Search Results

Search found 78653 results on 3147 pages for 'performance object name s'.

Page 333/3147 | < Previous Page | 329 330 331 332 333 334 335 336 337 338 339 340  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Reference-counted object is used after it is released

    - by EndyVelvet
    Doing code analysis of the project and get the message "Reference-counted object is used after it is released" on the line [defaults setObject: deviceUuid forKey: @ "deviceUuid"]; I watched this topic Obj-C, Reference-counted object is used after it is released? But the solution is not found. ARC disabled. // Get the users Device Model, Display Name, Unique ID, Token & Version Number UIDevice *dev = [UIDevice currentDevice]; NSString *deviceUuid; if ([dev respondsToSelector:@selector(uniqueIdentifier)]) deviceUuid = dev.uniqueIdentifier; else { NSUserDefaults *defaults = [NSUserDefaults standardUserDefaults]; id uuid = [defaults objectForKey:@"deviceUuid"]; if (uuid) deviceUuid = (NSString *)uuid; else { CFStringRef cfUuid = CFUUIDCreateString(NULL, CFUUIDCreate(NULL)); deviceUuid = (NSString *)cfUuid; CFRelease(cfUuid); [defaults setObject:deviceUuid forKey:@"deviceUuid"]; } } Please help find the cause.

    Read the article

  • GlassFish JDO and global object

    - by bach
    Hi, I'm thinking about the GlassFish platform for my new app. My app env. doesn't have a big volume of data to handle, but a lot of users writing/reading the same data A very volotile portion of the data updates every 200milsec by diff users. Therefore I'd like that type of data to be in memory only and accessible to the whole app My questions: How do I use a global object in memory with GF? a. use a static variable object - for that I guess I need to make sure GF is running on only 1 JVM -- how to I configure GF to run on 1 jvm? b. use HttpContext - same as a. How do I persist to the DB? a. can I use JDO interface? How do I Schedule tasks to be performed in the future (something like the task queue in GAE) thanks, J.S. Bach

    Read the article

  • C# how to dynamically cast an object?

    - by JL
    I am building a helper object that has a property called Mailer. In reality Mailer can be either a System.Net.Mail.MailMessage or a Mono.System.Net.Mail.MailMessage. So I would preferably only want 1 declaration of mailer. For example I don't want: private Mono.Mailing.MailMessage MonoMessage = new Mono.Mailing.MailMessage(); private System.Net.Mail.MailMessage MailMessage = new System.Net.Mail.MailMessage(); I would prefer object mailer; Then in constructor switch (software) { case EnunInternalMailingSoftware.dotnet: this.mailer = new System.Net.Mail.MailMessage(); break; case EnunInternalMailingSoftware.mono: this.mailer = new Mono.Mailing.MailMessage(); break; } The problem is that mailer has no properties at design time. So I can't compile my code. How can this be fixed, am I taking the right approach. Thanks in advance

    Read the article

  • Django: Update order attribute for objects in a queryset

    - by lazerscience
    I'm having a attribute on my model to allow the user to order the objects. I have to update the element's order depending on a list, that contains the object's ids in the new order; right now I'm iterating over the whole queryset and set one objects after the other. What would be the easiest/fastest way to do the same with the whole queryset? def update_ordering(model, order): """ order is in the form [id,id,id,id] for example: [8,4,5,1,3] """ id_to_order = dict((order[i], i) for i in range(len(order))) for x in model.objects.all(): x.order = id_to_order[x.id] x.save()

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • Binding an Ilist to datagridview containing another object in a field

    - by JaSk
    I have pretty much the same problem as this question http://stackoverflow.com/questions/970741 but in windows forms, can anyone help me solve it? this is my code, so you don't have to check the other question: public class Material { public virtual int id { get; private set; } public virtual string nombre { get; set; } public virtual string unidad { get; set; } public virtual Categorias Categoria { get; set; } public virtual IList Materiales { get; set; } public Material() { Materiales = new List<Materiales>(); } public virtual void AddMateriales(Materiales materiales) { materiales.Material = this; this.Materiales.Add(materiales); } } as you can see I have an object within the IList so when I use the List as the data source for a datagridview I get a object.categoria where I want to get the Categoria.Name property, can anyone help me?. Thanks

    Read the article

  • Group SQL tables in Microsoft SQL Server Management Studio object explorer

    - by MainMa
    I have a table which has approximately sixty tables, and other tables are added constantly. Each table is a part of a schema. A such quantity of tables makes it difficult to use Microsoft SQL Server Management Studio 2008. For example, I must scroll up in object explorer to access database related functions, or scroll down each time I need to access Views or Security features. Is it possible to group several tables to be able to expand or collapse them in Object Explorer? Maybe a folder may be displayed for each schema, letting collapse the folders I don't need to use?

    Read the article

  • t-sql get variable value from string with variable name

    - by Markus
    Hi. Is there a way to convert '@my_variable' string into a value of @my_variable? I have a table which stores names of variables. I need to get the value of this variable. Something like this: DECLARE @second_variable AS NVARCHAR(20); DECLARE @first_variable AS NVARCHAR(20); SET @first_variable = '20'; SET @second_variable = SELECT '@first_variable'; --here I want that @second variable be assigned a value of "20".

    Read the article

  • how to open many files simultaneously for reading in c

    - by monkeyking
    I'm trying to port some of my c++ code into c. I have the following construct class reader{ private: FILE *fp; alot_of_data data;//updated by read_until() method public: reader(const char*filename) read_until(some conditional dependent on the contents of the file, and the arg supplied) } Im then instantiating hundreds of these object and iterate over them using several 'read_until()' for each file until allfiles is at eof. I'm failing to see any clever way to do this in c, the only solution I can come up with is making an array of FILE pointers, and do the same with all the private member data from my class. But this seems very messy, can I implement the functionality of my class as a function pointer, or anything better, I think I'm missing a fundamental design pattern? The files are way to big to have all in memory, so reading everything from every file is not feasible Thanks

    Read the article

  • Basic class returns onject reference instead of Array

    - by php-b-grader
    I have very basic class: class Customer { protected $id; protected $customer; public function __construct($customer_id) { $this->id = $customer_id; return $this->set_customer(); } protected function set_customer() { $query = mysql_query("SELECT * FROM customer WHERE id = '$this->id'"); $this->customer = mysql_fetch_row($query); return $this->customer; } } $customer = new Customer($order->customer->id); print_r($customer); This is not doing what I want it to but I understand why... $customer returns a reference to the Customer Object... But what I want is the MySQL row array from the mysql_fetch_row() call... What am I missing?

    Read the article

  • pyInotify performance

    - by tranimatronic
    I have a very large directory tree I am wanting pyInotify to watch. Is it better to have pyInotify watch the entire tree or is it better to have a number of watches reporting changes to specific files ? Thanks

    Read the article

  • Java - how to tell class of an object?

    - by lkm
    Given a method that accepts as a parameter a certain supertype. Is there any way, within that method, to determine the actual class of the object that was passed to it? I.e. if a subtype of the allowable parameter was actually passed, is there a way to find out which type it is? If this isn't possible can someone explain why not (from a language design perspective)? Thanks Update: just to make sure I was clear void doSomething(MyType myType) { //determine if myType is MyType OR one of its subclasses } Since the method signature specifies the parameter as being MyType, then how can one tell if the object is actually a subtype of MyType (and which one).

    Read the article

  • How to add values to a JSON object?

    - by Damiano
    Hello everybody, I have created an array with: var msg = new Array(); then, I have a function that add values to this array, this function is: function add(time, user, text){ var message = [time, user, text]; if (msg.length >= 50) msg.shift(); msg.push(message); } As you can see, if the array has 50 or more elements I remove the first with .shift(). Then I add an array as element. Ok, the code works perfectly, but now I have to loop the msg array to create a JSON obj. The JSON object should has this format: var obj = [ {'time' : time, 'user' : user, 'text' : text}, {'time' : time, 'user' : user, 'text' : text}, {'time' : time, 'user' : user, 'text' : text} ] I mean...i have to loop msg array and then store all the values inside the JSON object. I do not know how to "concatenate" the element of the array inside json obj. Could you help me? Thank you very much in advance!

    Read the article

  • Java Session Like Object

    - by scriptmonster
    I have been developing a project and in this project i have designed my code to do the same job after a specified time interval continuously. The job that wanted to be done has a lot of distinct cycles. The interval is small to execute them normally thus i used threads. Until that point everything is clear for me. To decrease the process and information transaction i wanted to put an session like object that holds the given data and provide it to any thread at anytime. With this object i plan to not query the same configuration information from database at everytime but if it exists on the session take it else query and store on session. I'm not sure how to implement this structure. Regards,

    Read the article

  • Improve performance writing 10 million records to text file using windows service

    - by user1039583
    I'm fetching more than 10 millions of records from database and writing to a text file. It takes hours of time to complete this operation. Is there any option to use TPL features here? It would be great if someone could get me started implementing this with the TPL. using (FileStream fStream = new FileStream("d:\\file.txt", FileMode.OpenOrCreate, FileAccess.ReadWrite)) { BufferedStream bStream = new BufferedStream(fStream); TextWriter writer = new StreamWriter(bStream); for (int i = 0; i < 100000000; i++) { writer.WriteLine(i); } bStream.Flush(); writer.Flush(); // empty buffer; fStream.Flush(); }

    Read the article

  • IIS - IP Address and Domain Name Restrictions - not blocking IP addresses

    - by Funky
    I have added an IP address in IIS7 in the IP address and domain restrictions. From what I have read this should block all traffic to the folder apart from the allowed IP address. For some reason this does not work. If I access the section from my work computer all ok, when I access it from my phone I can still see the page. Does anyone have any idea why IIS is not blocking all the other IPs out? Thanks

    Read the article

  • Pointers, links, object and reference count

    - by EugeneP
    String a = "a"; // allocate memory and write address of a memory block to a variable String b = "b"; // in a and b hold addresses b = a; // copy a address into b. // Now what? b value is completely lost and will be garbage collected //* next step a = null; // now a does not hold a valid address to any data, // still data of a object exist somewhere, yet we cannot get access to it. Correct me if there's a mistake somewhere in my reflexions. My question is: suppose anInstance object of type Instance has a property ' surname ' anInstance.getSurname() returns "MySurname". now String s = anInstance.getSurname(); anInstance = null; question is - is it true that getSurname value, namely MySurname will not be garbage collected because and only because it has active reference counter 0, and if other properties of anInstance have a zero reference counter, they'll be garbage collected?

    Read the article

  • Learning to write organized and modular programs (C++)

    - by Peter
    Hi All, I'm a computer science student, and I'm just starting to write relatively larger programs for my coursework (between 750 - 1500 lines). Up until now, it's been possible to get by with any reasonable level of modularization and object oriented design. However, now that I'm writing more complex code for my assignments I'd like to learn to write better code. Can anyone point me in the direction of some resources for learning about what sort of things to look for when designing your program's architecture so that you can make it as modularized as possible? Thank you for any help. Best, Peter

    Read the article

  • Good code architecture for this problem?

    - by RCIX
    I am developing a space shooter game with customizable ships. You can increase the strength of any number of properties of the ship via a pair of radar charts*. Internally, i represent each ship as a subclassed SpaceObject class, which holds a ShipInfo that describes various properties of that ship. I want to develop a relatively simple API that lets me feed in a block of relative strengths (from minimum to maximum of what the radar chart allows) for all of the ship properties (some of which are simplifications of the underlying actual set of properties) and get back a ShipInfo class i can give to a PlayerShip class (that is the object that is instantiated to be a player ship). I can develop the code to do the transformations between simplified and actual properties myself, but i would like some recommendations as to what sort of architecture to provide to minimize the pain of interacting with this translator code (i.e. no methods with 5+ arguments or somesuch other nonsense). Does anyone have any ideas? *=not actually implemented yet, but that's the plan.

    Read the article

  • invalid file name in matlab when using file split

    - by klijo
    here jj will be the value of FN, but the trouble is iam getting a error message ??? Error using == fopen Invalid filename. DirName = 'Samples\mattest\jj'; FileName = split('\\',DirName); [a,b] = size(FileName); FN = FileName(b); file_1 = fopen(FN,'w'); split method was found at http://www.mathworks.com/matlabcentral/fileexchange/4873 Doesnt the code seem correct ? Could someone please help me ?

    Read the article

  • Is it possible to reference object within the same object?

    - by fudgey
    I've been messing around with jQuery plugin code and I'm trying to put all of my common variables into a single object for easy access. I have included a few examples below on how I've done this, but I'm wondering how others deal with this problem. Lets say I have this var x = function(options){ var defaults = { ulist : $('ul#list'), listLen : $('ul#list').children().length } $.extend(options, defaults); // do other stuff } What I'm trying to do is use the ulist object in as a base, then find the number of li's I guess I could do this: var x = function(options){ var defaults = { ulist : $('ul#list'), listLen : 0 } defaults.listLen = defaults.ulist.children().length; $.extend(options, defaults); // do other stuff } or this: var x = function(options){ var defaults = { ulist : $('ul#list') }; var defaults2 = { listLen : defaults.ulist.children().length } $.extend(defaults, defaults2); $.extend(options, defaults); // do other stuff } The above code samples are just thrown together, and only meant to get the idea across to you. Anyway, is there a better way to do this?

    Read the article

< Previous Page | 329 330 331 332 333 334 335 336 337 338 339 340  | Next Page >