Search Results

Search found 9106 results on 365 pages for 'course'.

Page 334/365 | < Previous Page | 330 331 332 333 334 335 336 337 338 339 340 341  | Next Page >

• Thoughts on streamlining multiple .Net apps

  - by John Virgolino

  We have a series of ASP.Net applications that have been written over the course of 8 years. Mostly in the first 3-4 years. They have been running quite well with little maintenance, but new functionality is being requested and we are running into IDE and platform issues. The apps were written in .Net 1.x and 2.x and run in separate spaces but are presented as a single suite of applications which use a common navigation toolbar (implemented as a user control). Every time we want to add something to a menu in the nav we have to modify it in all the apps which is a pain. Also, the various versions of Crystal reports and that we used tables to organize the visual elements and we end up with a mess, especially with all the multi-platform .Net versions running. We need to streamline the suite of apps and make it easier to add on new apps without a hassle. We also need to bring all these apps under one .Net platform and IDE. In addition, there is a WordPress blog styled to match the style of the application suite "integrated" into the UI and a link to a MediaWiki Wiki application as well. My current thinking is to use an open source content management system (CMS) like Joomla (PHP based unfortunately, but it works well) as the user interface framework for style templating and menu management. Joomla's article management would allow us to migrate the Wiki content into articles which could be published without interfering with the .Net apps. Then essentially use an IFrame within an "article" to "host" the .Net application, then... Upgrade the .Net apps to VS2010, strip out all the common header/footer controls and migrate the styles to use the style sheets used in the CMS. As I write this, I certainly realize this is a lot of work and there are optimization issues which this may cause as well as using IFrames seems a bit like cheating and I've read about issues with IFrames. I know that we could use .Net application styling, but it seems like a lot more work (not sure really). Also, the use of a CMS to handle the blog and wiki also seems appealing, unless there is a .Net CMS out there that can handle all of these requirements. Given this information, I am looking to know if I am totally going in the wrong direction? We tried to use open source and integrate it over time, but not this has become hard to maintain. Am I not aware of some technology out there that will meet our requirements? Did we do this right and should we just focus on getting the .Net streamlined? I understand that no matter what we do, it's going to be a lot of work. The communities considerable experience would be helpful. Thanks!! PS - A complete rewrite is not an option.

  Read the article

• drupal (CMS) or codeigniter (MVC) for creating a new web application?

  - by ajsie

  im going to create a new web application that is very customized. it will contain images, that are fully searchable - in a very, very customized way. when you click on the pictures you can add comments and so on. it requires users to be registered, but the registration/login process will be highly customized too. at the moment im using CodeIgniter for this. But i've read a lot of posts about CMS like Drupal and it sounds like i could let it handle basic stuff, maybe design and other front end work. i have no experience with CMS, in fact, i just started to use a MVC framework like CI and was impressed of how much easier it gets to start developing. so i wonder, if i'm going to create this kind of application, could i use drupal and then add the usual stuff, as i was going to do with CodeIgniter, like controllers, views, models, config files, my own libraries and so on? how does it work on a system like Drupal. how do you code PHP with it as with any MVC framework. it sounds like it has a lot of modules, i just wonder, if i can use it as a MVC framework but have the benefit of having all these basic stuff and design ready to use? cause then it sounds like the best "library" to provide for a web application from scratch. or is it difficult to create a customized app with it? i guess it has modules like images and users, but then how could i customize these so that every image has tags on it and country information, or have every user subscribing to changes to an image, that email will be sent to users and so on? cause i guess its easy to install a module. the question is, how do i customize it. maybe i don't need all that table columns. maybe i want to add/remove business logic. what are the pros and cons with using Drupal for this? is it even the right way to go? can you make a Stackoverflow with Drupal? Facebook? Twitter? Youtube? assuming that you know php of course. share your thoughts cause im totally new on creating a web application! thanks

  Read the article

• grdb not working variables

  - by stupid_idiot

  hi, i know this is kinda retarded but I just can't figure it out. I'm debugging this: xor eax,eax mov ah,[var1] mov al,[var2] call addition stop: jmp stop var1: db 5 var2: db 6 addition: add ah,al ret the numbers that I find on addresses var1 and var2 are 0x0E and 0x07. I know it's not segmented, but that ain't reason for it to do such escapades, because the addition call works just fine. Could you please explain to me where is my mistake? I see the problem, dunno how to fix it yet though. The thing is, for some reason the instruction pointer starts at 0x100 and all the segment registers at 0x1628. To address the instruction the used combination is i guess [cs:ip] (one of the segment registers and the instruction pointer for sure). The offset to var1 is 0x10 (probably because from the begining of the code it's the 0x10th byte in order), i tried to examine the memory and what i got was: 1628:100 8 bytes 1628:108 8 bytes 1628:110 <- wtf? (assume another 8 bytes) 1628:118 ... whatever tricks are there in the memory [cs:var1] points somewhere else than in my code, which is probably where the label .data would usually address ds.... probably.. i don't know what is supposed to be at 1628:10 ok, i found out what caused the assness and wasted me whole fuckin day. the behaviour described above is just correct, the code is fully functional. what i didn't know is that grdb debugger for some reason sets the begining address to 0x100... the sollution is to insert the directive ORG 0x100 on the first line and that's the whole thing. the code was working because instruction pointer has the right address to first instruction and goes one by one, but your assembler doesn't know what effective address will be your program stored at so it pretty much remains relative to first line of the code which means all the variables (if not using label for data section) will remain pointing as if it started at 0x0. which of course wouldn't work with DOS. and grdb apparently emulates some DOS features... sry for the language, thx everyone for effort, hope this will spare someone's time if having the same problem... heheh.. at least now i know the reason why to use .data section :))))

  Read the article

• JAXB doesn't unmarshal list of interfaces

  - by Joker_vD

  It seems JAXB can't read what it writes. Consider the following code: interface IFoo { void jump(); } @XmlRootElement class Bar implements IFoo { @XmlElement public String y; public Bar() { y = ""; } public Bar(String y) { this.y = y; } @Override public void jump() { System.out.println(y); } } @XmlRootElement class Baz implements IFoo { @XmlElement public int x; public Baz() { x = 0; } public Baz(int x) { this.x = x; } @Override public void jump() { System.out.println(x); } } @XmlRootElement public class Holder { private List<IFoo> things; public Holder() { things = new ArrayList<>(); } @XmlElementWrapper @XmlAnyElement public List<IFoo> getThings() { return things; } public void addThing(IFoo thing) { things.add(thing); } } // ... try { JAXBContext context = JAXBContext.newInstance(Holder.class, Bar.class, Baz.class); Holder holder = new Holder(); holder.addThing(new Bar("1")); holder.addThing(new Baz(2)); holder.addThing(new Baz(3)); for (IFoo thing : holder.getThings()) { thing.jump(); } StringWriter s = new StringWriter(); context.createMarshaller().marshal(holder, s); String data = s.toString(); System.out.println(data); StringReader t = new StringReader(data); Holder holder2 = (Holder)context.createUnmarshaller().unmarshal(t); for (IFoo thing : holder2.getThings()) { thing.jump(); } } catch (Exception e) { System.err.println(e.getMessage()); } It's a simplified example, of course. The point is that I have to store two very differently implemented classes, Bar and Baz, in one collection. Well, I observed that they have pretty similar public interface, so I created an interface IFoo and made them two to implement it. Now, I want to have tools to save and load this collection to/from XML. Unfortunately, this code doesn't quite work: the collection is saved, but then it cannot be loaded! The intended output is 1 2 3 some xml 1 2 3 But unfortunately, the actual output is 1 2 3 some xml com.sun.org.apache.xerces.internal.dom.ElementNSImpl cannot be cast to testapplication1.IFoo Apparently, I need to use the annotations in a different way? Or to give up on JAXB and look for something else? I, well, can write "XMLNode toXML()" method for all classes I wan't to (de)marshal, but...

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Settings designer file complains when protecting configuration for connectionStrings in App.Config i

  - by Joe

  Hi, I am trying to encrypt Configuration Information Using Protected Configuration in Visual Studio 2010. I have the following info speicifed in the App.Config file: <connectionStrings configProtectionProvider="TheProviderName"> <EncryptedData> <CipherData> <CipherValue>VALUE GOES HERE</CipherValue> </CipherData> </EncryptedData> </connectionStrings> <appSettings configProtectionProvider="TheProviderName"> <EncryptedData> <CipherData> <CipherValue>VALUE GOES HERE</CipherValue> </CipherData> </EncryptedData> </appSettings> However, when I then go to the Settings area of the Projects Properties to view the settings in the Designer, I get prompted with the following error "An error occured while reading the App.config file. The file might be corrupted or contain invalid XML." I understand that my changes are causing the error, however, is there anyway I can bypass that the information is not read into at design view? (Of course the best way would be to make the tags be recognized by the designer, is there any way to do this?) I tried adding <connectionStrings configProtectionProvider="TheProviderName" xmlns="http://schemas.microsoft.com/.NetConfiguration/v2.0"> to connectionStrings as well as to the appSettings, but with no luck, the intellisense is bypassed in the config file, but the designer still complains. I would be satisfied if the designer would not complain about this "error", which is not actually an error because Microsoft states here that it should work. ASP.NET 2.0 provides a new feature, called protected configuration, that enables you to encrypt sensitive information in a configuration file. Although primarily designed for ASP.NET, protected configuration can also be used to encrypt configuration file sections in Windows applications. For a detailed description of the new protected configuration capabilities, see Encrypting Configuration Information Using Protected Configuration. And yes, it does work to encrypt it and to decrypt it and use it, it is just very annoying and frustrating that the designer complains about it. Anyone who knows which xsd file that is used (if used) to verify the contents of the App.config file in the design view? Any help appreciated.

  Read the article

• sed - trying to replace first occurrence after a match

  - by wakkaluba

  I am facing a situation that drives me nuts. I am setting up an update server which uses a json file. Don't ask why or how, it sucks and is my only possibility to achieve it. I have been trying and researching for HOURS (many) because I went ballistic and wanted to crack this on my own. But I have to realize I got stuck and need help. So sorry for this chunk but I think it is somewhat important to see... The file is a one liner and repeating the following sequence with changing values (of course). "plugin_name_foo_bar": {"buildDate": "bla", "dependencies": [{"name": "bla", "optional": true, "version": "1.00"}], "developers": [{"developerId": "bla", "email": "[email protected]", "name": "Bla bla2nd"}], "excerpt": "some text {excerpt} !bla.png|thumbnail,border=1! ", "gav": "bla", "labels": ["report", "scm-related"], "name": "plugin_name_foo_bar", "previousTimestamp": "bla", "previousVersion": "1.0", "releaseTimestamp": "bla", "requiredCore": "1", "scm": "github.com", "sha1": "ynnBM2jWo25ZLDdP3ybBOnV/Pio=", "title": "bla", "url": "http://bla.org", "version": "1.0", "wiki": "https://bla.org"}, "Exclusion": {"buildDate": "bla", "dependencies": [], and the next plugin block is glued straight afterwards. What I now want to do is to search for "plugin_foo_bar": {" as this is the unique identifier for a new plugin description block. I want to replace the first sha1 value occuring afterwards. That's where I keep failing. I always grab the first,last or any occurrence in the entire file and not the block :( "title" is the unique identifier after the sha1 value. So I tried to make the .* less greedy but it ain't working out. last attempt was heading towards: sed -i 's/("name": "plugin_name_foo_bar.*sha1": ")([a-zA-Z0-9!@#\$%^&*()\[\]]*)(", "title"\)/\1blablabla\2/1' default.json to find the sha1 value of that plugin but still no joy. I hope someone knows - preferably a simpler approach - before I now continue with trial and error until I have to puke and freakout. I am working with SED on Windows, so Unix approach might help me to figure out how to achieve this in batch but please make it as one-liner if possible. Scripts are a real pain to convert. And I just need SED and no other solution with other tools like AWK. That is absolutely out of discussion. Any help is appreciated :) Cheers Jan

  Read the article

• CSS selectors : should I minimise my use of the class attribute in the HTML or optimise the speed

  - by Laurent Bourgault-Roy

  As I was working on a small website, I decided to use the PageSpeed extension to check if their was some improvement I could do to make the site load faster. However I was quite surprise when it told me that my use of CSS selector was "inefficient". I was always told that you should keep the usage of the class attribute in the HTML to a minimum, but if I understand correctly what PageSpeed tell me, it's much more efficient for the browser to match directly against a class name. It make sense to me, but it also mean that I need to put more CSS classes in my HTML. It also make my .css file a little harder to read. I usually tend to mark my CSS like this : #mainContent p.productDescription em.priceTag { ... } Which make it easy to read : I know this will affect the main content and that it affect something in a paragraph tag (so I wont start to put all sort of layout code in it) that describe a product and its something that need emphasis. However it seem I should rewrite it as .priceTag { ... } Which remove all context information about the style. And if I want to use differently formatted price tag (for example, one in a list on the sidebar and one in a paragraph), I need to use something like that .paragraphPriceTag { ... } .listPriceTag { ... } Which really annoy me since I seem to duplicate the semantic of the HTML in my classes. And that mean I can't put common style in an unqualified .priceTag { ... } and thus I need to replicate the style in both CSS rule, making it harder to make change. (Altough for that I could use multiple class selector, but IE6 dont support them) I believe making code harder to read for the sake of speed has never been really considered a very good practice . Except where it is critical, of course. This is why people use PHP/Ruby/C# etc. instead of C/assembly to code their site. It's easier to write and debug. So I was wondering if I should stick with few CSS classes and complex selector or if I should go the optimisation route and remove my fancy CSS selectors for the sake of speed? Does PageSpeed make over the top recommandation? On most modern computer, will it even make a difference?

  Read the article

• casting doubles to integers in order to gain speed

  - by antirez

  Hello all, in Redis (http://code.google.com/p/redis) there are scores associated to elements, in order to take this elements sorted. This scores are doubles, even if many users actually sort by integers (for instance unix times). When the database is saved we need to write this doubles ok disk. This is what is used currently: snprintf((char*)buf+1,sizeof(buf)-1,"%.17g",val); Additionally infinity and not-a-number conditions are checked in order to also represent this in the final database file. Unfortunately converting a double into the string representation is pretty slow. While we have a function in Redis that converts an integer into a string representation in a much faster way. So my idea was to check if a double could be casted into an integer without lost of data, and then using the function to turn the integer into a string if this is true. For this to provide a good speedup of course the test for integer "equivalence" must be fast. So I used a trick that is probably undefined behavior but that worked very well in practice. Something like that: double x = ... some value ... if (x == (double)((long long)x)) use_the_fast_integer_function((long long)x); else use_the_slow_snprintf(x); In my reasoning the double casting above converts the double into a long, and then back into an integer. If the range fits, and there is no decimal part, the number will survive the conversion and will be exactly the same as the initial number. As I wanted to make sure this will not break things in some system, I joined #c on freenode and I got a lot of insults ;) So I'm now trying here. Is there a standard way to do what I'm trying to do without going outside ANSI C? Otherwise, is the above code supposed to work in all the Posix systems that currently Redis targets? That is, archs where Linux / Mac OS X / *BSD / Solaris are running nowaday? What I can add in order to make the code saner is an explicit check for the range of the double before trying the cast at all. Thank you for any help.

  Read the article

• L-Soft LISTSERV TCPGUI Interface for PHP Creation

  - by poolnoodl

  I'm trying to use LISTSERV's "API" in PHP. L-Soft calls this TCPGUI, and essentially, you can request data like over Telnet. To do this, I'm using PHP's TCP socket functions. I've seen this done in other languages but can't quite convert it to PHP. I can connect, I can change set ASCII or BINARY mode. But I can never quite craft the header packet the way I need to authenticate, so I'm thinking I'm messing up my conversion. C: http://www.lsoft.com/manuals/16.0/htmlhelp/advanced%20topics/TCPGUI.html#2334328 $origin = '[email protected]'; $pwd = 'password'; $host = "example.com"; $port = 2306; $email = "[email protected]"; $list = "mailinglist"; $command = "Query $list FOR $email"; $fp = stream_socket_client("tcp://$host:$port", $errno, $errstr, 30); $cmd = $command . " PW=" . $pwd; $len = strlen($cmd); $orglen = strlen($origin); $n = $len + $orglen + 1; $headerPacket[0] = "1"; $headerPacket[1] = "B"; $headerPacket[2] = "\r"; $headerPacket[3] = "\n"; $headerPacket[4] = ord($n / 256); $headerPacket[5] = ord($n + 255); $headerPacket[6] = ord($orglen); for ($i = 0; $i < $orglen; $i++) { $headerPacket[$i + 7] = ord($origin[$i]); } for ($i = 0; $i < $len; $i++) { $cmdPacket[$i] = ord($cmd[$i]); } fwrite($fp, implode($headerPacket)); while (!feof($fp)) { echo fgets($fp, 1024); } Any thoughts on where I'm going wrong? I'd much appreciate it if anyone could point me toward some code to do this, days of googling and searching here on SO has only lead me to examples in other languages. Of course, if you know C (or Java or Perl as linked below in my comment to bypass the spam filter), PHP, and socket programming fairly well, you could probably rewrite the whole of the code in an hour, maybe a few minutes. You'd have my eternal thanks for that.

  Read the article

• boost::spirit::karma using the alternatives operator (|) with conditions

  - by Ingemar

  I'm trying to generate a string from my own class called Value using boost::spirit::karma, but i got stuck with this. I've tried to extract my problem into a simple example. I want to generate a String with karma from instances of the following class: class Value { public: enum ValueType { BoolType, NumericType }; Value(bool b) : type_(BoolType), value_(b) {} Value(const double d) : type_(NumericType), value_(d) {}; ValueType type() { return type_; } operator bool() { return boost::get<bool>(value_); } operator double() { return boost::get<double>(value_); } private: ValueType type_; boost::variant<bool, double> value_; }; Here you can see what I'm tying to do: int main() { using karma::bool_; using karma::double_; using karma::rule; using karma::eps; std::string generated; std::back_insert_iterator<std::string> sink(generated); rule<std::back_insert_iterator<std::string>, Value()> value_rule = bool_ | double_; Value bool_value = Value(true); Value double_value = Value(5.0); karma::generate(sink, value_rule, bool_value); std::cout << generated << "\n"; generated.clear(); karma::generate(sink, value_rule, double_value); std::cout << generated << "\n"; return 0; } The first call to karma::generate() works fine because the value is a bool and the first generator in my rule also "consumes" a bool. But the second karma::generate() fails with boost::bad_get because karma tries to eat a bool and calls therefore Value::operator bool(). My next thought was to modify my generator rule and use the eps() generator together with a condition but here i got stuck: value_rule = (eps( ... ) << bool_) | (eps( ... ) << double_); I'm unable to fill the brackets of the eps generator with sth. like this (of course not working): eps(value.type() == BoolType) I've tried to get into boost::phoenix, but my brain seems not to be ready for things like this. Please help me! here is my full example (compiling but not working): main.cpp

  Read the article

• Spring MVC, REST, and HATEOAS

  - by SingleShot

  I'm struggling with the correct way to implement Spring MVC 3.x RESTful services with HATEOAS. Consider the following constraints: I don't want my domain entities polluted with web/rest constructs. I don't want my controllers polluted with view constructs. I want to support multiple views. Currently I have a nicely put together MVC app without HATEOAS. Domain entities are pure POJOs without any view or web/rest concepts embedded. For example: class User { public String getName() {...} public String setName(String name) {...} ... } My controllers are also simple. They provide routing and status, and delegate to Spring's view resolution framework. Note my application supports JSON, XML, and HTML, yet no domain entities or controllers have embedded view information: @Controller @RequestMapping("/users") class UserController { @RequestMapping public ModelAndView getAllUsers() { List<User> users = userRepository.findAll(); return new ModelAndView("users/index", "users", users); } @RequestMapping("/{id}") public ModelAndView getUser(@PathVariable Long id) { User user = userRepository.findById(id); return new ModelAndView("users/show", "user", user); } } So, now my issue - I'm not sure of a clean way to support HATEOAS. Here's an example. Let's say when the client asks for a User in JSON format, it comes out like this: { firstName: "John", lastName: "Smith" } Let's also say that when I support HATEOAS, I want the JSON to contain a simple "self" link that the client can then use to refresh the object, delete it, or something else. It might also have a "friends" link indicating how to get the user's list of friends: { firstName: "John", lastName: "Smith", links: [ { rel: "self", ref: "http://myserver/users/1" }, { rel: "friends", ref: "http://myserver/users/1/friends" } ] } Somehow I want to attach links to my object. I feel the right place to do this is in the controller layer as the controllers all know the correct URLs. Additionally, since I support multiple views, I feel like the right thing to do is somehow decorate my domain entities in the controller before they are converted to JSON/XML/whatever in Spring's view resolution framework. One way to do this might be to wrap the POJO in question with a generic Resource class that contains a list of links. Some view tweaking would be required to crunch it into the format I want, but its doable. Unfortunately nested resources could not be wrapped in this way. Other things that come to mind include adding links to the ModelAndView, and then customizing each of Spring's out-of-the-box view resolvers to stuff links into the generated JSON/XML/etc. What I don't want is to be constantly hand-crafting JSON/XML/etc. to accommodate various links as they come and go during the course of development. Thoughts?

  Read the article

• plane bombing problems- help

  - by peiska

  I'm training code problems, and on this one I am having problems to solve it, can you give me some tips how to solve it please. The problem is something like this: Your task is to find the sequence of points on the map that the bomber is expected to travel such that it hits all vital links. A link from A to B is vital when its absence isolates completely A from B. In other words, the only way to go from A to B (or vice versa) is via that link. Notice that if we destroy for example link (d,e), it becomes impossible to go from d to e,m,l or n in any way. A vital link can be hit at any point that lies in its segment (e.g. a hit close to d is as valid as a hit close to e). Of course, only one hit is enough to neutralize a vital link. Moreover, each bomb affects an exact circle of radius R, i.e., every segment that intersects that circle is considered hit. Due to enemy counter-attack, the plane may have to retreat at any moment, so the plane should follow, at each moment, to the closest vital link possible, even if in the end the total distance grows larger. Given all coordinates (the initial position of the plane and the nodes in the map) and the range R, you have to determine the sequence of positions in which the plane has to drop bombs. This sequence should start (takeoff) and finish (landing) at the initial position. Except for the start and finish, all the other positions have to fall exactly in a segment of the map (i.e. it should correspond to a point in a non-hit vital link segment). The coordinate system used will be UTM (Universal Transverse Mercator) northing and easting, which basically corresponds to a Euclidian perspective of the world (X=Easting; Y=Northing). Input Each input file will start with three floating point numbers indicating the X0 and Y0 coordinates of the airport and the range R. The second line contains an integer, N, indicating the number of nodes in the road network graph. Then, the next N (<10000) lines will each contain a pair of floating point numbers indicating the Xi and Yi coordinates (1 No two links will ever cross with each other. Output The program will print the sequence of coordinates (pairs of floating point numbers with exactly one decimal place), each one at a line, in the order that the plane should visit (starting and ending in the airport). Sample input 1 102.3 553.9 0.2 14 342.2 832.5 596.2 638.5 479.7 991.3 720.4 874.8 744.3 1284.1 1294.6 924.2 1467.5 659.6 1802.6 659.6 1686.2 860.7 1548.6 1111.2 1834.4 1054.8 564.4 1442.8 850.1 1460.5 1294.6 1485.1 17 1 2 1 3 2 4 3 4 4 5 4 6 6 7 7 8 8 9 8 10 9 10 10 11 6 11 5 12 5 13 12 13 13 14 Sample output 1 102.3 553.9 720.4 874.8 850.1 1460.5 102.3 553.9

  Read the article

• Safely escaping and reading back a file path in ruby

  - by user336851

  I need to save a few informations about some files. Nothing too fancy so I thought I would go with a simple one line per item text file. Something like this : # write io.print "%i %s %s\n" % [File.mtime(fname), fname, Digest::SHA1.file(fname).hexdigest] # read io.each do |line| mtime, name, hash = line.scanf "%i %s %s" end Of course this doesn't work because a file name can contain spaces (breaking scanf) and line breaks (breaking IO#each). The line break problem can be avoided by dropping the use of each and going with a bunch of gets(' ') while not io.eof? mtime = Time.at(io.gets(" ").to_i) name = io.gets " " hash = io.gets "\n" end Dealing with spaces in the names is another matter. Now we need to do some escaping. note : I like space as a record delimiter but I'd have no issue changing it for one easier to use. In the case of filenames though, the only one that could help is ascii nul "\0" but a nul delimited file isn't really a text file anymore... I initially had a wall of text detailing the iterations of my struggle to make a correct escaping function and its reciprocal but it was just boring and not really useful. I'll just give you the final result: def write_name(io, val) io << val.gsub(/([\\ ])/, "\\\\\\1") # yes that' 6 backslashes ! end def read_name(io) name, continued = "", true while continued continued = false name += io.gets(' ').gsub(/\\(.)/) do |c| if c=="\\\\" "\\" elsif c=="\\ " continued=true " " else raise "unexpected backslash escape : %p (%s %i)" % [c, io.path, io.pos] end end end return name.chomp(' ') end I'm not happy at all with read_name. Way too long and akward, I feel it shouldn't be that hard. While trying to make this work I tried to come up with other ways : the bittorrent encoded / php serialize way : prefix the file name with the length of the name then just io.read(name_len.to_i). It works but it's a real pita to edit the file by hand. At this point we're halfway to a binary format. String#inspect : This one looks expressly made for that purpose ! Except it seems like the only way to get the value back is through eval. I hate the idea of eval-ing a string I didn't generate from trusted data. So. Opinions ? Isn't there some lib which can do all this ? Am I missing something obvious ? How would you do that ?

  Read the article

• controlling the class names generated by JAXB for xsd:attributeGroup?

  - by Stephen Winnall

  I am using JAXB to bind XML to Java for an application that I am writing. I have an element called measure which contains two amount elements called amount and maxAmount, with which I want to model a lower and an upper limiting value. amount and maxAmount are otherwise identical and I would like them to be implemented with the same class when unmarshalled into Java. The following is an extract from the XML schema which I feed to JAXB: <xsd:attributeGroup name="AmountAttributes"> <xsd:attribute name="quantity" type="xsd:decimal"/> <xsd:attribute name="numerator" type="xsd:nonNegativeInteger"/> <xsd:attribute name="denominator" type="xsd:positiveInteger"/> </xsd:attributeGroup> <xsd:element name="measure"> <xsd:complexType> <xsd:sequence> <xsd:element minOccurs="0" name="amount"> <xsd:complexType> <xsd:attributeGroup ref="mpr:AmountAttributes"/> </xsd:complexType> </xsd:element> <xsd:element minOccurs="0" name="maxAmount"> <xsd:complexType> <xsd:attributeGroup ref="mpr:AmountAttributes"/> </xsd:complexType> </xsd:element> </xsd:sequence> </xsd:complexType> </xsd:element> JAXB creates from this a more elaborate version of the following: public class Measure { protected Measure.Amount amount; protected Measure.MaxAmount maxAmount; public static class Measure.Amount {} public static class Measure.MaxAmount {} } Measure.Amount and Measure.MaxAmount are identical except for their names, but - of course - as far as Java is concerned they have little to do with each other. Is there a way of making JAXB use the same class for both amount and maxAmount? Just to come completely clean ;-) I should mention that I generate the XML schema from RNC using Trang. If the answer to the question is "change the XML schema", I have the supplementary question "how do I change the RNC to produce that XML schema?". My RNC looks like this: AmountAttributes = QuantityAttribute? & attribute numerator { xsd:nonNegativeInteger }? & attribute denominator { xsd:positiveInteger }? QuantityAttribute = attribute quantity { xsd:decimal } Measure = element measure { element amount { AmountAttributes }?, element maxAmount { AmountAttributes }? }+ I use RNC because I find it simpler to understand, but if the solution to my problem means just using XML Schema, so be it. Steve

  Read the article

• How should I handle the case in which a username is already in use?

  - by idealmachine

  I'm a JavaScript programmer and new to PHP and MySQL (want to get into server-side coding). Because I'm trying to learn PHP by building a simple online game (more specifically, correspondence chess), I'm starting by implementing a simple user accounts system. Of course, user registration comes first. What are the best practices for: How I should handle the (likely) possibility that when a user tries to register, the username he has chosen is already in use, particularly when it comes to function return values?($result === true is rather ugly, and I'm not sure whether checking the MySQL error code is the best way to do it either) How to cleanly handle varying page titles?($gPageTitle = '...'; require_once 'bgsheader.php'; is also rather ugly) Anything else I'm doing wrong? In some ways, PHP is rather different from JavaScript... Here is a (rather large) excerpt of the code I have written so far. Note that this is a work in progress and is missing security checks that I will add as my next step. function addUser( $username, $password ) { global $gDB, $gPasswordSalt; $stmt = $gDB->prepare( 'INSERT INTO user(user_name, user_password, user_registration) VALUES(?, ?, NOW())' ); $stmt || trigger_error( 'Failed to prepare statement: ' . htmlspecialchars( $gDB->error ) ); $hashedPassword = hash_hmac( 'sha256', $password, $gPasswordSalt, true ); $stmt->bind_param( 'ss', $username, $hashedPassword ); if( $stmt->execute() ) { return true; } elseif( $stmt->errno == 1062) { return 'exists'; } else { trigger_error( 'Failed to execute statement: ' . htmlspecialchars( $stmt->error ) ); } } $username = $_REQUEST['username']; $password = $_REQUEST['password']; $result = addUser( $username, $password ); if( $result === true ) { $gPageTitle = 'Registration successful'; require_once 'bgsheader.php'; echo '<p>You have successfully registered as ' . htmlspecialchars( $username ) . ' on this site.</p>'; } elseif( $result == 'exists' ) { $gPageTitle = 'Username already taken'; require_once 'bgsheader.php'; echo '<p>Someone is already using the username you have chosen. Please try using another one instead.'; } else { trigger_error('This should never happen'); } require_once 'bgsfooter.php';

  Read the article

• ASP.Net / MySQL : Translating content into several languages

  - by philwilks

  I have an ASP.Net website which uses a MySQL database for the back end. The website is an English e-commerce system, and we are looking at the possibility of translating it into about five other languages (French, Spanish etc). We will be getting human translators to perform the translation - we've looked at automated services but these aren't good enough. The static text on the site (e.g. headings, buttons etc) can easily be served up in multiple languages via .Net's built in localization features (resx files etc). The thing that I'm not so sure about it how best to store and retrieve the multi-language content in the database. For example, there is a products table that includes these fields... productId (int) categoryId (int) title (varchar) summary (varchar) description (text) features (text) The title, summary, description and features text would need to be available in all the different languages. Here are the two options that I've come up with... Create additional field for each language For example we could have titleEn, titleFr, titleEs etc for all the languages, and repeat this for all text columns. We would then adapt our code to use the appropriate field depending on the language selected. This feels a bit hacky, and also would lead to some very large tables. Also, if we wanted to add additional languages in the future it would be time consuming to add even more columns. Use a lookup table We could create a new table with the following format... textId | languageId | content ------------------------------- 10 | EN | Car 10 | FR | Voiture 10 | ES | Coche 11 | EN | Bike 11 | FR | Vélo We'd then adapt our products table to reference the appropriate textId for the title, summary, description and features instead of having the text stored in the product table. This seems much more elegant, but I can't think of a simple way of getting this data out of the database and onto the page without using complex SQL statements. Of course adding new languages in the future would be very simple compared to the previous option. I'd be very grateful for any suggestions about the best way to achieve this! Is there any "best practice" guidance out there? Has anyone done this before?

  Read the article

• Generate A Simple Read-Only DAL?

  - by David

  I've been looking around for a simple solution to this, trying my best to lean towards something like NHibernate, but so far everything I've found seems to be trying to solve a slightly different problem. Here's what I'm looking at in my current project: We have an IBM iSeries database as a primary repository for a third party software suite used for our core business (a financial institution). Part of what my team does is write applications that report on or key off of a lot of this data in some way. In the past, we've been manually creating ADO .NET connections (we're using .NET 3.5 and Visual Studio 2008, by the way) and manually writing queries, etc. Moving forward, I'd like to simplify the process of getting data from there for the development team. Rather than creating connections and queries and all that each time, I'd much rather a developer be able to simply do something like this: var something = (from t in TableName select t); And, ideally, they'd just get some IQueryable or IEnumerable of generated entities. This would be done inside a new domain core that I'm building where these entities would live and the applications would interface with it through a request/response service layer. A few things to note are: The entities that correspond to the database tables should be generated once and we'd prefer to manually keep them updated over time. That is, if columns/tables are added to the database then we shouldn't have to do anything. (If some are deleted, of course, it will break, but that's fine.) But if we need to use a new column, we should be able to just add it to the necessary class(es) without having to re-gen the whole thing. The whole thing should be SELECT-only. We're not doing a full DAL here because we don't want to be able to break anything in the database (even accidentally). We don't need any kind of mapping between our domain objects and the generated entity types. The domain barely covers a fraction of the data that's in there, most of it we'll never need, and we would rather just create re-usable maps manually over time. I already have a logical separation for the DAL where my "repository" classes return domain objects, I'm just looking for a better alternative to manual ADO to be used inside the repository classes. Any suggestions? It seems like what I'm doing is just enough outside the normal demand for DAL/ORM tools/tutorials online that I haven't been able to find anything. Or maybe I'm just overlooking something obvious?

  Read the article

• codeIgniter: pass parameter to a select query from previous query

  - by krike

  I'm creating a little management tool for the browser game travian. So I select all the villages from the database and I want to display some content that's unique to each of the villages. But in order to query for those unique details I need to pass the id of the village. How should I do this? this is my code (controller): function members_area() { global $site_title; $this->load->model('membership_model'); if($this->membership_model->get_villages()) { $data['rows'] = $this->membership_model->get_villages(); $id = 1;//this should be dynamic, but how? if($this->membership_model->get_tasks($id)): $data['tasks'] = $this->membership_model->get_tasks($id); endif; } $data['title'] = $site_title." | Your account"; $data['main_content'] = 'account'; $this->load->view('template', $data); } and this is the 2 functions I'm using in the model: function get_villages() { $q = $this->db->get('villages'); if($q->num_rows() > 0) { foreach ($q->result() as $row) { $data[] = $row; } return $data; } } function get_tasks($id) { $this->db->select('name'); $this->db->from('tasks'); $this->db->where('villageid', $id); $q = $this->db->get(); if($q->num_rows() > 0) { foreach ($q->result() as $task) { $data[] = $task; } return $data; } } and of course the view: <?php foreach($rows as $r) : ?> <div class="village"> <h3><?php echo $r->name; ?></h3> <ul> <?php foreach($tasks as $task): ?> <li><?php echo $task->name; ?></li> <?php endforeach; ?> </ul> <?php echo anchor('site/add_village/'.$r->id.'', '+ add new task'); ?> </div> <?php endforeach; ?> ps: please do not remove the comment in the first block of code!

  Read the article

• Why does every thread in my application use a different hibernate session?

  - by Ittai

  Hi, I have a web-application which uses hibernate and for some reason every thread (httprequest or other threads related to queueing) uses a different session. I've implemented a HibernateSessionFactory class which looks like this: public class HibernateSessionFactory { private static final ThreadLocal<Session> threadLocal = new ThreadLocal<Session>(); private static Configuration configuration = new AnnotationConfiguration(); private static org.hibernate.SessionFactory sessionFactory; static { try { configuration.configure(configFile); sessionFactory = configuration.buildSessionFactory(); } catch (Exception e) {} } private HibernateSessionFactory() {} public static Session getSession() throws HibernateException { Session session = (Session) threadLocal.get(); if (session == null || !session.isOpen()) { if (sessionFactory == null) { rebuildSessionFactory();//This method basically does what the static init block does } session = (sessionFactory != null) ? sessionFactory.openSession(): null; threadLocal.set(session); } return session; } //More non relevant methods here. Now from my testing it seems that the threadLocal member is indeed initialized only once when the class is first loaded by the JVM but for some reason when different threads access the getSession() method they use different sessions. When a thread first accesses this class (Session) threadLocal.get(); will return null but as expected all other access requests will yeild the same session. I'm not sure how this can be happening as the threadLocal variable is final and the method threadLocal.set(session) is only used in the above context (which I'm 99.9% sure has to yeild a non null session as I would have encountered a NullPointerException at a different part of my app). I'm not sure this is relevant but these are the main parts of my hibernate.cfg.xml file: <hibernate-configuration> <session-factory> <property name="connection.url">someURL</property> <property name="connection.driver_class"> com.microsoft.sqlserver.jdbc.SQLServerDriver</property> <property name="dialect">org.hibernate.dialect.SQLServerDialect</property> <property name="hibernate.connection.isolation">1</property> <property name="hibernate.connection.username">User</property> <property name="hibernate.connection.password">Password</property> <property name="hibernate.connection.pool_size">10</property> <property name="show_sql">false</property> <property name="current_session_context_class">thread</property> <property name="hibernate.hbm2ddl.auto">update</property> <property name="hibernate.cache.use_second_level_cache">false</property> <property name="hibernate.cache.provider_class">org.hibernate.cache.NoCacheProvider</property> <!-- Mapping files --> I'd appreciate any help granted and of course if anyone has any questions I'd be happy to clarify. Ittai

  Read the article

• How do I use Ruby metaprogramming to refactor this common code?

  - by James Wenton

  I inherited a project with a lot of badly-written Rake tasks that I need to clean up a bit. Because the Rakefiles are enormous and often prone to bizarre nonsensical dependencies, I'm simplifying and isolating things a bit by refactoring everything to classes. Specifically, that pattern is the following: namespace :foobar do desc "Frozz the foobar." task :frozzify do unless Rake.application.lookup('_frozzify') require 'tasks/foobar' Foobar.new.frozzify end Rake.application['_frozzify'].invoke end # Above pattern repeats many times. end # Several namespaces, each with tasks that follow this pattern. In tasks/foobar.rb, I have something that looks like this: class Foobar def frozzify() # The real work happens here. end # ... Other tasks also in the :foobar namespace. end For me, this is great, because it allows me to separate the task dependencies from each other and to move them to another location entirely, and I've been able to drastically simplify things and isolate the dependencies. The Rakefile doesn't hit a require until you actually try to run a task. Previously this was causing serious issues because you couldn't even list the tasks without it blowing up. My problem is that I'm repeating this idiom very frequently. Notice the following patterns: For every namespace :xyz_abc, there is a corresponding class in tasks/... in the file tasks/[namespace].rb, with a class name that looks like XyzAbc. For every task in a particular namespace, there is an identically named method in the associated namespace class. For example, if namespace :foo_bar has a task :apples, you would expect to see def apples() ... inside the FooBar class, which itself is in tasks/foo_bar.rb. Every task :t defines a "meta-task" _t (that is, the task name prefixed with an underscore) which is used to do the actual work. I still want to be able to specify a desc-description for the tasks I define, and that will be different for each task. And, of course, I have a small number of tasks that don't follow the above pattern at all, so I'll be specifying those manually in my Rakefile. I'm sure that this can be refactored in some way so that I don't have to keep repeating the same idiom over and over, but I lack the experience to see how it could be done. Can someone give me an assist?

  Read the article

• manipulate variable made up of html before adding it to the dom (new in jQuery 1.4???)

  - by pedalpete

  I thought I had seen this in the first announcement of jQuery 1.4, but can't seem to find anything now. I have a calendar table which is built dynamically from a json ajax response. The table is built in a variable called putHtml. Currently, once the table is added to the DOM, I run a showEvents function which takes each event and adds it to the appropriate cell in the table. Unfortunately, when I have 100 events, that means I am updating the DOM 100 seperate times. Which is getting rather slow. I use the showEvents function to add events dynamically, so it would be really nice if I could just use the same function, and specify to look in the DOM for the cell to add the event to, or look in the variable (assuming I've got it right, and you can actually do this with jQuery). The code I use currenlty is this jQuery('div#calendars').append('putHtml.join('')); for(var e in thisCal.events){ showEvent(thisCal.events[e]); } What I had attempted to do instead was for(var e in thisCal.events){ showEvent(thisCal.events[e],putHtml); } jQuery('div#calendars').append('putHtml.join('')); the showEvents function looks like this function showEvents(event){ var eventDate=event.date; var eventTime=event.time; var eventGroup=event.group; var eventName=event.name; var eventType=event.type; var whereEvent=jQuery('div.a'+eventDate, 'table.'+eventGroup); var putEvent='<div class="event" id="a+'eventDate+'_'+eventTime+'">'+eventName+'</div>' jQuery(whereEvent, 'div#calendar').append(putEvent); if(eventType2){ jQuery(whereEvent, 'div#listings').append(putEvent); } } when attempting to manipulate the variable putHtml before adding to the dom, I was passing putHtml into the showEvent function, so instead of '(whereEvent, 'div#calendar'), I had (whereEvent, putHtml), but that didn't work. of course, the other method to accomplish this would be that when I make each cell, I iterate over the events json, and apply the appropriate html to the cell at the time, but that means repetitively running over the entire json in order to get the event to put in the cell. Is there another/better way to do something like this?

  Read the article

• assignment not working in a dll exported C++ class

  - by Jim Jones

  Using VS 2008 Have a C++ class in which I'm calling functions from a 3rd party dll. The definition in the header file is as follows: namespace OITImageExport { class ImageExport { private: SCCERR seResult; /* Error code returned. */ VTHDOC hDoc; /* Input doc handle returned by DAOpenDocument(). */ VTHEXPORT hExport; /* Handle to the export returned by EXOpenExport(). */ VTDWORD dwFIFlags; /* Used in setting the SCCOPT_FIFLAGS option. */ VTCHAR szError[256]; /* Error string buffer. */ VTDWORD dwOutputId; /* Output Format. */ VTDWORD dwSpecType; public: ImageExport(const char* outputId, const char* specType); void ProcessDocument(const char* inputPath, const char* outputPath); ~ImageExport(); }; } In the constructor I initialize two of the class fields having values which come from enumerations in the 3rd party dll: ImageExport::ImageExport(const char* outputId, const char* specType) { if(outputId == "jpeg") { dwOutputId = FI_JPEGFIF; } if(specType == "ansi") { dwSpecType = IOTYPE_ANSIPATH; } seResult = DAInit(); if (seResult != SCCERR_OK) { DAGetErrorString(seResult, szError, sizeof(szError)); fprintf(stderr, "DAInit() failed: %s (0x%04X)\n", szError, seResult); exit(seResult); } } When I use this class inside of a console app, with a main method in another file (all in the same namespace), instantiating the class object and calling the methods, it works like a champ. So, now that I know the basic code works, I open a dll project using the class header and code file. Course I have to add the dll macro, namely: #ifdef IMAGEDLL_EXPORTS #define DLL __declspec(dllexport) #else #define DLL __declspec(dllimport) #endif and changed the class definition to "class DLL ImageExport". Compiled nicely to a dll and .lib file (No errors, No warnings). Now to test this dll I open another console project using the same main method as before and linking to the (dll) lib file. Had problems, which when tracked down were the result of the two fields not being set; both had values of 0. Went back to the first console app and printed out the values: dwOutputId was 1535 (#define FI_JPEGFIF 1535) and dwSpecType was 2 (#define IOTYPE_ANSIPATH 2). Now if I was assigning these values outside of the class, I can see how the visibility could be different, but why is the assignment in the dll not working? Is it something about having a class in the dll?

  Read the article

• No Method Error Undefined method 'save' for nil:NilClass

  - by BennyB

  I'm getting this error when i try to create a "Lecture" via my Lecture controller's create method. This used to work but i went on to work on other parts of the app & then of course i come back & something is now throwing this error when a user tries to create a Lecture in my app. I'm sure its something small i'm just overlooking (been at it a while & probably need to take a break)...but I'd appreciate if someone could let me know why this is happening...let me know if i need to post anything else...thx! The error I get NoMethodError in LecturesController#create undefined method `save' for nil:NilClass Rails.root: /Users/name/Sites/rails_projects/app_name Application Trace | Framework Trace | Full Trace app/controllers/lectures_controller.rb:13:in `create' My view to create a new Lecture views/lectures/new.html.erb <% provide(:title, 'Start a Lecture') %> <div class="container"> <div class="content-wrapper"> <h1>Create a Lecture</h1> <div class="row"> <div class="span 6 offset3"> <%= form_for(@lecture) do |f| %> <%= render 'shared/error_messages', :object => f.object %> <div class="field"> <%= f.text_field :title, :placeholder => "What will this Lecture be named?" %> <%= f.text_area :content, :placeholder => "Describe this Lecture & what will be learned..." %> </div> <%= f.submit "Create this Lecture", :class => "btn btn-large btn-primary" %> <% end %> </div> </div> </div> </div> Then my controller where its saying the error is coming from controllers/lectures_controller.rb class LecturesController < ApplicationController before_filter :signed_in_user, :only => [:create, :destroy] before_filter :correct_user, :only => :destroy def index end def new @lecture = current_user.lectures.build if signed_in? end def create if @lecture.save flash[:success] = "Lecture created!" redirect_to @lecture else @activity_items = [ ] render 'new' end end def show @lecture = Lecture.find(params[:id]) end def destroy @lecture.destroy redirect_to root_path end private def correct_user @lecture = current_user.lectures.find_by_id(params[:id]) redirect_to root_path if @lecture.nil? end

  Read the article

• Best approach for using Scanner Objects in Java?

  - by devjeetroy

  Although I'm more of a C++/ASM guy, I have to work with java as a part of my undergrad course at college. Our teacher taught us input using Scanner(System.in), and told us that if multiple functions are were taking user input, it would be advisable that a single Scanner object is passed around so as to reduce chances of the input stream getting screwed up. Now using this approach has gotten me into a situation where I'm trying to use a Scanner.nextLine(), and this statement does not wait for user input. It just moves on to the following statement. I figured there may be some residual cr/lf or other characters in the Scanner that might not have been retrieved are causing the problem. Here is the code. while(lineScanner.hasNext()) { if(isPlaceHolder(temp = lineScanner.next())) { temp = temp.replace("<",""); temp = temp.replace(">", ""); System.out.print("Enter "+aOrA(temp.charAt(0)) +" " +temp + " : "); temp = consoleInput.nextLine(); } outputFileStream.print(temp + " "); } All of the code is inside a function which receives a Scanner object consoleInput. Ok, so what happens when i run it is that when the program enters the if() the first time, It carries out theSystem.out.print, does not wait for user input, and moves on to the second time that it enters the 'if' block. This time, it takes the input and the rest of the program operates normally. What is even more surprising is that when i check the output file created by the program, it is perfect, just as i want to be. Almost as if the first time input using the scanner is correct. I have solved this problem by creating a new system.in Scanner in the function itself, instead of receiving the Scanner object as a parameter. But I am still very curious to know what the hell is happening and why it couldn't be solved using a simple Scanner.reset(). Would it be better to just simply create a Scanner Object for each function? Thanks, Devjeet PS. Although I know how to take input using fileinputstreams and the like, we are not supposed to use it with the homework.

  Read the article

< Previous Page | 330 331 332 333 334 335 336 337 338 339 340 341  | Next Page >