Search Results

Search found 8942 results on 358 pages for 'print r'.

Page 337/358 | < Previous Page | 333 334 335 336 337 338 339 340 341 342 343 344  | Next Page >

  • Problem with Executing Mysql stored procedure

    - by karthik
    The stored procedure builds without any problem. The purpose of this is to take backup of selected tables to a script file. when the SP returns a value {Insert statements}. I am using the below MySql stored procedure, created by SQLWAYS [Tool to convert MsSql to MySql]. The actual MsSql SP is from http://www.codeproject.com/KB/database/InsertGeneratorPack.aspx When i execute the SP in MySql Query Browser, It says "Unknown column 'tbl_users' in 'field list'" What would be the problem ? Because there was no error when i build-ed this Converted MySql SP. Help.. DELIMITER $$ DROP PROCEDURE IF EXISTS `demo`.`InsertGenerator` $$ CREATE DEFINER=`root`@`localhost` PROCEDURE `InsertGenerator`(v_tableName VARCHAR(100)) SWL_return: BEGIN -- SQLWAYS_EVAL# to retrieve column specific information -- SQLWAYS_EVAL# table DECLARE v_string NATIONAL VARCHAR(3000); -- SQLWAYS_EVAL# first half -- SQLWAYS_EVAL# tement DECLARE v_stringData NATIONAL VARCHAR(3000); -- SQLWAYS_EVAL# data -- SQLWAYS_EVAL# statement DECLARE v_dataType NATIONAL VARCHAR(1000); -- SQLWAYS_EVAL# -- SQLWAYS_EVAL# columns DECLARE v_colName NATIONAL VARCHAR(50); DECLARE NO_DATA INT DEFAULT 0; DECLARE cursCol CURSOR FOR SELECT column_name,data_type FROM `columns` WHERE table_name = v_tableName; DECLARE CONTINUE HANDLER FOR SQLEXCEPTION BEGIN SET NO_DATA = -2; END; DECLARE CONTINUE HANDLER FOR NOT FOUND SET NO_DATA = -1; OPEN cursCol; SET v_string = CONCAT('INSERT ',v_tableName,'('); SET v_stringData = ''; SET NO_DATA = 0; FETCH cursCol INTO v_colName,v_dataType; IF NO_DATA <> 0 then -- NOT SUPPORTED print CONCAT('Table ',@tableName, ' not found, processing skipped.') close cursCol; LEAVE SWL_return; end if; WHILE NO_DATA = 0 DO IF v_dataType in('varchar','char','nchar','nvarchar') then SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# ll(',v_colName,'SQLWAYS_EVAL# ''+'); ELSE if v_dataType in('text','ntext') then -- SQLWAYS_EVAL# -- SQLWAYS_EVAL# else SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# ll(cast(',v_colName,'SQLWAYS_EVAL# 00)),'''')+'''''',''+'); ELSE IF v_dataType = 'money' then -- SQLWAYS_EVAL# doesn't get converted -- SQLWAYS_EVAL# implicitly SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# y,''''''+ isnull(cast(',v_colName,'SQLWAYS_EVAL# 0)),''0.0000'')+''''''),''+'); ELSE IF v_dataType = 'datetime' then SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# time,''''''+ isnull(cast(',v_colName, 'SQLWAYS_EVAL# 0)),''0'')+''''''),''+'); ELSE IF v_dataType = 'image' then SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# ll(cast(convert(varbinary,',v_colName, 'SQLWAYS_EVAL# 6)),''0'')+'''''',''+'); ELSE SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# ll(cast(',v_colName,'SQLWAYS_EVAL# 0)),''0'')+'''''',''+'); end if; end if; end if; end if; end if; SET v_string = CONCAT(v_string,v_colName,','); SET NO_DATA = 0; FETCH cursCol INTO v_colName,v_dataType; END WHILE; END $$ DELIMITER ;

    Read the article

  • Distinct rand() sequences yielding the same results in an expression

    - by suszterpatt
    Ok, this is a really weird one. I have an MPI program, where each process has to generate random numbers in a fixed range (the range is read from file). What happens is that even though I seed each process with a different value, and the numbers generated by rand() are different in each process, the expression to generate the random numbers still yields the same sequence between them. Here's all relevant code: // 'rank' will be unique for each process int rank; MPI_Comm_rank(MPI_COMM_WORLD, &rank); // seed the RNG with a different value for each process srand(time(NULL) + rank); // print some random numbers to see if we get a unique sequence in each process // 'log' is a uniquely named file, each process has its own log << rand() << " " << rand() << " " << rand() << std::endl; // do boring deterministic stuff while (true) { // waitTimeMin and waitTimeMax are integers, Max is always greater than Min waitSecs = waitTimeMin + rand() % (waitTimeMax - waitTimeMin); log << "waiting " << waitSecs << " seconds" << std::endl; sleep(waitSecs); // do more boring deterministic stuff } Here's the output of each process, with 3 processes generating numbers in the range [1,9]. process 1: 15190 28284 3149 waiting 6 seconds waiting 8 seconds waiting 9 seconds waiting 4 seconds process 2: 286 6264 3153 waiting 6 seconds waiting 8 seconds waiting 9 seconds waiting 4 seconds process 3: 18151 17013 3156 waiting 6 seconds waiting 8 seconds waiting 9 seconds waiting 4 seconds So while rand() clearly generates different numbers, the expression to calculate waitSecs still evaluates to the same sequence on all processes. What's even weirder: if I run the program with the same parameteres again, only the first 3 random numbers will change, the rest of the "random" sequence will be exactly the same in each run! Changing the range of numbers will obviously produce a different result from this one, but the same parameters always yield the same sequence, between processes and between executions: except for the first 3 numbers. Just what the hell is going on here?

    Read the article

  • POST parameters strangely parsed inside phantomjs

    - by user61629
    I am working with PHP/CURL and would like to send POST data to my phantomjs script, by setting the postfields array below: In my php controller I have: $data=array('first' => 'John', 'last' => 'Smith'); $url='http://localhost:7788/'; $output = $this->my_model->get_data($url,$data); In my php model I have: public function get_data($url,$postFieldArray) { $ch = curl_init(); curl_setopt($ch, CURLOPT_COOKIEJAR, $cookieFile); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, TRUE); curl_setopt($ch, CURLOPT_RETURNTRANSFER, TRUE); curl_setopt($ch, CURLOPT_USERAGENT, "Mozilla/4.0 (compatible; MSIE 7.0; Windows NT 6.0)"); curl_setopt($ch, CURLOPT_POST, TRUE); curl_setopt($ch, CURLOPT_POSTFIELDS, $postFieldArray); curl_setopt($ch, CURLOPT_URL, $url); $output = curl_exec($ch); In my phantomJS script that I am running locally I have: // import the webserver module, and create a server var server = require('webserver').create(); var port = require('system').env.PORT || 7788; console.log("Start Application"); console.log("Listen port " + port); // Create serever and listen port server.listen(port, function(request, response) { // Print some information Just for debbug console.log("We got some requset !!!"); console.log("request method: ", request.method); // request.method POST or GET if(request.method == 'POST' ){ console.log("POST params should be next: "); console.log("POST params: ",request.post); exit; } I first start and run the phantomjs script (myscript.js) from the command line, then I run my php script. The output is: $ phantomjs.exe myscript.js Start Application Listen port 7788 null We got some requset !!! request method: POST POST params should be next: POST params: ------------------------------e70d439800f9 Content-Disposition: form-data; name="first" John ------------------------------e70d439800f9 Content-Disposition: form-data; name="last" Smith ------------------------------e70d439800f9-- I'm confused about the the output. I was expecting something more like: first' => 'John', 'last' => 'Smith Can someone explain why it looks this way? How can I parse the request.post object to assign to variables inside myscript.js

    Read the article

  • PHP miniwebsever file download

    - by snikolov
    $httpsock = @socket_create_listen("9090"); if (!$httpsock) { print "Socket creation failed!\n"; exit; } while (1) { $client = socket_accept($httpsock); $input = trim(socket_read ($client, 4096)); $input = explode(" ", $input); $input = $input[1]; $fileinfo = pathinfo($input); switch ($fileinfo['extension']) { default: $mime = "text/html"; } if ($input == "/") { $input = "index.html"; } $input = ".$input"; if (file_exists($input) && is_readable($input)) { echo "Serving $input\n"; $contents = file_get_contents($input); $output = "HTTP/1.0 200 OK\r\nServer: APatchyServer\r\nConnection: close\r\nContent-Type: $mime\r\n\r\n$contents"; } else { //$contents = "The file you requested doesn't exist. Sorry!"; //$output = "HTTP/1.0 404 OBJECT NOT FOUND\r\nServer: BabyHTTP\r\nConnection: close\r\nContent-Type: text/html\r\n\r\n$contents"; function openfile() { $filename = "a.pl"; $file = fopen($filename, 'r'); $filesize = filesize($filename); $buffer = fread($file, $filesize); $array = array("Output"=$buffer,"filesize"=$filesize,"filename"=$filename); return $array; } $send = openfile(); $file = $send['filename']; $filesize = $send['filesize']; $output = 'HTTP/1.0 200 OK\r\n'; $output .= "Content-type: application/octet-stream\r\n"; $output .= 'Content-Disposition: attachment; filename="'.$file.'"\r\n'; $output .= "Content-Length:$filesize\r\n"; $output .= "Accept-Ranges: bytes\r\n"; $output .= "Cache-Control: private\n\n"; $output .= $send['Output']; $output .= "Content-Transfer-Encoding: binary"; $output .= "Connection: Keep-Alive\r\n"; } socket_write($client, $output); socket_close ($client); } socket_close ($httpsock); Hello, I am snikolov i am creating a miniwebserver with php and i would like to know how i can send the client a file to download with his browser such as firefox or internet explore i am sending a file to the user to download via sockets, but the cleint is not getting the filename and the information to download can you please help me here,if i declare the file again i get this error in my server Fatal error: Cannot redeclare openfile() (previously declared in C:\User s\fsfdsf\sfdsfsdf\httpd.php:31) in C:\Users\hfghfgh\hfghg\httpd.php on li ne 29, if its possible, i would like to know if the webserver can show much banwdidth the user request via sockets, perl has the same option as php but its more hardcore than php i dont understand much about perl, i even saw that a miniwebserver can show much the client user pulls from the server would it be possible that you can assist me with this coding, i much aprreciate it thank you guys.

    Read the article

  • Bluetooth service problem

    - by hara
    hi I need to create a custom bluetooth service and I have to develop it using c++. I read a lot of examples but I didn't success in publishing a new service with a custom UUID. I need to specify a UUID in order to be able to connect to the service from an android app. This is what i wrote: GUID service_UUID = { /* 00000003-0000-1000-8000-00805F9B34FB */ 0x00000003, 0x0000, 0x1000, {0x80, 0x00, 0x00, 0x80, 0x5F, 0x9B, 0x34, 0xFB} }; SOCKET s, s2; SOCKADDR_BTH sab if (WSAStartup(MAKEWORD(2, 2), &wsd) != 0) return 1; printf("installing a new service\n"); s = socket(AF_BTH, SOCK_STREAM, BTHPROTO_RFCOMM); if (s == INVALID_SOCKET) { printf ("Socket creation failed, error %d\n", WSAGetLastError()); return 1; } memset (&sab, 0, sizeof(sab)); sab.addressFamily = AF_BTH; sab.port = BT_PORT_ANY; sab.serviceClassId = service_UUID; if (0 != bind(s, (SOCKADDR *) &sab, sizeof(sab))) { printf ("bind() failed with error code %d\n", WSAGetLastError()); closesocket (s); return 1; } int result=sizeof(sab); getsockname(s,(SOCKADDR *) &sab, &result ); printSOCKADDR_BTH(sab); if(listen (s, 5) == 0) printf("listen() is OK! Listening for connection... :)\n"); else printf("listen() failed with error code %d\n", WSAGetLastError()); printf("waiting connection"); for ( ; ; ) { int ilen = sizeof(sab2); s2 = accept (s, (SOCKADDR *)&sab2, &ilen); printf ("accepted"); } if(closesocket(s) == 0) printf("closesocket() pretty fine!\n"); if(WSACleanup () == 0) printf("WSACleanup() is OK!\n"); return 0; When i print the SOCKADDR_BTH structure retrieved with get getsockname i get an UUID that is not the mine. Furthermore if i use the UUID read from getsockname to connect the Android application the connection fails with this exception: java.io.IOException: Service discovery failed Could you help me?? Thanks!

    Read the article

  • JNI cached jclass global reference variables being garbage collected?

    - by bubbadoughball
    I'm working in the JNI Invocation API, calling into Java from C. I have some upfront initialization to cache 30+ Java classes into global references. The results of FindClass are passed into NewGlobalRef to acquire a global reference to the class. I'm caching these class variables to reuse them later. I have 30+ global references to classes (and 30+ global methodIDs for the class constructors). In the following sample, I've removed exception handling as well as JNI invocation for the purpose of shortening the code snippet. My working code has exception checks after every JNI call and I'm running with -Xcheck:jni. Here's the snippet: jclass aClass; jclass bClass; jmethodID aCtor; jmethodID bCtor; void getGlobalRef(const char* clazz, jclass* globalClass) { jclass local = (*jenv)->FindClass(jenv,clazz); if (local) { *globalClass = (jclass) (*jenv)->NewGlobalRef(jenv,local); (*jenv)->DeleteLocalRef(jenv,local); } } methodID getMethodID(jclass clazz, const char* method, const char* sig) { return (*jenv)->GetMethodID(jenv,clazz,method,sig); } void initializeJNI() { getGlobalRef("MyProj/Testclass1", &aclass); getGlobalRef("MyProj/Testclass2", &bclass); . . aCtor = getMethodID(aclass,"<init>","()V"); bCtor = getMethodID(bclass,"<init>","(I)V"); } The initializeJNI() function sets the global references for jclasses and method IDs for constructors as well as some jfieldID's and some initialization of C data structures. After initialization, when I call into a JNI function using some of the cached jclasses and ctor jmethodIDs, I get a bad global or local reference calling reported from the -Xcheck:jni. In gdb, I break at the last line of initializeJNI(), and print all jclasses and jmethodIDs and the ones causing problems look to have been turned into garbage or garbage-collected (i.e. 0x00 or 0x06). Is it possible for global references to be gc'ed? Any suggestions?

    Read the article

  • When is ¦ not equal to ¦?

    - by Trey Jackson
    Background. I'm working with netlists, and in general, people specify different hierarchies by using /. However, it's not illegal to actually use a / as a part of an instance name. For example, X1/X2/X3/X4 might refer to instance X4 inside another instance named X1/X2/X3. Or it might refer an instance named X3/X4 inside an instance named X2 inside an instance named X1. Got it? There's really no "regular" character that cannot be used as a part of an instance name, so you resort to a non-printable one, or ... perhaps one outside of the standard 0..127 ASCII chars. I thought I'd try (decimal) 166, because for me it shows up as the pipe: ¦. So... I've got some C++ code which constructs the path name using ¦ as the hierarchical separator, so the path above looks like X1¦X2/X3¦X4. Now the GUI is written in Tcl/Tk, and to properly translate this into human readable terms I need to do something like the following: set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 set humanreadable [join [split $path ¦] /] Basically, replace the ¦ with / (I could also accomplish this with [string map]). Now, the problem is, the ¦ in the string I get from C++ doesn't match the ¦ I can create in Tcl. i.e. This fails: set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 string match $path [format X1%cX2/X3%cX4 166 166] Visually, the two strings look identical, but string match fails. I even tried using scan to see if I'd mixed up the bit values. But set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 set path2 [format X1%cX2/X3%cX4 166 166] for {set i 0} {$i < [string length $path]} {incr i} { set p [string range $path $i $i] set p2 [string range $path2 $i $i] scan %c $p c scan %c $p2 c2 puts [list $p $c :::: $p2 $c2 equal? [string equal $c $c2]] } Produces output which looks like everything should match, except the [string equal] fails for the ¦ characters with a print line: ¦ 166 :::: ¦ 166 equal? 0 For what it's worth, the character in C++ is defined as: const char SEPARATOR = 166; Any ideas why a character outside the regular ASCII range would fail like this? When I changed the separator to (decimal) 28 (^\), things worked fine. I just don't want to get bit by a similar problem on a different platform. (I'm currently using Redhat Linux).

    Read the article

  • Advice/suggestions for my first project PHP Classes

    - by Philip
    Hi guys, Any advice is welcome! I have a very limited understanding of php classes but below is my starting point for the route I would like to take. The code is a reflection of what I see in my head and how I would like to go about business. Does my code even look ok, or am I way off base? What are your thoughts, how would you go about achieving such a task as form-validate-insertquery-sendmail-return messages and errors? Please try and keep your answers simple enough for me to digest as for me its about understanding whats going on and not just a copy/paste job. Kindest regards, Phil. Note: This is a base structure only, no complete code added. <?php //======================================= //class.logging.php //======================================== class logging { public $data = array(); public $errors = array(); function __construct() { array_pop($_POST); $this->data =($this->_logging)? is_isset(filterStr($_POST) : ''; foreach($this->data as $key=> $value) { $this->data[$key] = $value; } //print_r($this->data); de-bugging } public function is_isset($str) { if(isset($str)) ? true: false; } public function filterStr($str) { return preg_match(do somthing, $str); } public function validate_post() { try { if(!is_numeric($data['cardID'])) ? throw new Exception('CardID must be numeric!') : continue; } catch (Exception $e) { return $errors = $e->getCode(); } } public function showErrors() { foreach($errors as $error => $err) { print('<div class="notok"></div><br />'); } } public function insertQ() { $query = ""; } } //======================================= //Usercp.php //======================================== if(isset($_GET['mode'])) { $mode = $_GET['mode']; } else { $mode = 'usercp'; } switch($mode) { case 'usercp': echo 'Welcome to the User Control Panel'; break; case 'logging': require_once 'class.logging.php'; $logger = new logging(); if(isset($_POST['submit']) { if($logger->validate_post === true) { $logger->insertQ(); require_once '/scripts/PHPMailer/class.phpmailer.php'; $mailer = new PHPMailer(); $mailer->PHPMailer(); } else { echo ''.$logger->showErrors.''; } } else { echo ' <form action="'.$_SERVER['PHP_SELF'].'?mode=logging" method="post"> </form> '; } break; case 'user_logout': // do somthing break; case 'user_settings': // do somthing break; ?>

    Read the article

  • Why does my Perl regular expression only find the last occurrence?

    - by scharan
    I have the following input to a Perl script and I wish to get the first occurrence of NAME="..." strings in each of the <table>...</table> structures. The entire file is read into a single string and the regex acts on that input. However, the regex always returns the last occurrence of NAME="..." strings. Can anyone explain what is going on and how this can be fixed? Input file: ADSDF <TABLE> NAME="ORDERSAA" line1 line2 NAME="ORDERSA" line3 NAME="ORDERSAB" </TABLE> <TABLE> line1 line2 NAME="ORDERSB" line3 </TABLE> <TABLE> line1 line2 NAME="ORDERSC" line3 </TABLE> <TABLE> line1 line2 NAME="ORDERSD" line3 line3 line3 </TABLE> <TABLE> line1 line2 NAME="QUOTES2" line3 NAME="QUOTES3" NAME="QUOTES4" line3 NAME="QUOTES5" line3 </TABLE> <TABLE> line1 line2 NAME="QUOTES6" NAME="QUOTES7" NAME="QUOTES8" NAME="QUOTES9" line3 line3 </TABLE> <TABLE> NAME="MyName IsKhan" </TABLE> Perl Code starts here: use warnings; use strict; my $nameRegExp = '(<table>((NAME="(.+)")|(.*|\n))*</table>)'; sub extractNames($$){ my ($ifh, $ofh) = @_; my $fullFile; read ($ifh, $fullFile, 1024);#Hardcoded to read just 1024 bytes. while( $fullFile =~ m#$nameRegExp#gi){ print "found: ".$4."\n"; } } sub main(){ if( ($#ARGV + 1 )!= 1){ die("Usage: extractNames infile\n"); } my $infileName = $ARGV[0]; my $outfileName = $ARGV[1]; open my $inFile, "<$infileName" or die("Could not open log file $infileName"); my $outFile; #open my $outFile, ">$outfileName" or die("Could not open log file $outfileName"); extractNames( $inFile, $outFile ); close( $inFile ); #close( $outFile ); } #call main();

    Read the article

  • jQuery: modify href attribute for first level list only

    - by bloggerious
    I'm a noob in jQuery and have stuck at this. I have the following HTML code output from a PHP page: <ul class="cats"> <li><span><a href="cant_post_link_yet1">Lifestyle</a></span></li> <li><span><a href="cant_post_link_yet2">Entertainment</a></span></li> <li class="has_child"> <span><a href="cant_post_link_yet3">Technology</a></span> <ul class="subcats"> <li><span><a href="cant_post_link_yet4">Gadgets</a></span></li> <li><span><a href="cant_post_link_yet5">Hardware</a></span></li> </ul> </li> <li><span><a href="cant_post_link_yetsports">Sports</a></span></li> <li class="has_child"> <span><a href="cant_post_link_yet6">Design</a></span> <ul class="subcats"> <li class="has_child"> <span><a href="cant_post_link_yet7">Web Design</a></span> <ul class="subcat"> <li><span><a href="cant_post_link_yet8">Adobe Photoshop</a></span></li> </ul> </li> <li><span><a href="cant_post_link_yet9">Graphics and Print</a></span></li> </ul> </li> What's the correct jQuery code so that I can modify the href attribute for the first-level list only? Basically, I want to change the href of Technology and Design to be "#" but will not change the href of Web Design which is already on second-level list. More Info: In the code above, if list has subcategories, then it has the class has_child, whether it's on first-level or not. So I want only the first-level list which has class has_child to be modified the href to "#" I can't alter output anymore because it's in the PHP code. Any help is greatly appreciated.

    Read the article

  • Multiplying matrices: error: expected primary-expression before 'struct'

    - by justin
    I am trying to write a program that is supposed to multiply matrices using threads. I am supposed to fill the matrices using random numbers in a thread. I am compiling in g++ and using PTHREADS. I have also created a struct to pass the data from my command line input to the thread so it can generate the matrix of random numbers. The sizes of the two matrices are also passed in the command line as well. I keep getting: main.cpp:7: error: expected primary-expression before 'struct' my code @ line 7 =: struct a{ int Arow; int Acol; int low; int high; }; My inpust are : Sizes of two matrices ( 4 arguments) high and low ranges in which o generate the random numbers between. Complete code: [headers] using namespace std; void *matrixACreate(struct *); void *status; int main(int argc, char * argv[]) { int Arow = atoi(argv[1]); // Matrix A int Acol = atoi(argv[2]); // WxX int Brow = atoi(argv[3]); // Matrix B int Bcol = atoi(argv[4]); // XxZ, int low = atoi(argv[5]); // Range low int high = atoi(argv[6]); struct a{ int Arow; // Matrix A int Acol; // WxX int low; // Range low int high; }; pthread_t matrixAthread; //pthread_t matrixBthread; pthread_t runner; int error, retValue; if (Acol != Brow) { cout << " This matrix cannot be multiplied. FAIL" << endl; return 0; } error = pthread_create(&matrixAthread, NULL, matrixACreate, struct *a); //error = pthread_create(&matrixAthread, NULL, matrixBCreate, sendB); retValue = pthread_join(matrixAthread, &status); //retValue = pthread_join(matrixBthread, &status); return 0; } void matrixACreate(struct * a) { struct a *data = (struct a *) malloc(sizeof(struct a)); data->Arow = Arow; data->Acol = Acol; data->low = low; data->high = high; int range = ((high - low) + 1); cout << Arow << endl<< Acol << endl; }// just trying to print to see if I am in the thread

    Read the article

  • itertools.product eliminating repeated reversed tuples

    - by genclik27
    I asked a question yesterday and thanks to Tim Peters, it is solved. The question is here; itertools.product eliminating repeated elements The new question is further version of this. This time I will generate tuples inside of tuples. Here is an example; lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]] When I use it in itertools.product function this is what I get, ((1, 2), (5, 2), (2, 1)) ((1, 2), (5, 2), (1, 2)) ((1, 2), (1, 2), (2, 1)) ((1, 2), (1, 2), (1, 2)) ((3, 4), (5, 2), (2, 1)) ((3, 4), (5, 2), (1, 2)) ((3, 4), (1, 2), (2, 1)) ((3, 4), (1, 2), (1, 2)) I want to change it in a way that if a sequence has (a,b) inside of it, then it can not have (b,a). In this example if you look at this sequence ((3, 4), (1, 2), (2, 1)) it has (1,2) and (2,1) inside of it. So, this sequence ((3, 4), (1, 2), (2, 1)) should not be considered in the results. As I said, I asked similar question before, in that case it was not considering duplicate elements. I try to adapt it to my problem. Here is modified code. Changed parts in old version are taken in comments. def reverse_seq(seq): s = [] for i in range(len(seq)): s.append(seq[-i-1]) return tuple(s) def uprod(*seqs): def inner(i): if i == n: yield tuple(result) return for elt in sets[i] - reverse: #seen.add(elt) rvrs = reverse_seq(elt) reverse.add(rvrs) result[i] = elt for t in inner(i+1): yield t #seen.remove(elt) reverse.remove(rvrs) sets = [set(seq) for seq in seqs] n = len(sets) #seen = set() reverse = set() result = [None] * n for t in inner(0): yield t In my opinion this code should work but I am getting error for the input lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]]. I could not understand where I am wrong. for i in uprod(*lis): print i Output is, ((1, 2), (1, 2), (1, 2)) Traceback (most recent call last): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 39, in <module> for i in uprod(*lis): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 32, in uprod for t in inner(0): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 22, in inner for t in inner(i+1): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 25, in inner reverse.remove(rvrs) KeyError: (2, 1) Thanks,

    Read the article

  • Why an object declared in method is subject to garbage collection before the method returns?

    - by SiLent SoNG
    Consider an object declared in a method: public void foo() { final Object obj = new Object(); // A long run job that consumes tons of memory and // triggers garbage collection } Will obj be subject to garbage collection before foo() returns? UPDATE: Previously I thought obj is not subject to garbage collection until foo() returns. However, today I find myself wrong. I have spend several hours in fixing a bug and finally found the problem is caused by obj garbage collected! Can anyone explain why this happens? And if I want obj to be pinned how to achieve it? Here is the code that has problem. public class Program { public static void main(String[] args) throws Exception { String connectionString = "jdbc:mysql://<whatever>"; // I find wrap is gc-ed somewhere SqlConnection wrap = new SqlConnection(connectionString); Connection con = wrap.currentConnection(); Statement stmt = con.createStatement(ResultSet.TYPE_FORWARD_ONLY, ResultSet.CONCUR_READ_ONLY); stmt.setFetchSize(Integer.MIN_VALUE); ResultSet rs = stmt.executeQuery("select instance_id, doc_id from crawler_archive.documents"); while (rs.next()) { int instanceID = rs.getInt(1); int docID = rs.getInt(2); if (docID % 1000 == 0) { System.out.println(docID); } } rs.close(); //wrap.close(); } } After running the Java program, it will print the following message before it crashes: 161000 161000 ******************************** Finalizer CALLED!! ******************************** ******************************** Close CALLED!! ******************************** 162000 Exception in thread "main" com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: And here is the code of class SqlConnection: class SqlConnection { private final String connectionString; private Connection connection; public SqlConnection(String connectionString) { this.connectionString = connectionString; } public synchronized Connection currentConnection() throws SQLException { if (this.connection == null || this.connection.isClosed()) { this.closeConnection(); this.connection = DriverManager.getConnection(connectionString); } return this.connection; } protected void finalize() throws Throwable { try { System.out.println("********************************"); System.out.println("Finalizer CALLED!!"); System.out.println("********************************"); this.close(); } finally { super.finalize(); } } public void close() { System.out.println("********************************"); System.out.println("Close CALLED!!"); System.out.println("********************************"); this.closeConnection(); } protected void closeConnection() { if (this.connection != null) { try { connection.close(); } catch (Throwable e) { } finally { this.connection = null; } } } }

    Read the article

  • Opening Macro definitions: tdfx_span.c: lvalue required as left operand of assignment

    - by anttir
    Hi, I'm trying to compile X11R6-7.0 under Ubuntu maverick and got some weird compilation errors I'm unable to resolve myself. I needed X11R6-7.0 as ati catalyst drivers don't support newer xorg and oss drivers don't support 3d acceleration of my hardware. Anyone know what this error message means? I know some C but I got a bit confused. Does it mean GET_FB_DATA macro returned NULL or some method/property not set? Any further insight how to "debug" preprocessor definitions at this point would be great. I don't think I can print anything useful with #error. The error I get: tdfx_span.c: In function ‘tdfxDDWriteDepthPixels’: tdfx_span.c:976: error: lvalue required as left operand of assignment tdfx_span.c:1008: error: lvalue required as left operand of assignment tdfx_span.c: In function ‘write_stencil_pixels’: tdfx_span.c:1242: error: lvalue required as left operand of assignment the Code: 958- switch (depth_size) { 959- case 16: 960- GetBackBufferInfo(fxMesa, &backBufferInfo); 961- /* 962- * Note that the _LOCK macro adds a curly brace, 963- * and the UNLOCK macro removes it. 964- */ 965- WRITE_FB_SPAN_LOCK(fxMesa, info, 966- GR_BUFFER_AUXBUFFER, GR_LFBWRITEMODE_ANY); 967- { 968- LFBParameters ReadParams; 969- GetFbParams(fxMesa, &info, &backBufferInfo, 970- &ReadParams, sizeof(GLushort)); 971- for (i = 0; i < n; i++) { 972- if (mask[i] && visible_pixel(fxMesa, x[i], y[i])) { 973- xpos = x[i] + fxMesa->x_offset; 974- ypos = bottom - y[i]; 975- d16 = depth[i]; 976: PUT_FB_DATA(&ReadParams, GLushort, xpos, ypos, d16); 977- } 978- } 979- } 980- WRITE_FB_SPAN_UNLOCK(fxMesa, GR_BUFFER_AUXBUFFER); 981- break; 982- case 24: And relative macros: #define GET_FB_DATA(ReadParamsp, type, x, y) \ (((x) < (ReadParamsp)->firstWrappedX) \ ? (((type *)((ReadParamsp)->lfbPtr)) \ [(y) * ((ReadParamsp)->LFBStrideInElts) \ + (x)]) \ : (((type *)((ReadParamsp)->lfbWrapPtr)) \ [((y)) * ((ReadParamsp)->LFBStrideInElts) \ + ((x) - (ReadParamsp)->firstWrappedX)])) #define GET_ORDINARY_FB_DATA(ReadParamsp, type, x, y) \ (((type *)((ReadParamsp)->lfbPtr)) \ [(y) * ((ReadParamsp)->LFBStrideInElts) \ + (x)]) #define GET_WRAPPED_FB_DATA(ReadParamsp, type, x, y) \ (((type *)((ReadParamsp)->lfbWrapPtr)) \ [((y)) * ((ReadParamsp)->LFBStrideInElts) \ + ((x) - (ReadParamsp)->firstWrappedX)]) #define PUT_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) #define PUT_ORDINARY_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_ORDINARY_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) #define PUT_WRAPPED_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_WRAPPED_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) The LFBParameters Struct 483-typedef struct 484-{ 485- void *lfbPtr; 486- void *lfbWrapPtr; 487- FxU32 LFBStrideInElts; 488- GLint firstWrappedX; 489-} 490:LFBParameters; Thanks for looking.

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • Problem setting row backgrounds in Android Listview

    - by zchtodd
    I have an application in which I'd like one row at a time to have a certain color. This seems to work about 95% of the time, but sometimes instead of having just one row with this color, it will allow multiple rows to have the color. Specifically, a row is set to have the "special" color when it is tapped. In rare instances, the last row tapped will retain the color despite a call to setBackgroundColor attempting to make it otherwise. private OnItemClickListener mDirectoryListener = new OnItemClickListener(){ public void onItemClick(AdapterView parent, View view, int pos, long id){ if (stdir.getStationCount() == pos) { stdir.moreStations(); return; } if (playingView != null) playingView.setBackgroundColor(Color.DKGRAY); view.setBackgroundColor(Color.MAGENTA); playingView = view; playStation(pos); } }; I have confirmed with print statements that the code setting the row to gray is always called. Can anyone imagine a reason why this code might intermittently fail? If there is a pattern or condition that causes it, I can't tell. I thought it might have something to do with the activity lifecycle setting the "playingView" variable back to null, but I can't reliably reproduce the problem by switching activities or locking the phone. private class DirectoryAdapter extends ArrayAdapter { private ArrayList<Station> items; public DirectoryAdapter(Context c, int resLayoutId, ArrayList<Station> stations){ super(c, resLayoutId, stations); this.items = stations; } public int getCount(){ return items.size() + 1; } public View getView(int position, View convertView, ViewGroup parent){ View v = convertView; LayoutInflater vi = (LayoutInflater)getContext().getSystemService(Context.LAYOUT_INFLATER_SERVICE); if (position == this.items.size()) { v = vi.inflate(R.layout.morerow, null); return v; } Station station = this.items.get(position); v = vi.inflate(R.layout.songrow, null); if (station.playing) v.setBackgroundColor(Color.MAGENTA); else if (station.visited) v.setBackgroundColor(Color.DKGRAY); else v.setBackgroundColor(Color.BLACK); TextView title = (TextView)v.findViewById(R.id.title); title.setText(station.name); return v; } };

    Read the article

  • Where should I initialize variables for an OO Recursive Descent Parse Tree?

    - by Vasto
    I'd like to preface this by stating that this is for a class, so please don't solve this for me. One of my labs for my cse class is creating an interpreter for a BNF that was provided. I understand most of the concepts, but I'm trying to build up my tree and I'm unsure where to initialize values. I've tried in both the constructor, and in the methods but Eclipse's debugger still only shows the left branch, even though it runs through completely. Here is my main procedure so you can get an idea of how I'm calling the methods. public class Parser { public static void main(String[] args) throws IOException { FileTokenizer instance = FileTokenizer.Instance(); FileTokenizer.main(args); Prog prog = new Prog(); prog.ParseProg(); prog.PrintProg(); prog.ExecProg(); } Now here is My Prog class: public class Prog { private DeclSeq ds; private StmtSeq ss; Prog() { ds = new DeclSeq(); ss = new StmtSeq(); } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) // ds = new DeclSeq(); ds.ParseDS(); instance.skipToken(); //Skips begin (2) // ss = new StmtSeq(); ss.ParseSS(); instance.skipToken(); } I've tried having Prog() { ds = null; ss = null; } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) ds = new DeclSeq(); ds.ParseDS(); ... But it gave me the same error. I need the parse tree built up so I can do a pretty print and an execute command, but like I said, I only get the left branch. Any help would be appreciated. Explanations why are even more so appreciated. Thank you, Vasto

    Read the article

  • using Object input\ output Streams with files and array list

    - by soad el-hayek
    hi every one .. i'm an it student , and it's time to finish my final project in java , i've faced too many problems , this one i couldn't solve it and i'm really ubset ! :S my code is like this : in Admin class : public ArrayList cos_info = new ArrayList(); public ArrayList cas_info = new ArrayList(); public int cos_count = 0 ; public int cas_count = 0 ; void coustmer_acount() throws FileNotFoundException, IOException{ String add=null; do{ person p = new person() ; cos_info.add(cos_count, p); cos_count ++ ; add =JOptionPane.showInputDialog("Do you want to add more coustmer..\n'y'foryes ..\n 'n'for No .."); } while(add.charAt(0) == 'Y'||add.charAt(0)=='y'); writenew_cos(); // add_acounts(); } void writenew_cos() throws IOException{ ObjectOutputStream aa = new ObjectOutputStream(new FileOutputStream("coustmer.txt")); aa.writeObject(cos_info); JOptionPane.showMessageDialog(null,"Added to file done sucessfuly.."); aa.close(); } in Coustmer class : void read_cos() throws IOException, ClassNotFoundException{ person p1= null ; int array_count = 0; ObjectInputStream d = new ObjectInputStream(new FileInputStrea ("coustmer.txt")); JOptionPane.showMessageDialog(null,d.available() ); for(int i = 0;d.available() == 0;i++){ a.add(array_count,(ArrayList) d.readObject()); array_count++; JOptionPane.showMessageDialog(null,"Haaaaai :D" ); JOptionPane.showMessageDialog(null,array_count ); } d.close(); JOptionPane.showMessageDialog(null,array_count +"1111" ); for(int i = 0 ; i<a.size()&& found!= true ; i++){ count++ ; p1 =(person)a.get(i); user=p1.user; pass = p1.pass; cas_checkpass(); } } it just print JOptionPane.showMessageDialog(null,d.available() ); and having excep. here a.add(array_count,(ArrayList) d.readObject()); p.s : person object from my own class and it's Serializabled

    Read the article

  • How to populate GridView if Internet not available but images already cached to SD Card

    - by Sophie
    Hello I am writing an Application in which i am parsing JSON Images and then caching into SD Card. What I want to do ? I want to load images into GridView from JSON (by caching images into SD Card), and wanna populate GridView (no matter Internet available or not) once images already downloaded into SD Card. What I am getting ? I am able to cache images into SD Card, also to populate GridView, but not able to show images into GridView (if Internet not available) but images cached into SD Card @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { myGridView = inflater.inflate(R.layout.fragment_church_grid, container, false); if (isNetworkAvailable()) { new DownloadJSON().execute(); } else { Toast.makeText(getActivity(), "Internet not available !", Toast.LENGTH_LONG).show(); } return myGridView ; } private boolean isNetworkAvailable() { ConnectivityManager cm = (ConnectivityManager) getActivity().getSystemService(Context.CONNECTIVITY_SERVICE); NetworkInfo info = cm.getActiveNetworkInfo(); return (info != null); } // DownloadJSON AsyncTask private class DownloadJSON extends AsyncTask<Void, Void, Void> { @Override protected void onPreExecute() { super.onPreExecute(); // Create a progressdialog mProgressDialog = new ProgressDialog(getActivity()); // Set progressdialog title mProgressDialog.setTitle("Church Application"); // Set progressdialog message mProgressDialog.setMessage("Loading Images..."); mProgressDialog.setIndeterminate(false); // Show progressdialog mProgressDialog.show(); } @Override protected Void doInBackground(Void... params) { // Create an array arraylist = new ArrayList<HashMap<String, String>>(); // Retrieve JSON Objects from the given URL address jsonobject = JSONfunctions .getJSONfromURL("http://snapoodle.com/APIS/android/feed.php"); try { // Locate the array name in JSON jsonarray = jsonobject.getJSONArray("print"); for (int i = 0; i < jsonarray.length(); i++) { HashMap<String, String> map = new HashMap<String, String>(); jsonobject = jsonarray.getJSONObject(i); // Retrive JSON Objects map.put("saved_location", jsonobject.getString("saved_location")); // Set the JSON Objects into the array arraylist.add(map); } } catch (JSONException e) { Log.e("Error", e.getMessage()); e.printStackTrace(); } return null; } @Override protected void onPostExecute(Void args) { // Locate the listview in listview_main.xml listview = (GridView) shriRamView.findViewById(R.id.listview); // Pass the results into ListViewAdapter.java adapter = new ChurchImagesAdapter(getActivity(), arraylist); // Set the adapter to the ListView listview.setAdapter(adapter); // Close the progressdialog mProgressDialog.dismiss(); } } }

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Java NoSuchElementException using scanner.nextInt()

    - by othnin
    I am trying to read in a pgm file (512x512 array) and when I read in a larger file I get the error: java.util.NoSuchElementException on reading element (3,97). I have created a much smaller file to read (23x23) and it reads fine. Is there a size limit? I have checked the file and confirmed that there is an int for the value: This appears to be the line it crashes at: fileArray[row][col] = scan.nextInt(); Here is the file: import java.util.Scanner; import java.io.*; public class FileReader { public static void main(String[] args) throws IOException { String fileName = "lena.pgma"; int width, height, maxValue; FileInputStream fileInputStream = null; fileInputStream = new FileInputStream(fileName); Scanner scan = new Scanner(fileInputStream); // Discard the magic number scan.nextLine(); // Discard the comment line scan.nextLine(); // Read pic width, height and max value width = scan.nextInt(); System.out.println("Width: " + width); height = scan.nextInt(); System.out.println("Heigth: " + height); maxValue = scan.nextInt(); fileInputStream.close(); // Now parse the file as binary data FileInputStream fin = new FileInputStream(fileName); DataInputStream dis = new DataInputStream(fin); // look for 4 lines (i.e.: the header) and discard them int numnewlines = 4; while (numnewlines > 0) { char c; do { c = (char)(dis.readUnsignedByte()); } while (c != '\n'); numnewlines--; } // read the image data int[][] fileArray = new int[height][width]; for (int row = 0; row < height; row++) { for (int col = 0; col < width; col++) { fileArray[row][col] = scan.nextInt(); System.out.print("(" + row + " ," + col +"): " + fileArray[row][col]+ " "); } System.out.println(); } dis.close(); } } any advise would be appreciated.

    Read the article

  • MFC: Reading entire file to buffer...

    - by deostroll
    I've meddled with some code but I am unable to read the entire file properly...a lot of junk gets appended to the output. How do I fix this? // wmfParser.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include "wmfParser.h" #include <cstring> #ifdef _DEBUG #define new DEBUG_NEW #endif // The one and only application object CWinApp theApp; using namespace std; int _tmain(int argc, TCHAR* argv[], TCHAR* envp[]) { int nRetCode = 0; // initialize MFC and print and error on failure if (!AfxWinInit(::GetModuleHandle(NULL), NULL, ::GetCommandLine(), 0)) { // TODO: change error code to suit your needs _tprintf(_T("Fatal Error: MFC initialization failed\n")); nRetCode = 1; } else { // TODO: code your application's behavior here. CFile file; CFileException exp; if( !file.Open( _T("c:\\sample.txt"), CFile::modeRead, &exp ) ){ exp.ReportError(); cout<<'\n'; cout<<"Aborting..."; system("pause"); return 0; } ULONGLONG dwLength = file.GetLength(); cout<<"Length of file to read = " << dwLength << '\n'; /* BYTE* buffer; buffer=(BYTE*)calloc(dwLength, sizeof(BYTE)); file.Read(buffer, 25); char* str = (char*)buffer; cout<<"length of string : " << strlen(str) << '\n'; cout<<"string from file: " << str << '\n'; */ char str[100]; file.Read(str, sizeof(str)); cout << "Data : " << str <<'\n'; file.Close(); cout<<"File was closed\n"; //AfxMessageBox(_T("This is a test message box")); system("pause"); } return nRetCode; }

    Read the article

  • Sorted sets and comparators

    - by Jack
    Hello, I'm working with a TreeSetthat is meant to store pathfind locations used during the execution of a A* algorithm. Basically until there are "open" elements (still to be exhaustively visited) the neighbours of every open element are taken into consideration and added to a SortedSetthat keeps them ordered by their cost and heuristic cost. This means that I have a class like: public class PathTileInfo implements Comparable<PathTileInfo> { int cost; int hCost; final int x, y; @Override public int compareTo(PathTileInfo t2) { int c = cost + hCost; int c2 = t2.cost + t2.hCost; int costComp = c < c2 ? -1 : (c > c2 ? 1: 0); return costComp != 0 ? costComp : (x < t2.x || y < t2.y ? -1 : (x > t2.x || y > t2.y ? 1 : 0)); } @Override public boolean equals(Object o2) { if (o2 instanceof PathTileInfo) { PathTileInfo i = (PathTileInfo)o2; return i.cost + i.hCost == cost + hCost && x == i.x && y == i.y; } return false; } } In this way first the total cost is considered, then, since a total ordering is needed (consistency with equals) a ordering according to the x,y coordinate is taken into account. This should work but simply it doesn't, if I iterate over the TreeSet during the algorithm execution like in for (PathTileInfo t : openSet) System.out.print("("+t.x+","+t.y+","+(t.cost+t.hCost)+") "); I get results in which the right ordering is not kept, eg: (7,7,6) (7,6,7) (6,8,6) (6,6,7) (5,8,7) (5,7,7) (6,7,6) (6,6,7) (6,5,7) (5,7,7) (5,5,8) (4,7,7) (4,6,8) (4,5,8) is there something subtle I am missing? Thanks!

    Read the article

  • Help with bugs in a C code

    - by Yanki Twizzy
    This C code is giving me some unpredictable results. The program is meant to collect 6 nos and print out the max, position of the max no and the average. It's supposed to have only 3 functions - input, max_avr_pos and output for doing what the code is supposed to do but I am getting unpredictable results. Please what could be the problem #include <stdio.h> #include <stdlib.h> #include <conio.h> void input_vals(int arrnum[]); void max_ave_val(int arrnum1[],double *average,int *maxval,int *position); void print_output(double *average1,int *maxval1,int *position1); int main(void) { int arrnum[6],maxval2,position2; double average2; input_vals(arrnum); max_ave_val(arrnum,&average2,&maxval2,&position2); print_output(&average2,&maxval2,&position2); _getche(); return 0; } void input_vals(int arrnum[]) { int count; printf("\n Please enter six numbers\n"); for(count=0;count<6;count++) { scanf("%d",&arrnum[count]); } } void max_ave_val(int arrnum1[],double *average,int *maxval,int *position) { int total=0; int cnt,cnt1,cnt2,limit,maxval2,post; limit=6; /* finding the max value*/ for(cnt=0;cnt<limit-1;cnt++) for(cnt1=limit-1;cnt1>cnt;--cnt1) { if(arrnum1[cnt1-1]>arrnum1[cnt1]) { maxval2=arrnum1[cnt-1]; post=(cnt-1)+1; } else { maxval2=arrnum1[cnt1]; post=cnt1+1; } } *maxval=maxval2; *position=post; /* solving for total */ for(cnt2=0;cnt2<limit;cnt2++); { total=total+arrnum1[cnt2]; } *average=total/limit; } void print_output(double *average1,int *maxval1,int *position1) { printf("\n value of the highest of the numbers is %d\n",*maxval1); printf("\n the average of all the numbers is %g\n",*average1); printf("\n the postion of the highest number in the list is %d\n",*position1); }

    Read the article

< Previous Page | 333 334 335 336 337 338 339 340 341 342 343 344  | Next Page >