Search Results

Search found 78653 results on 3147 pages for 'performance object name s'.

Page 333/3147 | < Previous Page | 329 330 331 332 333 334 335 336 337 338 339 340  | Next Page >

• How do polymorphic inline caches work with mutable types?

  - by kingkilr

  A polymorphic inline cache works by caching the actual method by the type of the object, in order to avoid the expensive lookup procedures (usually a hashtable lookup). How does one handle the type comparison if the type objects are mutable (i.e. the method might be monkey patched into something different at run time). The one idea I've come up with would be a "class counter" that gets incremented each time a method is adjusted, however this seems like it would be exceptionally expensive in a heavily monkey patched environ since it would kill all the PICs for that class, even if the methods for them weren't altered. I'm sure there must be a good solution to this, as this issue is directly applicable to Javascript and AFAIK all 3 of the big JS VMs have PICs (wow acronym ahoy).

  Read the article

• how to avoid sub-query to gain performance

  - by chun

  hi i have a reporting query which have 2 long sub-query SELECT r1.code_centre, r1.libelle_centre, r1.id_equipe, r1.equipe, r1.id_file_attente, r1.libelle_file_attente,r1.id_date, r1.tranche, r1.id_granularite_de_periode,r1.granularite, r1.ContactsTraites, r1.ContactsenParcage, r1.ContactsenComm, r1.DureeTraitementContacts, r1.DureeComm, r1.DureeParcage, r2.AgentsConnectes, r2.DureeConnexion, r2.DureeTraitementAgents, r2.DureePostTraitement FROM ( SELECT cc.id_centre_contact, cc.code_centre, cc.libelle_centre, a.id_equipe, a.equipe, a.id_file_attente, f.libelle_file_attente, a.id_date, g.tranche, g.id_granularite_de_periode, g.granularite, sum(Nb_Contacts_Traites) as ContactsTraites, sum(Nb_Contacts_en_Parcage) as ContactsenParcage, sum(Nb_Contacts_en_Communication) as ContactsenComm, sum(Duree_Traitement/1000) as DureeTraitementContacts, sum(Duree_Communication / 1000 + Duree_Conference / 1000 + Duree_Com_Interagent / 1000) as DureeComm, sum(Duree_Parcage/1000) as DureeParcage FROM agr_synthese_activite_media_fa_agent a, centre_contact cc, direction_contact dc, granularite_de_periode g, media m, file_attente f WHERE m.id_media = a.id_media AND cc.id_centre_contact = a.id_centre_contact AND a.id_direction_contact = dc.id_direction_contact AND dc.direction_contact ='INCOMING' AND a.id_file_attente = f.id_file_attente AND m.media = 'PHONE' AND ( ( g.valeur_min = date_format(a.id_date,'%d/%m') and g.granularite = 'Jour') or ( g.granularite = 'Heure' and a.id_th_heure = g.id_granularite_de_periode) ) GROUP by cc.id_centre_contact, a.id_equipe, a.id_file_attente, a.id_date, g.tranche, g.id_granularite_de_periode) r1, ( (SELECT cc.id_centre_contact,cc.code_centre, cc.libelle_centre, a.id_equipe, a.equipe, a.id_date, g.tranche, g.id_granularite_de_periode,g.granularite, count(distinct a.id_agent) as AgentsConnectes, sum(Duree_Connexion / 1000) as DureeConnexion, sum(Duree_en_Traitement / 1000) as DureeTraitementAgents, sum(Duree_en_PostTraitement / 1000) as DureePostTraitement FROM activite_agent a, centre_contact cc, granularite_de_periode g WHERE ( g.valeur_min = date_format(a.id_date,'%d/%m') and g.granularite = 'Jour') AND cc.id_centre_contact = a.id_centre_contact GROUP BY cc.id_centre_contact, a.id_equipe, a.id_date, g.tranche, g.id_granularite_de_periode ) UNION (SELECT cc.id_centre_contact,cc.code_centre, cc.libelle_centre, a.id_equipe, a.equipe, a.id_date, g.tranche, g.id_granularite_de_periode,g.granularite, count(distinct a.id_agent) as AgentsConnectes, sum(Duree_Connexion / 1000) as DureeConnexion, sum(Duree_en_Traitement / 1000) as DureeTraitementAgents, sum(Duree_en_PostTraitement / 1000) as DureePostTraitement FROM activite_agent a, centre_contact cc, granularite_de_periode g WHERE ( g.granularite = 'Heure' AND a.id_th_heure = g.id_granularite_de_periode) AND cc.id_centre_contact = a.id_centre_contact GROUP BY cc.id_centre_contact,a.id_equipe, a.id_date, g.tranche, g.id_granularite_de_periode) ) r2 WHERE r1.id_centre_contact = r2.id_centre_contact AND r1.id_equipe = r2.id_equipe AND r1.id_date = r2.id_date AND r1.tranche = r2.tranche AND r1.id_granularite_de_periode = r2.id_granularite_de_periode GROUP BY r1.id_centre_contact , r1.id_equipe, r1.id_file_attente, r1.id_date, r1.tranche, r1.id_granularite_de_periode ORDER BY r1.code_centre, r1.libelle_centre, r1.equipe, r1.libelle_file_attente, r1.id_date, r1.id_granularite_de_periode,r1.tranche the EXPLAIN shows | id | select_type | table | type| possible_keys | key | key_len | ref| rows | Extra | '1', 'PRIMARY', '<derived3>', 'ALL', NULL, NULL, NULL, NULL, '2520', 'Using temporary; Using filesort' '1', 'PRIMARY', '<derived2>', 'ALL', NULL, NULL, NULL, NULL, '4378', 'Using where; Using join buffer' '3', 'DERIVED', 'a', 'ALL', 'fk_Activite_Agent_centre_contact', NULL, NULL, NULL, '83433', 'Using temporary; Using filesort' '3', 'DERIVED', 'g', 'ref', 'Index_granularite,Index_Valeur_min', 'Index_Valeur_min', '23', 'func', '1', 'Using where' '3', 'DERIVED', 'cc', 'ALL', 'PRIMARY', NULL, NULL, NULL, '6', 'Using where; Using join buffer' '4', 'UNION', 'g', 'ref', 'PRIMARY,Index_granularite', 'Index_granularite', '23', '', '24', 'Using where; Using temporary; Using filesort' '4', 'UNION', 'a', 'ref', 'fk_Activite_Agent_centre_contact,fk_activite_agent_TH_heure', 'fk_activite_agent_TH_heure', '5', 'reporting_acd.g.Id_Granularite_de_periode', '2979', 'Using where' '4', 'UNION', 'cc', 'ALL', 'PRIMARY', NULL, NULL, NULL, '6', 'Using where; Using join buffer' NULL, 'UNION RESULT', '<union3,4>', 'ALL', NULL, NULL, NULL, NULL, NULL, '' '2', 'DERIVED', 'g', 'range', 'PRIMARY,Index_granularite,Index_Valeur_min', 'Index_granularite', '23', NULL, '389', 'Using where; Using temporary; Using filesort' '2', 'DERIVED', 'a', 'ALL', 'fk_agr_synthese_activite_media_fa_agent_centre_contact,fk_agr_synthese_activite_media_fa_agent_direction_contact,fk_agr_synthese_activite_media_fa_agent_file_attente,fk_agr_synthese_activite_media_fa_agent_media,fk_agr_synthese_activite_media_fa_agent_th_heure', NULL, NULL, NULL, '20903', 'Using where; Using join buffer' '2', 'DERIVED', 'cc', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_Centre_Contact', '1', '' '2', 'DERIVED', 'f', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_File_Attente', '1', '' '2', 'DERIVED', 'dc', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_Direction_Contact', '1', 'Using where' '2', 'DERIVED', 'm', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_Media', '1', 'Using where' don't know it very clear, but i think is the problem of seems it take full scaning than i change all the sub-query to views(create view as select sub-query), and the result is the same thanks for any advice

  Read the article

• GlassFish JDO and global object

  - by bach

  Hi, I'm thinking about the GlassFish platform for my new app. My app env. doesn't have a big volume of data to handle, but a lot of users writing/reading the same data A very volotile portion of the data updates every 200milsec by diff users. Therefore I'd like that type of data to be in memory only and accessible to the whole app My questions: How do I use a global object in memory with GF? a. use a static variable object - for that I guess I need to make sure GF is running on only 1 JVM -- how to I configure GF to run on 1 jvm? b. use HttpContext - same as a. How do I persist to the DB? a. can I use JDO interface? How do I Schedule tasks to be performed in the future (something like the task queue in GAE) thanks, J.S. Bach

  Read the article

• Group SQL tables in Microsoft SQL Server Management Studio object explorer

  - by MainMa

  I have a table which has approximately sixty tables, and other tables are added constantly. Each table is a part of a schema. A such quantity of tables makes it difficult to use Microsoft SQL Server Management Studio 2008. For example, I must scroll up in object explorer to access database related functions, or scroll down each time I need to access Views or Security features. Is it possible to group several tables to be able to expand or collapse them in Object Explorer? Maybe a folder may be displayed for each schema, letting collapse the folders I don't need to use?

  Read the article

• How to add values to a JSON object?

  - by Damiano

  Hello everybody, I have created an array with: var msg = new Array(); then, I have a function that add values to this array, this function is: function add(time, user, text){ var message = [time, user, text]; if (msg.length >= 50) msg.shift(); msg.push(message); } As you can see, if the array has 50 or more elements I remove the first with .shift(). Then I add an array as element. Ok, the code works perfectly, but now I have to loop the msg array to create a JSON obj. The JSON object should has this format: var obj = [ {'time' : time, 'user' : user, 'text' : text}, {'time' : time, 'user' : user, 'text' : text}, {'time' : time, 'user' : user, 'text' : text} ] I mean...i have to loop msg array and then store all the values inside the JSON object. I do not know how to "concatenate" the element of the array inside json obj. Could you help me? Thank you very much in advance!

  Read the article

• does a Java getter incur a performance penalty

  - by alan

  if i have the code int getA(){ return a; } and then do something like int b = obj.a(); instead of int b = obj.a; will that mean that the stack will have to be pushed and popped ultimately slowing down my code?

  Read the article

• Java Session Like Object

  - by scriptmonster

  I have been developing a project and in this project i have designed my code to do the same job after a specified time interval continuously. The job that wanted to be done has a lot of distinct cycles. The interval is small to execute them normally thus i used threads. Until that point everything is clear for me. To decrease the process and information transaction i wanted to put an session like object that holds the given data and provide it to any thread at anytime. With this object i plan to not query the same configuration information from database at everytime but if it exists on the session take it else query and store on session. I'm not sure how to implement this structure. Regards,

  Read the article

• Basic class returns onject reference instead of Array

  - by php-b-grader

  I have very basic class: class Customer { protected $id; protected $customer; public function __construct($customer_id) { $this->id = $customer_id; return $this->set_customer(); } protected function set_customer() { $query = mysql_query("SELECT * FROM customer WHERE id = '$this->id'"); $this->customer = mysql_fetch_row($query); return $this->customer; } } $customer = new Customer($order->customer->id); print_r($customer); This is not doing what I want it to but I understand why... $customer returns a reference to the Customer Object... But what I want is the MySQL row array from the mysql_fetch_row() call... What am I missing?

  Read the article

• Binding an Ilist to datagridview containing another object in a field

  - by JaSk

  I have pretty much the same problem as this question http://stackoverflow.com/questions/970741 but in windows forms, can anyone help me solve it? this is my code, so you don't have to check the other question: public class Material { public virtual int id { get; private set; } public virtual string nombre { get; set; } public virtual string unidad { get; set; } public virtual Categorias Categoria { get; set; } public virtual IList Materiales { get; set; } public Material() { Materiales = new List<Materiales>(); } public virtual void AddMateriales(Materiales materiales) { materiales.Material = this; this.Materiales.Add(materiales); } } as you can see I have an object within the IList so when I use the List as the data source for a datagridview I get a object.categoria where I want to get the Categoria.Name property, can anyone help me?. Thanks

  Read the article

• Accessing a JavaScript object property names with a "-" in it

  - by Anil kumar

  I have a requirement to read JSON data in my application. Problem is that the JSON data that I am getting from the service includes "-" and when I am trying to read it, I am getting "Uncaught ReferenceError: person is not defined ". e.g. I have below JSON object- var JSONObject ={ "name-person":"John Johnson", "street":"Oslo West 16", "age":33, "phone":"555 1234567"}; when I am writing below console log statement I am getting "Uncaught ReferenceError: person is not defined " error console.log(JSONObject.name-person); Can someone please help me how to read such data which includes "-" in it? I do not have control on the service and the DB so to modify source data is not in my hand.

  Read the article

• how to open many files simultaneously for reading in c

  - by monkeyking

  I'm trying to port some of my c++ code into c. I have the following construct class reader{ private: FILE *fp; alot_of_data data;//updated by read_until() method public: reader(const char*filename) read_until(some conditional dependent on the contents of the file, and the arg supplied) } Im then instantiating hundreds of these object and iterate over them using several 'read_until()' for each file until allfiles is at eof. I'm failing to see any clever way to do this in c, the only solution I can come up with is making an array of FILE pointers, and do the same with all the private member data from my class. But this seems very messy, can I implement the functionality of my class as a function pointer, or anything better, I think I'm missing a fundamental design pattern? The files are way to big to have all in memory, so reading everything from every file is not feasible Thanks

  Read the article

• How to test my GAE site for performance

  - by Sergey Basharov

  I am building a GAE site that uses AJAX/JSON for almost all its tasks including building the UI elements, all interactions and client-server requests. What is a good way to test it for highloads so that I could have some statistics about how much resources 1000 average users per some period of time would take. I think I can create some Python functions for this purpose. What can you advise? Thanks.

  Read the article

• Is it possible to reference object within the same object?

  - by fudgey

  I've been messing around with jQuery plugin code and I'm trying to put all of my common variables into a single object for easy access. I have included a few examples below on how I've done this, but I'm wondering how others deal with this problem. Lets say I have this var x = function(options){ var defaults = { ulist : $('ul#list'), listLen : $('ul#list').children().length } $.extend(options, defaults); // do other stuff } What I'm trying to do is use the ulist object in as a base, then find the number of li's I guess I could do this: var x = function(options){ var defaults = { ulist : $('ul#list'), listLen : 0 } defaults.listLen = defaults.ulist.children().length; $.extend(options, defaults); // do other stuff } or this: var x = function(options){ var defaults = { ulist : $('ul#list') }; var defaults2 = { listLen : defaults.ulist.children().length } $.extend(defaults, defaults2); $.extend(options, defaults); // do other stuff } The above code samples are just thrown together, and only meant to get the idea across to you. Anyway, is there a better way to do this?

  Read the article

• How to get to the key name of a referenced entity property from an entity instance without a datastore read in google app engine?

  - by Sumeet Pareek

  Consider I have the following models - class Team(db.Model): # say I have just 5 teams name = db.StringProperty() class Player(db.Model): # say I have thousands of players name = db.StringProperty() team = db.ReferenceProperty(Team, collection_name="player_set") Key name for each Team entity = 'team_' , and for each Player entity = 'player_' By some prior arrangement I have a Team entity's (key_name, name) mapping available to me. For example (team_01, United States Of America), (team_02, Russia) etc I have to show all the players and their teams on a page. One way of doing this would be - players = Player.all().fetch(1000) # This is 1 DB read for player in players: # This will iterate 1000 times self.response.out.write(player.name) # This is obviously not a DB read self.response.out.write(player.team.name) #This is a total of 1x1000 = 1000 DB reads That is a 1001 DB reads for a silly thing. The interesting part is that when I do a db.to_dict() on players, it shows that for every player in that list there is 'name' of the player and there is the 'key_name' of the team available too. So how can I do the below ?? players = Player.all().fetch(1000) # This is 1 DB read for player in players: # This will iterate 1000 times self.response.out.write(player.name) # This is obviously not a DB read self.response.out.write(team_list[player.<SOME WAY OF GETTING TEAM KEY NAME>]) # Here 'team_list' already has (key_name, name) for all 5 teams I have been struggling with this for a long time. Have read every available documentation. I could just hug the person that can help me here :-) Disclaimer: The above problem description is not a real scenario. It is a simplified arrangement that represents my problem exactly. I have run into it in a rater complex and big GAE appication.

  Read the article

• Learning to write organized and modular programs (C++)

  - by Peter

  Hi All, I'm a computer science student, and I'm just starting to write relatively larger programs for my coursework (between 750 - 1500 lines). Up until now, it's been possible to get by with any reasonable level of modularization and object oriented design. However, now that I'm writing more complex code for my assignments I'd like to learn to write better code. Can anyone point me in the direction of some resources for learning about what sort of things to look for when designing your program's architecture so that you can make it as modularized as possible? Thank you for any help. Best, Peter

  Read the article

• Java - how to tell class of an object?

  - by lkm

  Given a method that accepts as a parameter a certain supertype. Is there any way, within that method, to determine the actual class of the object that was passed to it? I.e. if a subtype of the allowable parameter was actually passed, is there a way to find out which type it is? If this isn't possible can someone explain why not (from a language design perspective)? Thanks Update: just to make sure I was clear void doSomething(MyType myType) { //determine if myType is MyType OR one of its subclasses } Since the method signature specifies the parameter as being MyType, then how can one tell if the object is actually a subtype of MyType (and which one).

  Read the article

• Pointers, links, object and reference count

  - by EugeneP

  String a = "a"; // allocate memory and write address of a memory block to a variable String b = "b"; // in a and b hold addresses b = a; // copy a address into b. // Now what? b value is completely lost and will be garbage collected //* next step a = null; // now a does not hold a valid address to any data, // still data of a object exist somewhere, yet we cannot get access to it. Correct me if there's a mistake somewhere in my reflexions. My question is: suppose anInstance object of type Instance has a property ' surname ' anInstance.getSurname() returns "MySurname". now String s = anInstance.getSurname(); anInstance = null; question is - is it true that getSurname value, namely MySurname will not be garbage collected because and only because it has active reference counter 0, and if other properties of anInstance have a zero reference counter, they'll be garbage collected?

  Read the article

• Give app.config another name after build?

  - by AndyC

  As you all know, when you build a project with an app.config file it gets copied to the bin directory and renamed $(targetFileName).config. Is it possible for it to be called something else? For example if my executable is called myApplication.exe, can I have the config file called settings.config as opposed to myApplication.exe.config? Cheers

  Read the article

• Regex, replace path to resource, modify resource name

  - by jerome

  Hi all, I'd like to use a JS regex to take a string such as the following: 'http://www.somedomain.com/some_directory/some_other_directory/some_image.jpg' And turn it into this: 'http://www.some_other_domain.com/another_directory/yet_another_directory/size1_some_image.jpg' Any hints? Additionally, any pointers for books or other resources that give a gentle introduction to mastering regexes in JS and other languages?

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• t-sql get variable value from string with variable name

  - by Markus

  Hi. Is there a way to convert '@my_variable' string into a value of @my_variable? I have a table which stores names of variables. I need to get the value of this variable. Something like this: DECLARE @second_variable AS NVARCHAR(20); DECLARE @first_variable AS NVARCHAR(20); SET @first_variable = '20'; SET @second_variable = SELECT '@first_variable'; --here I want that @second variable be assigned a value of "20".

  Read the article

• C# how to dynamically cast an object?

  - by JL

  I am building a helper object that has a property called Mailer. In reality Mailer can be either a System.Net.Mail.MailMessage or a Mono.System.Net.Mail.MailMessage. So I would preferably only want 1 declaration of mailer. For example I don't want: private Mono.Mailing.MailMessage MonoMessage = new Mono.Mailing.MailMessage(); private System.Net.Mail.MailMessage MailMessage = new System.Net.Mail.MailMessage(); I would prefer object mailer; Then in constructor switch (software) { case EnunInternalMailingSoftware.dotnet: this.mailer = new System.Net.Mail.MailMessage(); break; case EnunInternalMailingSoftware.mono: this.mailer = new Mono.Mailing.MailMessage(); break; } The problem is that mailer has no properties at design time. So I can't compile my code. How can this be fixed, am I taking the right approach. Thanks in advance

  Read the article

• what is object buffering?

  - by Abhimanyu

  can any body explain me what is object buffering and why one is using it in php?

  Read the article

• Ads in whole app iPhone problem

  - by lars

  I am using mobclix together with admob. The code is to big to add it in all classes. So i created a new class: Ads Everytime i want an ad in a view, i have to send the view to the ad class: - (void)initAd:(UIView *) pView { NSLog(@"ads init"); self.loadedView = pView; ..... To create an ad in a class: Ad* ad = [Ads new]; [ad initAd:self.view]; I dont know if thats the right way. I have to create a new Ads object everytime i change a view (or class). Is there a way to always have an Ads instance running, or is there another better way? Thanks alot!!

  Read the article

• JQuery use variable by name of divID

  - by Russell Parrott

  Just a quick question, that I cannot fathom out, hope you guys and girls can help. I have a div (with ID) that when clicked opens a new div - great works well, what I really want is to "populate" the new div with predefined text based on the clicked div's ID. example: <div class="infobox" id="help_msg1">Click me</div> I may have say 3 (actually more but...) of these div's This opens: <div id="helpbox">text in here</div> In/on my .js page I have doc ready etc then: var help_msg1 ='text that is a help message'; var help_msg2 ='text that is another help message'; var help_msg3 ='text that is yet another help message'; Then $('.infobox').live('click',function() { $('#helpbox').remove(); $('label').css({'font-weight': '400'}); $(this).next('label').css({'font-weight': '900'}); var offset = $(this).next().next().offset(); var offsetby = $(this).next().next().width(); var leftitby = offset.left+offsetby+10; $('body').append('text in here'); $('#helpbox').css( { 'left': leftitby, 'top': offset.top } ); }); Note I remove each #helpbox before appending the new one and the .next().next() identifies the appropriate text input that lot all works. What I need is how do I put var help_msg1 into the append when id="help_msg1" is clicked or var help_msg2 when id="help_msg2" is clicked etc. I have tried

  Read the article

< Previous Page | 329 330 331 332 333 334 335 336 337 338 339 340  | Next Page >