Search Results

Search found 9106 results on 365 pages for 'course'.

Page 333/365 | < Previous Page | 329 330 331 332 333 334 335 336 337 338 339 340  | Next Page >

  • Get value of element in Multi-Dimensional Array

    - by George
    Here is my foreach loop to get at the values from a multi-dimensional array $_coloredvariables = get_post_meta( $post->ID, '_coloredvariables', true ); foreach ($_coloredvariables as $key => $value) { var_dump($value); } Which outputs this: array 'label' => string 'Color' (length=5) 'size' => string 'small' (length=5) 'displaytype' => string 'square' (length=6) 'values' => array 'dark-night-angel' => array 'type' => string 'Image' (length=5) 'color' => string '#2c4065' (length=7) 'image' => string '' (length=0) 'forest-green' => array 'type' => string 'Color' (length=5) 'color' => string '#285d5f' (length=7) 'image' => string '' (length=0) 'voilet' => array 'type' => string 'Color' (length=5) 'color' => string '#6539c9' (length=7) 'image' => string '' (length=0) 'canary-yellow' => array 'type' => string 'Color' (length=5) 'color' => string 'grey' (length=4) 'image' => string '' (length=0) And then to only get the values array I can do this: foreach ($_coloredvariables as $key => $value) { var_dump($value['values']); } which outputs this: array 'dark-night-angel' => array 'type' => string 'Image' (length=5) 'color' => string '#2c4065' (length=7) 'image' => string '' (length=0) 'forest-green' => array 'type' => string 'Color' (length=5) 'color' => string '#285d5f' (length=7) 'image' => string '' (length=0) 'voilet' => array 'type' => string 'Color' (length=5) 'color' => string '#6539c9' (length=7) 'image' => string '' (length=0) 'canary-yellow' => array 'type' => string 'Color' (length=5) 'color' => string 'grey' (length=4) 'image' => string '' (length=0) What I can't figure out is how to get these elements in the array structure "dark-night-angel", "forest-green", "voilet", "canary-yellow" Without using specific names: var_dump($value['values']['dark-night-angel']) Something that is more dynamic, of course this doesn't work: var_dump($value['values'][0][0]); thanks

    Read the article

  • Remove links with Javascript

    - by Arlen Beiler
    How do I remove links from a webpage with Javascript. I am using Google Chrome. The code I tried is: function removehyperlinks() { try { alert(document.anchors.length); alert(document.getElementsByTagName('a')); for(i=0;i=document.anchors.length;i++) { var a = document.anchors[i]; a.outerHTML = a.innerHTML; var b = document.getElementsByTagName('a'); b[i].outerHTML = b[i].innerHTML; } } catch(e) { alert (e);} alert('done'); } Of course, this is test code, which is why I have the alerts and 2 things trying at the same time. The first alert returns "0" the second [Object NodeList] and the third returns "done". My html body looks like this: <body onload="removehyperlinks()"> <ol style="text-align:left;" class="messagelist"> <li class="accesscode"><a href="#">General information, Updates, &amp; Meetings<span class="extnumber">141133#</span></a> <ol> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li start="77"><a href="#"">...</a></li> <li start="88"><a href="#">...</a></li> <li start="99"><a href="#">...</a></li> </ol> </li> </ol> </body>

    Read the article

  • drupal (CMS) or codeigniter (MVC) for creating a new web application?

    - by ajsie
    im going to create a new web application that is very customized. it will contain images, that are fully searchable - in a very, very customized way. when you click on the pictures you can add comments and so on. it requires users to be registered, but the registration/login process will be highly customized too. at the moment im using CodeIgniter for this. But i've read a lot of posts about CMS like Drupal and it sounds like i could let it handle basic stuff, maybe design and other front end work. i have no experience with CMS, in fact, i just started to use a MVC framework like CI and was impressed of how much easier it gets to start developing. so i wonder, if i'm going to create this kind of application, could i use drupal and then add the usual stuff, as i was going to do with CodeIgniter, like controllers, views, models, config files, my own libraries and so on? how does it work on a system like Drupal. how do you code PHP with it as with any MVC framework. it sounds like it has a lot of modules, i just wonder, if i can use it as a MVC framework but have the benefit of having all these basic stuff and design ready to use? cause then it sounds like the best "library" to provide for a web application from scratch. or is it difficult to create a customized app with it? i guess it has modules like images and users, but then how could i customize these so that every image has tags on it and country information, or have every user subscribing to changes to an image, that email will be sent to users and so on? cause i guess its easy to install a module. the question is, how do i customize it. maybe i don't need all that table columns. maybe i want to add/remove business logic. what are the pros and cons with using Drupal for this? is it even the right way to go? can you make a Stackoverflow with Drupal? Facebook? Twitter? Youtube? assuming that you know php of course. share your thoughts cause im totally new on creating a web application! thanks

    Read the article

  • Google Code + SVN or GitHub + Git

    - by Nazgulled
    Let me start by telling you that I never used anything besides SVN and I'm also a Windows user. I have a couple of simple projects that are open-source, others are on there way when I'm happy enough to release their source code but either way, I was thinking of using Google Code and SVN to share the source code of my projects instead of providing a link to the source on my website. This as always been a pain cause I had to update the binaries and the code every time I released a new version. This would also help me out to have a backup of my code some where instead of just my local machine (I used to have a local Subversion server running). What I want from a service like this is very simple... I just want a place to store my source code that people can download if they want, allows me to control revisions and provide a simple and easy issue system so people can submit bugs and stuff like that. I guess both of them have this. But I don't want to host any binaries in their websites, I want this to be hosted on my website so I can control download statistics with my own scripts, I also don't have the need for wiki pages as I prefer to have all the documentation in my own website. Does anyone of this services provide a way to "disable" features like wiki and downloads and don't show them at all for my project(s)? Now, I'm sure there are lots of pros and cons about using Google Code with SVN and GitHub with Git (of course) but here's what it's important for me on each one and why I like them: Google Code: As with any Google page, the complexity is almost non-existent Everyone (or almost) as a Google account and this is nice if people want to report problems using the issues system GitHub: May (or may not) be a little more complex (not a problem for me though) than Google's pages but... ...has a much prettier interface than Google's service It needs people to be registered on GitHub to post about issues I like the fact that with Git, you have your own revisions locally (can I use TortoiseGit for this or?) Basically that's it, not much I know... What other, most common, pros and cons can you tell me about each site/software? Keep in mind that my projects are simple, I'm probably the only one who will ever develop these projects on these repositories (or maybe not, for now I will)

    Read the article

  • java web application best practices

    - by Bruce
    Hi all I'm trying to figure out the optimum way to develop and release a fairly simple web application, and I'm running into several problems. I'll outline the decisions I've made, because somewhere I've clearly gone off the rails.. Hugely grateful for any help! I have what I think is a fairly simple web application. It contains a couple of jsps that reference a couple of java beans, and the usual static html, js, css and images. Decision 1) I wanted to have a clear and clean release procedure, such that I could develop on my local machine and then release reliably to a production machine. I therefore made the decision to package the application into a war file (including all the static resources), to minimize the separate bits and pieces I would need to release. So far so good? Decision 2) I wanted things on my local machine to be as similar as possible to the production environment. So in my html, for example, I may have a reference to a static file such as http://static.foo.com/file . To keep this code working seamlessly on dev and prod, I decided to put static.foo.com in my /etc/hosts when developing locally, so that all the urls work correctly without changing anything. Decision 3) I decided to use eclipse and maven to give me a best practice environment for administering and building my project. So I have a nice tight set up now, except that: Every time I want to change anything in development, like one line in an html file, I have to rebuild the entire project and then wait for tomcat to load the war before I can see if it's what I wanted. So my questions are: 1) Is there a way to connect up eclipse and tomcat so that I don't have to rebuild the war each time? ie tomcat is looking straight at my actual workspace to serve up the static files? 2)I think I'm maybe making things harder by using /etc/hosts to reflect production urls - is there a better way that doesn't involve manually changing over urls (relative urls are fine of course, but where you have many subdomains, say one for static files and one for dynamic, you have to write out the full path, surely?) 3) Is this really best practice?? How do people set things up so that they balance the requirement for an automated, all-encompassing build process on the one hand, and the speed and flexibility to be able to develop javascript and html and css quickly, as quickly as if one just pointed apache at the directory and developed live? What do people find works? Many thanks!

    Read the article

  • How to obtain the first cluster of the directory's data in FAT using C# (or at least C++) and Win32A

    - by DarkWalker
    So I have a FAT drive, lets say H: and a directory 'work' (full path 'H:\work'). I need to get the NUMBER of the first cluster of that directory. The number of the first cluster is 2-bytes value, that is stored in the 26th and 27th bytes of the folder enty (wich is 32 bytes). Lets say I am doing it with file, NOT a directory. I can use code like this: static public string GetDirectoryPtr(string dir) { IntPtr ptr = CreateFile(@"H:\Work\dover.docx", GENERIC_READ, FILE_SHARE_READ | FILE_SHARE_WRITE, IntPtr.Zero, OPEN_EXISTING, 0,//FILE_FLAG_BACKUP_SEMANTICS, IntPtr.Zero); try { const uint bytesToRead = 2; byte[] readbuffer = new byte[bytesToRead]; if (ptr.ToInt32() == -1) return String.Format("Error: cannot open direcotory {0}", dir); if (SetFilePointer(ptr, 26, 0, 0) == -1) return String.Format("Error: unable to set file pointer on file {0}", ptr); uint read = 0; // real count of read bytes if (!ReadFile(ptr, readbuffer, bytesToRead, out read, 0)) return String.Format("cant read from file {0}. Error #{1}", ptr, Marshal.GetLastWin32Error()); int result = readbuffer[0] + 16 * 16 * readbuffer[1]; return result.ToString();//ASCIIEncoding.ASCII.GetString(readbuffer); } finally { CloseHandle(ptr); } } And it will return some number, like 19 (quite real to me, this is the only file on the disk). But I DONT need a file, I need a folder. So I am puttin FILE_FLAG_BACKUP_SEMANTICS param for CreateFile call... and dont know what to do next =) msdn is very clear on this issue http://msdn.microsoft.com/en-us/library/aa365258(v=VS.85).aspx It sounds to me like: "There is no way you can get a number of the folder's first cluster". The most desperate thing is that my tutor said smth like "You are going to obtain this or you wont pass this course". The true reason why he is so sure this is possible is because for 10 years (or may be more) he recieved the folder's first cluster number as a HASH of the folder's addres (and I was stupid enough to point this to him, so now I cant do it the same way) PS: This is the most spupid task I have ever had!!! This value is not really used anythere in program, it is only fcking pointless integer.

    Read the article

  • output with "Private`" Content in Mathematica Package

    - by madalina
    Hello everyone, I am trying to solve the following implementation problem in Mathematica 7.0 for some days now and I do not understand exactly what is happening so I hope someone can give me some hints. I have 3 functions that I implemented in Mathematica in a source file with extension *.nb. They are working okay to all the examples. Now I want to put these functions into 3 different packages. So I created three different packages with extension .*m in which I put all the desired Mathematica function. An example in the "stereographic.m" package which contain the code: BeginPackage["stereographic`"] stereographic::usage="The package stereographic...." formEqs::usage="The function formEqs[complexBivPolyEqn..." makePoly::usage="The function makePoly[algebraicEqn] ..." getFixPolys::usage="The function..." milnorFibration::usage="The function..." Begin["Private`"] Share[]; formEqs[complex_,{m_,n_}]:=Block[{complexnew,complexnew1, realeq, imageq, expreal, expimag, polyrealF, polyimagF,s,t,u,v,a,b,c,epsilon,x,y,z}, complexnew:=complex/.{m->s+I*t,n->u+I*v}; complexnew1:=complexnew/.{s->(2 a epsilon)/(1+a^2+b^2+c^2),t->(2 b epsilon)/(1+a^2+b^2+c^2),u->(2 c epsilon)/(1+a^2+b^2+c^2),v->(- epsilon+a^2 epsilon+b^2 epsilon+c^2 epsilon)/(1+a^2+b^2+c^2)}; realeq:=ComplexExpand[Re[complexnew1]]; imageq:=ComplexExpand[Im[complexnew1]]; expreal:=makePoly[realeq]; expimag:=makePoly[imageq]; polyrealF:=expreal/.{a->x,b->y,c->z}; polyimagF:=expimag/.{a->x,b->y,c->z}; {polyrealF,polyimagF} ] End[] EndPackage[] Now to test the function I load the package Needs["stereographic`"] everything is okay. But when I test the function for example with formEqs[x^2-y^2,{x,y}] I get the following ouput: {Private`epsilon^2 + 2 Private`x^2 Private`epsilon^2 + Private`x^4 Private`epsilon^2 - 6 Private`y^2 Private`epsilon^2 + 2 Private`x^2 Private`y^2 Private`epsilon^2 + Private`y^4 Private`epsilon^2 - 6 Private`z^2 Private`epsilon^2 + 2 Private`x^2 Private`z^2 Private`epsilon^2 + 2 Private`y^2 Private`z^2 Private`epsilon^2 + Private`z^4 Private`epsilon^2, 8 Private`x Private`y Private`epsilon^2 + 4 Private`z Private`epsilon^2 - 4 Private`x^2 Private`z Private`epsilon^2 - 4 Private`y^2 Private`z Private`epsilon^2 - 4 Private`z^3 Private`epsilon^2} Of course I do not understand why Private` appears in front of any local variable which I returned in the final result. I would want not to have this Private` in the computed output. Any idea or better explanations which could indicate me why this happens? Thank you very much for your help. Best wishes, madalina

    Read the article

  • Implementing coroutines in Java

    - by JUST MY correct OPINION
    This question is related to my question on existing coroutine implementations in Java. If, as I suspect, it turns out that there is no full implementation of coroutines currently available in Java, what would be required to implement them? As I said in that question, I know about the following: You can implement "coroutines" as threads/thread pools behind the scenes. You can do tricksy things with JVM bytecode behind the scenes to make coroutines possible. The so-called "Da Vinci Machine" JVM implementation has primitives that make coroutines doable without bytecode manipulation. There are various JNI-based approaches to coroutines also possible. I'll address each one's deficiencies in turn. Thread-based coroutines This "solution" is pathological. The whole point of coroutines is to avoid the overhead of threading, locking, kernel scheduling, etc. Coroutines are supposed to be light and fast and to execute only in user space. Implementing them in terms of full-tilt threads with tight restrictions gets rid of all the advantages. JVM bytecode manipulation This solution is more practical, albeit a bit difficult to pull off. This is roughly the same as jumping down into assembly language for coroutine libraries in C (which is how many of them work) with the advantage that you have only one architecture to worry about and get right. It also ties you down to only running your code on fully-compliant JVM stacks (which means, for example, no Android) unless you can find a way to do the same thing on the non-compliant stack. If you do find a way to do this, however, you have now doubled your system complexity and testing needs. The Da Vinci Machine The Da Vinci Machine is cool for experimentation, but since it is not a standard JVM its features aren't going to be available everywhere. Indeed I suspect most production environments would specifically forbid the use of the Da Vinci Machine. Thus I could use this to make cool experiments but not for any code I expect to release to the real world. This also has the added problem similar to the JVM bytecode manipulation solution above: won't work on alternative stacks (like Android's). JNI implementation This solution renders the point of doing this in Java at all moot. Each combination of CPU and operating system requires independent testing and each is a point of potentially frustrating subtle failure. Alternatively, of course, I could tie myself down to one platform entirely but this, too, makes the point of doing things in Java entirely moot. So... Is there any way to implement coroutines in Java without using one of these four techniques? Or will I be forced to use the one of those four that smells the least (JVM manipulation) instead?

    Read the article

  • get renamed file names of multiple upload form [js array] in codeigniter

    - by artmania
    Hi friends, I use codeigniter. I have a multiple image upload form. The code below is working well for uploading, but I also need to save file names to database. How can I get the names in here? I spent hours & hours :/ but could not sort it :/ Appreciate helps!!! uploadform.php echo form_open_multipart('gallery/upload'); <input type="file" name="photo" size="50" /> <input type="file" name="thumb" size="50" /> <input type="submit" value="Upload" /> </form> I have a controller between form view and model load model (of course : )) but didnt post here because of no need. gallery_model.php function multiple_upload($upload_dir = 'uploads/', $config = array()) { /* Upload */ $CI =& get_instance(); $files = array(); if(empty($config)) { $config['upload_path'] = realpath($upload_dir); $config['allowed_types'] = 'gif|jpg|jpeg|jpe|png'; $config['max_size'] = '2048'; } $CI->load->library('upload', $config); $errors = FALSE; foreach($_FILES as $key => $value) { if( ! empty($value['name'])) { if( ! $CI->upload->do_upload($key)) { $data['upload_message'] = $CI->upload->display_errors(ERR_OPEN, ERR_CLOSE); // ERR_OPEN and ERR_CLOSE are error delimiters defined in a config file $CI->load->vars($data); $errors = TRUE; } else { // Build a file array from all uploaded files $files[] = $CI->upload->data(); } } } // There was errors, we have to delete the uploaded files if($errors) { foreach($files as $key => $file) { @unlink($file['full_path']); } } elseif(empty($files) AND empty($data['upload_message'])) { $CI->lang->load('upload'); $data['upload_message'] = ERR_OPEN.$CI->lang->line('upload_no_file_selected').ERR_CLOSE; $CI->load->vars($data); } else { return $files; } /* ------------------------------- Insert to database */ // problem is here, i need file names to add db. // if there is already same names file at the folder, it rename file itself. so in such case, I need renamed file name :/ } }

    Read the article

  • what to do with a flawed C++ skills test

    - by Mike Landis
    In the following gcc.gnu.org post, Nathan Myers says that a C++ skills test at SANS Consulting Services contained three errors in nine questions: Looking around, one of fthe first on-line C++ skills tests I ran across was: http://www.geekinterview.com/question_details/13090 I looked at question 1... find(int x,int y) { return ((x<y)?0:(x-y)):} call find(a,find(a,b)) use to find (a) maximum of a,b (b) minimum of a,b (c) positive difference of a,b (d) sum of a,b ... immediately wondering why would anyone write anything so obtuse. Getting past the absurdity, I didn't really like any of the answers, immediately eliminating (a) and (b) because you can get back zero (which is neither a nor b) in a variety of circumstances. Sum or difference seemed more likely, except that you could also get zero regardless of the magnitudes of a and b. So... I put Matlab to work (code below) and found: when either a or b is negative you get zero; when b a you get a; otherwise you get b, so the answer is (b) min(a,b), if a and b are positive, though strictly speaking the answer should be none of the above because there are no range restrictions on either variable. That forces test takers into a dilemma - choose the best available answer and be wrong in 3 of 4 quadrants, or don't answer, leaving the door open to the conclusion that the grader thinks you couldn't figure it out. The solution for test givers is to fix the test, but in the interim, what's the right course of action for test takers? Complain about the questions? function z = findfunc(x,y) for i=1:length(x) if x(i) < y(i) z(i) = 0; else z(i) = x(i) - y(i); end end end function [b,d1,z] = plotstuff() k = 50; a = [-k:1:k]; b = (2*k+1) * rand(length(a),1) - k; d1 = findfunc(a,b); z = findfunc(a,d1); plot( a, b, 'r.', a, d1, 'g-', a, z, 'b-'); end

    Read the article

  • Learning... anything really

    - by WebDevHobo
    I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

    Read the article

  • Thoughts on streamlining multiple .Net apps

    - by John Virgolino
    We have a series of ASP.Net applications that have been written over the course of 8 years. Mostly in the first 3-4 years. They have been running quite well with little maintenance, but new functionality is being requested and we are running into IDE and platform issues. The apps were written in .Net 1.x and 2.x and run in separate spaces but are presented as a single suite of applications which use a common navigation toolbar (implemented as a user control). Every time we want to add something to a menu in the nav we have to modify it in all the apps which is a pain. Also, the various versions of Crystal reports and that we used tables to organize the visual elements and we end up with a mess, especially with all the multi-platform .Net versions running. We need to streamline the suite of apps and make it easier to add on new apps without a hassle. We also need to bring all these apps under one .Net platform and IDE. In addition, there is a WordPress blog styled to match the style of the application suite "integrated" into the UI and a link to a MediaWiki Wiki application as well. My current thinking is to use an open source content management system (CMS) like Joomla (PHP based unfortunately, but it works well) as the user interface framework for style templating and menu management. Joomla's article management would allow us to migrate the Wiki content into articles which could be published without interfering with the .Net apps. Then essentially use an IFrame within an "article" to "host" the .Net application, then... Upgrade the .Net apps to VS2010, strip out all the common header/footer controls and migrate the styles to use the style sheets used in the CMS. As I write this, I certainly realize this is a lot of work and there are optimization issues which this may cause as well as using IFrames seems a bit like cheating and I've read about issues with IFrames. I know that we could use .Net application styling, but it seems like a lot more work (not sure really). Also, the use of a CMS to handle the blog and wiki also seems appealing, unless there is a .Net CMS out there that can handle all of these requirements. Given this information, I am looking to know if I am totally going in the wrong direction? We tried to use open source and integrate it over time, but not this has become hard to maintain. Am I not aware of some technology out there that will meet our requirements? Did we do this right and should we just focus on getting the .Net streamlined? I understand that no matter what we do, it's going to be a lot of work. The communities considerable experience would be helpful. Thanks!! PS - A complete rewrite is not an option.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • dynamically embedding youtube videos with jquery

    - by danwoods
    Hello all, I'm trying to retrieve a listing of a user's youtube videos and embed them in a page using jQuery. My code looks something like this: $(document).ready(function() { //some variables var fl_obj_template = $('<object width="260" height="140">' + '<param name="movie" value=""></param>' + '<param name="allowFullScreen" value="true"></param>' + '<param name="allowscriptaccess" value="always"></param>' + '<embed src="" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="260" height="140"></embed>' + '</object>'); var video_elm_arr = $('.video'); //hide videos until ready $('.video').addClass('hidden'); //pull video data from youtube $.ajax({ url: 'http://gdata.youtube.com/feeds/api/users/username/uploads?alt=json', dataType: 'jsonp', success: function(data) { $.each(data.feed.entry, function(i,item){ //only take the first 7 videos if(i > 6) return; //give the video element a flash object var cur_flash_obj = fl_obj_template; //assign title $(video_elm_arr[i]).find('.video_title').html(item.title.$t); //clean url var video_url = item.media$group.media$content[0].url; var index = video_url.indexOf("?"); if (index > 0) video_url = video_url.substring(0, index); //and asign it to the player's parameters $(cur_flash_obj).find('object param[name="movie"]').attr('value', video_url); $(cur_flash_obj).find('object embed').attr('src', video_url); //alert(cur_flash_obj); //insert flash object in video element $(video_elm_arr[i]).append(cur_flash_obj); //and show $(video_elm_arr[i]).removeClass('hidden'); }); } }); }); (of course with 'username' being the actual username). The video titles appear correctly but no videos show up. What gives? The target html looks like: <div id="top_row_center" class="video_center video"> <p class="video_title"></p> </div>

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • C++ - Breaking code implementation into different parts

    - by Kotti
    Hi! The question plot (a bit abstract, but answering this question will help me in my real app): So, I have some abstract superclass for objects that can be rendered on the screen. Let's call it IRenderable. struct IRenderable { // (...) virtual void Render(RenderingInterface& ri) = 0; virtual ~IRenderable() { } }; And suppose I also have some other objects that derive from IRenderable, e.g. Cat and Dog. So far so good. I add some Cat and Dog specific methods, like SeekForWhiskas(...) and Bark(...). After that I add specific Render(...) method for them, so my code looks this way: class Cat : public IRenderable { public: void SeekForWhiskas(...) { // Implementation could be here or moved // to a source file (depends on me wanting // to inline it or not) } virtual void Render(...) { // Here comes the rendering routine, that // is specific for cats SomehowDrawAppropriateCat(...); } }; class Dog : public IRenderable { public: void Bark(...) { // Same as for 'SeekForWhiskas(...)' } virtual void Render(...) { // Here comes the rendering routine, that // is specific for dogs DrawMadDog(...); } }; And then somewhere else I can do drawing the way that an appropriate rendering routine is called: IRenderable* dog = new Dog(); dog->Render(...); My question is about logical wrapping of such kind of code. I want to break apart the code, that corresponds to rendering of the current object and it's own methods (Render and Bark in this example), so that my class implementation doesn't turn into a mess (imagine that I have 10 methods like Bark and of course my Render method doesn't fit in their company and would be hard to find). Two ways of making what I want to (as far as I know) are: Making appropriate routines that look like RenderCat(Cat& cat, RenderInterface* ri), joining them to render namespace and then the functions inside a class would look like virtual void Render(...) { RenderCat(*this, ...); }, but this is plain stupid, because I'll lose access to Cat's private members and friending these functions looks like a total design disaster. Using visitor pattern, but this would also mean I have to rebuild my app's design and looks like an inadequate way to make my code complicated from the very beginning. Any brilliant ideas? :)

    Read the article

  • Why is this simple Mobile Form not closed when using the player

    - by ajhvdb
    Hi, I created this simple sample Form with the close button. Everything is working as expected when NOT using the Interop.WMPLib.dll I've seen other applications using this without problems but why isn't the Form process closed when I just add the line: SoundPlayer myPlayer = new SoundPlayer(); and of course dispose it: if (myPlayer != null) { myPlayer.Dispose(); myPlayer = null; } The Form closes but the debugger VS2008 is still active. The Form project and the dll are still active. If you send me an email to [email protected], I can send you the zipped project. Below is the class for the dll: using System; using System.Collections.Generic; using System.Text; using System.Threading; using System.Runtime.InteropServices; using WMPLib; namespace WindowsMobile.Utilities { public delegate void SoundPlayerStateChanged(SoundPlayer sender, SoundPlayerState newState); public enum SoundPlayerState { Stopped, Playing, Paused, } public class SoundPlayer : IDisposable { [DllImport("coredll")] public extern static int waveOutSetVolume(int hwo, uint dwVolume); [DllImport("coredll")] public extern static int waveOutGetVolume(int hwo, out uint dwVolume); WindowsMediaPlayer myPlayer = new WindowsMediaPlayer(); public SoundPlayer() { myPlayer.uiMode = "invisible"; myPlayer.settings.volume = 100; } string mySoundLocation = string.Empty; public string SoundLocation { get { return mySoundLocation; } set { mySoundLocation = value; } } public void Pause() { myPlayer.controls.pause(); } public void PlayLooping() { Stop(); myPlayer.URL = mySoundLocation; myPlayer.settings.setMode("loop", true); } public int Volume { get { return myPlayer.settings.volume; } set { myPlayer.settings.volume = value; } } public void Play() { Stop(); myPlayer.URL = mySoundLocation; myPlayer.controls.play(); } public void Stop() { myPlayer.controls.stop(); myPlayer.close(); } #region IDisposable Members public void Dispose() { try { Stop(); } catch (Exception) { } // need this otherwise the process won't exit?! try { int ret = Marshal.FinalReleaseComObject(myPlayer); } catch (Exception) { } myPlayer = null; GC.Collect(); } #endregion } }

    Read the article

  • Hibernate3: Self-Referencing Objects

    - by monojohnny
    Need some help on understanding how to do this; I'm going to be running recursive 'find' on a file system and I want to keep the information in a single DB table - with a self-referencing hierarchial structure: This is my DB Table structure I want to populate. DirObject Table: id int NOT NULL, name varchar(255) NOT NULL, parentid int NOT NULL); Here is the proposed Java Class I want to map (Fields only shown): public DirObject { int id; String name; DirObject parent; ... For the 'root' directory was going to use parentid=0; real ids will start at 1, and ideally I want hibernate to autogenerate the ids. Can somebody provide a suggested mapping file for this please; as a secondary question I thought about doing the Java Class like this instead: public DirObject { int id; String name; List<DirObject> subdirs; Could I use the same data model for either of these two methods ? (With a different mapping file of course). --- UPDATE: so I tried the mapping file suggested below (thanks!), repeated here for reference: <hibernate-mapping> <class name="my.proj.DirObject" table="category"> ... <set name="subDirs" lazy="true" inverse="true"> <key column="parentId"/> <one-to-many class="my.proj.DirObject"/> </set> <many-to-one name="parent" class="my.proj.DirObject" column="parentId" cascade="all" /> </class> ...and altered my Java class to have BOTH 'parentid' and 'getSubDirs' [returning a 'HashSet']. This appears to work - thanks, but this is the test code I used to drive this - I think I'm not doing something right here, because I thought Hibernate would take care of saving the subordinate objects in the Set without me having to do this explicitly ? DirObject dirobject=new DirObject(); dirobject.setName("/files"); dirobject.setParent(dirobject); DirObject d1, d2; d1=new DirObject(); d1.setName("subdir1"); d1.setParent(dirobject); d2=new DirObject(); d2.setName("subdir2"); d2.setParent(dirobject); HashSet<DirObject> subdirs=new HashSet<DirObject>(); subdirs.add(d1); subdirs.add(d2); dirobject.setSubdirs(subdirs); session.save(dirobject); session.save(d1); session.save(d2);

    Read the article

  • Which style is preferable when writing this boolean expression?

    - by Jeppe Stig Nielsen
    I know this question is to some degree a matter of taste. I admit this is not something I don't understand, it's just something I want to hear others' opinion about. I need to write a method that takes two arguments, a boolean and a string. The boolean is in a sense (which will be obvious shortly) redundant, but it is part of a specification that the method must take in both arguments, and must raise an exception with a specific message text if the boolean has the "wrong" value. The bool must be true if and only if the string is not null or empty. So here are some different styles to write (hopefully!) the same thing. Which one do you find is the most readable, and compliant with good coding practice? // option A: Use two if, repeat throw statement and duplication of message string public void SomeMethod(bool useName, string name) { if (useName && string.IsNullOrEmpty(name)) throw new SomeException("..."); if (!useName && !string.IsNullOrEmpty(name)) throw new SomeException("..."); // rest of method } // option B: Long expression but using only && and || public void SomeMethod(bool useName, string name) { if (useName && string.IsNullOrEmpty(name) || !useName && !string.IsNullOrEmpty(name)) throw new SomeException("..."); // rest of method } // option C: With == operator between booleans public void SomeMethod(bool useName, string name) { if (useName == string.IsNullOrEmpty(name)) throw new SomeException("..."); // rest of method } // option D1: With XOR operator public void SomeMethod(bool useName, string name) { if (!(useName ^ string.IsNullOrEmpty(name))) throw new SomeException("..."); // rest of method } // option D2: With XOR operator public void SomeMethod(bool useName, string name) { if (useName ^ !string.IsNullOrEmpty(name)) throw new SomeException("..."); // rest of method } Of course you're welcome to suggest other possibilities too. Message text "..." would be something like "If 'useName' is true a name must be given, and if 'useName' is false no name is allowed".

    Read the article

  • Creating multiple heads in remote repository

    - by Jab
    We are looking to move our team (~10 developers) from SVN to mercurial. We are trying to figure out how to manage our workflow. In particular, we are trying to see if creating remote heads is the right solution. We currently have a very large repository with multiple, related projects. They share a lot of code, but pieces of the project are deployed by different teams (3 teams) independent of other portions of the code-base. So each team is working on concurrent large features. The way we currently handles this in SVN are branches. Team1 has a branch for Feature1, same deal for the other teams. When Team1 finishes their change, it gets merged into the trunk and deployed out. The other teams follow suite when their project is complete, merging of course. So my initial thought are using Named Branches for these situations. Team1 makes a Feature1 branch off of the default branch in Hg. Now, here is the question. Should the team PUSH that branch, in it's current/half-state to the repository. This will create a second head in the core repo. My initial reaction was "NO!" as it seems like a bad idea. Handling multiple heads on our repository just sounds awful, but there are some advantages... First, the teams want to setup Continuous Integration to build this branch during their development cycle(months long). This will only work if the CI can pull this branch from the repo. This is something we do now with SVN, copy a CI build and change the branch. Easy. Second, it makes it easier for any team member to jump onto the branch and start working. Without pushing to the core repo, they would have to receive a push from a developer on that team with the changeset information. It is also possible to lose local commits to hardware failure. The chances increase a lot if it's a branch by a single developer who has followed the "don't push until finished" approach. And lastly is just for ease of use. The developers can easily just commit and push on their branch at any time without consequence(as they do today, in their SVN branches). Is there a better way to handle this scenario that I may be missing? I just want a veteran's opinion before moving forward with the strategy. For bug fixes we like the general workflow of mecurial, anonymous branches that only consist of 1-2 commits. The simplicity is great for those cases. By the way, I've read this , great article which seems to favor Named branches.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • casting doubles to integers in order to gain speed

    - by antirez
    Hello all, in Redis (http://code.google.com/p/redis) there are scores associated to elements, in order to take this elements sorted. This scores are doubles, even if many users actually sort by integers (for instance unix times). When the database is saved we need to write this doubles ok disk. This is what is used currently: snprintf((char*)buf+1,sizeof(buf)-1,"%.17g",val); Additionally infinity and not-a-number conditions are checked in order to also represent this in the final database file. Unfortunately converting a double into the string representation is pretty slow. While we have a function in Redis that converts an integer into a string representation in a much faster way. So my idea was to check if a double could be casted into an integer without lost of data, and then using the function to turn the integer into a string if this is true. For this to provide a good speedup of course the test for integer "equivalence" must be fast. So I used a trick that is probably undefined behavior but that worked very well in practice. Something like that: double x = ... some value ... if (x == (double)((long long)x)) use_the_fast_integer_function((long long)x); else use_the_slow_snprintf(x); In my reasoning the double casting above converts the double into a long, and then back into an integer. If the range fits, and there is no decimal part, the number will survive the conversion and will be exactly the same as the initial number. As I wanted to make sure this will not break things in some system, I joined #c on freenode and I got a lot of insults ;) So I'm now trying here. Is there a standard way to do what I'm trying to do without going outside ANSI C? Otherwise, is the above code supposed to work in all the Posix systems that currently Redis targets? That is, archs where Linux / Mac OS X / *BSD / Solaris are running nowaday? What I can add in order to make the code saner is an explicit check for the range of the double before trying the cast at all. Thank you for any help.

    Read the article

  • Loading the last related record instantly for multiple parent records using Entity framework

    - by Guillaume Schuermans
    Does anyone know a good approach using Entity Framework for the problem described below? I am trying for our next release to come up with a performant way to show the placed orders for the logged on customer. Of course paging is always a good technique to use when a lot of data is available I would like to see an answer without any paging techniques. Here's the story: a customer places an order which gets an orderstatus = PENDING. Depending on some strategy we move that order up the chain in order to get it APPROVED. Every change of status is logged so we can see a trace for statusses and maybe even an extra line of comment per status which can provide some extra valuable information to whoever sees this order in an interface. So an Order is linked to a Customer. One order can have multiple orderstatusses stored in OrderStatusHistory. In my testscenario I am using a customer which has 100+ Orders each with about 5 records in the OrderStatusHistory-table. I would for now like to see all orders in one page not using paging where for each Order I show the last relevant Status and the extra comment (if there is any for this last status; both fields coming from OrderStatusHistory; the record with the highest Id for the given OrderId). There are multiple scenarios I have tried, but I would like to see any potential other solutions or comments on the things I have already tried. Trying to do Include() when getting Orders but this still results in multiple queries launched on the database. Each order triggers an extra query to the database to get all orderstatusses in the history table. So all statusses are queried here instead of just returning the last relevant one, plus 100 extra queries are launched for 100 orders. You can imagine the problem when there are 100000+ orders in the database. Having 2 computed columns on the database: LastStatus, LastStatusInformation and a regular Linq-Query which gets those columns which are available through the Entity-model. The problem with this approach is the fact that those computed columns are determined using a scalar function which can not be changed without removing the formula from the computed column, etc... In the end I am very familiar with SQL and Stored procedures, but since the rest of the data-layer uses Entity Framework I would like to stick to it as long as possible, even though I have my doubts about performance. Using the SQL approach I would write something like this: WITH cte (RN, OrderId, [Status], Information) AS ( SELECT ROW_NUMBER() OVER (PARTITION BY OrderId ORDER BY Id DESC), OrderId, [Status], Information FROM OrderStatus ) SELECT o.Id, cte.[Status], cte.Information AS StatusInformation, o.* FROM [Order] o INNER JOIN cte ON o.Id = cte.OrderId AND cte.RN = 1 WHERE CustomerId = @CustomerId ORDER BY 1 DESC; which returns all orders for the customer with the statusinformation provided by the Common Table Expression. Does anyone know a good approach using Entity Framework?

    Read the article

  • ASP.NET MVC 4/Web API Single Page App for Mobile Devices ... Needs Authentication

    - by lmttag
    We have developed an ASP.NET MVC 4/Web API single page, mobile website (also using jQuery Mobile) that is intended to be accessed only from mobile devices (e.g., iPads, iPhones, Android tables and phones, etc.), not desktop browsers. This mobile website will be hosted internally, like an intranet site. However, since we’re accessing it from mobile devices, we can’t use Windows authentication. We still need to know which user (and their role) is logging in to the mobile website app. We tried simply using ASP.NET’s forms authentication and membership provider, but couldn’t get it working exactly the way we wanted. What we need is for the user to be prompted for a user name and password only on the first time they access the site on their mobile device. After they enter a correct user name and password and have been authenticated once, each subsequent time they access the site they should just go right in. They shouldn’t have to re-enter their credentials (i.e., something needs to be saved locally to each device to identify the user after the first time). This is where we had troubles. Everything worked as expected the first time. That is, the user was prompted to enter a user name and password, and, after doing that, was authenticated and allowed into the site. The problem is every time after the browser was closed on the mobile device, the device and user were not know and the user had to re-enter user name and password. We tried lots of things too. We tried setting persistent cookies in JavaScript. No good. The cookies weren’t there to be read the second time. We tried manually setting persistent cookies from ASP.NET. No good. We, of course, used FormsAuthentication.SetAuthCookie(model.UserName, true); as part of the form authentication framework. No good. We tried using HTML5 local storage. No good. No matter what we tried, if the user was on a mobile device, they would have to log in every single time. (Note: we’ve tried on an iPad and iPhone running both iOS 5.1 and 6.0, with Safari configure to allow cookies, and we’ve tried on Android 2.3.4.) Is there some trick to getting a scenario like this working? Or, do we have to write some sort of custom authentication mechanism? If so, how? And, what? Or, should we use something like claims-based authentication and WIF? Or??? Any help is appreciated. Thanks!

    Read the article

< Previous Page | 329 330 331 332 333 334 335 336 337 338 339 340  | Next Page >