Search Results

Search found 78653 results on 3147 pages for 'performance object name s'.

Page 333/3147 | < Previous Page | 329 330 331 332 333 334 335 336 337 338 339 340  | Next Page >

  • PHP 5.4: disable warning "Creating default object from empty value"

    - by Werner
    I want to migrate code from PHP 5.2 to 5.4. This worked fine so far except that all the code I use makes extensive use of just using an object with a member without any initialisation, like: $MyObject->MyMember = "Hello"; which results in the warning: "Creating default object from empty value" I know that the solution would be to use: $MyObject = new stdClass(); $MyObject->MyMember = "Hello"; but it would be A LOT OF WORK to change this in all my code, because I use this many times in different projects. I know, it's not good style, but unfortunately I'm not able to spend the next weeks adding this to all of my code. I know I could set the php error_reporting to not reporting warnings, but I want to be able to still get other warnings and notices. This warning doesn't seem to be effected by enable or disable E_STRICT at all. So is there a way to just disable this warning?!

    Read the article

  • how to open many files simultaneously for reading in c

    - by monkeyking
    I'm trying to port some of my c++ code into c. I have the following construct class reader{ private: FILE *fp; alot_of_data data;//updated by read_until() method public: reader(const char*filename) read_until(some conditional dependent on the contents of the file, and the arg supplied) } Im then instantiating hundreds of these object and iterate over them using several 'read_until()' for each file until allfiles is at eof. I'm failing to see any clever way to do this in c, the only solution I can come up with is making an array of FILE pointers, and do the same with all the private member data from my class. But this seems very messy, can I implement the functionality of my class as a function pointer, or anything better, I think I'm missing a fundamental design pattern? The files are way to big to have all in memory, so reading everything from every file is not feasible Thanks

    Read the article

  • How do polymorphic inline caches work with mutable types?

    - by kingkilr
    A polymorphic inline cache works by caching the actual method by the type of the object, in order to avoid the expensive lookup procedures (usually a hashtable lookup). How does one handle the type comparison if the type objects are mutable (i.e. the method might be monkey patched into something different at run time). The one idea I've come up with would be a "class counter" that gets incremented each time a method is adjusted, however this seems like it would be exceptionally expensive in a heavily monkey patched environ since it would kill all the PICs for that class, even if the methods for them weren't altered. I'm sure there must be a good solution to this, as this issue is directly applicable to Javascript and AFAIK all 3 of the big JS VMs have PICs (wow acronym ahoy).

    Read the article

  • Pointers, links, object and reference count

    - by EugeneP
    String a = "a"; // allocate memory and write address of a memory block to a variable String b = "b"; // in a and b hold addresses b = a; // copy a address into b. // Now what? b value is completely lost and will be garbage collected //* next step a = null; // now a does not hold a valid address to any data, // still data of a object exist somewhere, yet we cannot get access to it. Correct me if there's a mistake somewhere in my reflexions. My question is: suppose anInstance object of type Instance has a property ' surname ' anInstance.getSurname() returns "MySurname". now String s = anInstance.getSurname(); anInstance = null; question is - is it true that getSurname value, namely MySurname will not be garbage collected because and only because it has active reference counter 0, and if other properties of anInstance have a zero reference counter, they'll be garbage collected?

    Read the article

  • Is it possible to reference object within the same object?

    - by fudgey
    I've been messing around with jQuery plugin code and I'm trying to put all of my common variables into a single object for easy access. I have included a few examples below on how I've done this, but I'm wondering how others deal with this problem. Lets say I have this var x = function(options){ var defaults = { ulist : $('ul#list'), listLen : $('ul#list').children().length } $.extend(options, defaults); // do other stuff } What I'm trying to do is use the ulist object in as a base, then find the number of li's I guess I could do this: var x = function(options){ var defaults = { ulist : $('ul#list'), listLen : 0 } defaults.listLen = defaults.ulist.children().length; $.extend(options, defaults); // do other stuff } or this: var x = function(options){ var defaults = { ulist : $('ul#list') }; var defaults2 = { listLen : defaults.ulist.children().length } $.extend(defaults, defaults2); $.extend(options, defaults); // do other stuff } The above code samples are just thrown together, and only meant to get the idea across to you. Anyway, is there a better way to do this?

    Read the article

  • Basic class returns onject reference instead of Array

    - by php-b-grader
    I have very basic class: class Customer { protected $id; protected $customer; public function __construct($customer_id) { $this->id = $customer_id; return $this->set_customer(); } protected function set_customer() { $query = mysql_query("SELECT * FROM customer WHERE id = '$this->id'"); $this->customer = mysql_fetch_row($query); return $this->customer; } } $customer = new Customer($order->customer->id); print_r($customer); This is not doing what I want it to but I understand why... $customer returns a reference to the Customer Object... But what I want is the MySQL row array from the mysql_fetch_row() call... What am I missing?

    Read the article

  • Accessing a JavaScript object property names with a "-" in it

    - by Anil kumar
    I have a requirement to read JSON data in my application. Problem is that the JSON data that I am getting from the service includes "-" and when I am trying to read it, I am getting "Uncaught ReferenceError: person is not defined ". e.g. I have below JSON object- var JSONObject ={ "name-person":"John Johnson", "street":"Oslo West 16", "age":33, "phone":"555 1234567"}; when I am writing below console log statement I am getting "Uncaught ReferenceError: person is not defined " error console.log(JSONObject.name-person); Can someone please help me how to read such data which includes "-" in it? I do not have control on the service and the DB so to modify source data is not in my hand.

    Read the article

  • Multiple constructors definitions with same name but different signatures (C++)

    - by PuRe_ChAoS12
    With the following code, I keep getting error C2535 when I compile. It's complaining that a member function already defined or declared. Rationnel.h ... class Rationnel { public: Rationnel(int); //Constructor Rationnel(int,int); //Constructor void add(const Rationnel); ... Rationnel.cpp ... //Constructor Rationnel::Rationnel(int n = 1) { numerateur = n; denominateur = 1; } //Constructor Rationnel::Rationnel(int n = 1, int d = 1) { numerateur = n; denominateur = d; } ... Any idea what could be causing the error? Thanks for your time.

    Read the article

  • Group SQL tables in Microsoft SQL Server Management Studio object explorer

    - by MainMa
    I have a table which has approximately sixty tables, and other tables are added constantly. Each table is a part of a schema. A such quantity of tables makes it difficult to use Microsoft SQL Server Management Studio 2008. For example, I must scroll up in object explorer to access database related functions, or scroll down each time I need to access Views or Security features. Is it possible to group several tables to be able to expand or collapse them in Object Explorer? Maybe a folder may be displayed for each schema, letting collapse the folders I don't need to use?

    Read the article

  • Binding an Ilist to datagridview containing another object in a field

    - by JaSk
    I have pretty much the same problem as this question http://stackoverflow.com/questions/970741 but in windows forms, can anyone help me solve it? this is my code, so you don't have to check the other question: public class Material { public virtual int id { get; private set; } public virtual string nombre { get; set; } public virtual string unidad { get; set; } public virtual Categorias Categoria { get; set; } public virtual IList Materiales { get; set; } public Material() { Materiales = new List<Materiales>(); } public virtual void AddMateriales(Materiales materiales) { materiales.Material = this; this.Materiales.Add(materiales); } } as you can see I have an object within the IList so when I use the List as the data source for a datagridview I get a object.categoria where I want to get the Categoria.Name property, can anyone help me?. Thanks

    Read the article

  • How to write data by dynamic parameter name

    - by Maxim Welikobratov
    I need to be able to write data to datastore of google-app-engine for some known entity. But I don't want write assignment code for each parameter of the entity. I meen, I don't want do like this val_1 = self.request.get('prop_1') val_2 = self.request.get('prop_2') ... val_N = self.request.get('prop_N') item.prop_1 = val_1 item.prop_2 = val_2 ... item.prop_N = val_N item.put() instead, I want to do something like this args = self.request.arguments() for prop_name in args: item.set(prop_name, self.request.get(prop_name)) item.put() dose anybody know how to do this trick?

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • Ads in whole app iPhone problem

    - by lars
    I am using mobclix together with admob. The code is to big to add it in all classes. So i created a new class: Ads Everytime i want an ad in a view, i have to send the view to the ad class: - (void)initAd:(UIView *) pView { NSLog(@"ads init"); self.loadedView = pView; ..... To create an ad in a class: Ad* ad = [Ads new]; [ad initAd:self.view]; I dont know if thats the right way. I have to create a new Ads object everytime i change a view (or class). Is there a way to always have an Ads instance running, or is there another better way? Thanks alot!!

    Read the article

  • Java - how to tell class of an object?

    - by lkm
    Given a method that accepts as a parameter a certain supertype. Is there any way, within that method, to determine the actual class of the object that was passed to it? I.e. if a subtype of the allowable parameter was actually passed, is there a way to find out which type it is? If this isn't possible can someone explain why not (from a language design perspective)? Thanks Update: just to make sure I was clear void doSomething(MyType myType) { //determine if myType is MyType OR one of its subclasses } Since the method signature specifies the parameter as being MyType, then how can one tell if the object is actually a subtype of MyType (and which one).

    Read the article

  • Regex, replace path to resource, modify resource name

    - by jerome
    Hi all, I'd like to use a JS regex to take a string such as the following: 'http://www.somedomain.com/some_directory/some_other_directory/some_image.jpg' And turn it into this: 'http://www.some_other_domain.com/another_directory/yet_another_directory/size1_some_image.jpg' Any hints? Additionally, any pointers for books or other resources that give a gentle introduction to mastering regexes in JS and other languages?

    Read the article

  • Give app.config another name after build?

    - by AndyC
    As you all know, when you build a project with an app.config file it gets copied to the bin directory and renamed $(targetFileName).config. Is it possible for it to be called something else? For example if my executable is called myApplication.exe, can I have the config file called settings.config as opposed to myApplication.exe.config? Cheers

    Read the article

  • C# class in a directory without having the directory name in its namespace

    - by PaN1C_Showt1Me
    Hi ! If you add a directory in your Visual Studio project and you add a class inside it, the namespace will respect the whole path the directory inclusive. But sometimes, I prefer having the class in the main project namespace, although it lies in a directory structure, just because I don't want to have mess in my code. So often happens that I rewrite the Myproject.MyDirectory namespace to be Myproject only. Is it OK in your opinion? Or does any convention say that every class inside the directory must have it included in the namespace ? Thanks

    Read the article

  • Learning to write organized and modular programs (C++)

    - by Peter
    Hi All, I'm a computer science student, and I'm just starting to write relatively larger programs for my coursework (between 750 - 1500 lines). Up until now, it's been possible to get by with any reasonable level of modularization and object oriented design. However, now that I'm writing more complex code for my assignments I'd like to learn to write better code. Can anyone point me in the direction of some resources for learning about what sort of things to look for when designing your program's architecture so that you can make it as modularized as possible? Thank you for any help. Best, Peter

    Read the article

  • Is the a pattern for iterating over lists held by a class (dynamicly typed OO languages)

    - by Roman A. Taycher
    If I have a class that holds one or several lists is it better to allow other classes to fetch those lists(with a getter) or to implement a doXList/eachXList type method for that list that take a function and call that function on each element of the list contained by that object. I wrote a program that did a ton of this and I hated passing around all these lists sometimes with method in class a calling method in class B to return lists contained in class C, B contains a C or multiple C's (note question is about dynamically typed OO languages languages like ruby or smalltalk) ex. (that came up in my program) on a Person class containing scheduling preferences and a scheduler class needing to access them.

    Read the article

  • jQuery Ajax Methods Not Returning XHR Object

    - by Nate
    UPDATE: I haven't figured out what's going on, but this definitely seems to be a problem with my project. After creating a simple test page, I was able to verify that getJSON does in fact return an XHR object like it's supposed to. Per the stackoverflow question/answer here: Kill ajax requests using javascript using jquery. and a number of other question/answers on this site and others, the jQuery Ajax methods should return the XHR object. However, when I run the following code, request is "undefined". var request = $.getJSON(url, function(data) { console.log(data); }); console.log(request); Did I miss a change in jQuery? I'm using 1.4.4.

    Read the article

  • C# how to dynamically cast an object?

    - by JL
    I am building a helper object that has a property called Mailer. In reality Mailer can be either a System.Net.Mail.MailMessage or a Mono.System.Net.Mail.MailMessage. So I would preferably only want 1 declaration of mailer. For example I don't want: private Mono.Mailing.MailMessage MonoMessage = new Mono.Mailing.MailMessage(); private System.Net.Mail.MailMessage MailMessage = new System.Net.Mail.MailMessage(); I would prefer object mailer; Then in constructor switch (software) { case EnunInternalMailingSoftware.dotnet: this.mailer = new System.Net.Mail.MailMessage(); break; case EnunInternalMailingSoftware.mono: this.mailer = new Mono.Mailing.MailMessage(); break; } The problem is that mailer has no properties at design time. So I can't compile my code. How can this be fixed, am I taking the right approach. Thanks in advance

    Read the article

  • t-sql get variable value from string with variable name

    - by Markus
    Hi. Is there a way to convert '@my_variable' string into a value of @my_variable? I have a table which stores names of variables. I need to get the value of this variable. Something like this: DECLARE @second_variable AS NVARCHAR(20); DECLARE @first_variable AS NVARCHAR(20); SET @first_variable = '20'; SET @second_variable = SELECT '@first_variable'; --here I want that @second variable be assigned a value of "20".

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 329 330 331 332 333 334 335 336 337 338 339 340  | Next Page >