Search Results

Search found 8942 results on 358 pages for 'print'.

Page 338/358 | < Previous Page | 334 335 336 337 338 339 340 341 342 343 344 345  | Next Page >

  • POST parameters strangely parsed inside phantomjs

    - by user61629
    I am working with PHP/CURL and would like to send POST data to my phantomjs script, by setting the postfields array below: In my php controller I have: $data=array('first' => 'John', 'last' => 'Smith'); $url='http://localhost:7788/'; $output = $this->my_model->get_data($url,$data); In my php model I have: public function get_data($url,$postFieldArray) { $ch = curl_init(); curl_setopt($ch, CURLOPT_COOKIEJAR, $cookieFile); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, TRUE); curl_setopt($ch, CURLOPT_RETURNTRANSFER, TRUE); curl_setopt($ch, CURLOPT_USERAGENT, "Mozilla/4.0 (compatible; MSIE 7.0; Windows NT 6.0)"); curl_setopt($ch, CURLOPT_POST, TRUE); curl_setopt($ch, CURLOPT_POSTFIELDS, $postFieldArray); curl_setopt($ch, CURLOPT_URL, $url); $output = curl_exec($ch); In my phantomJS script that I am running locally I have: // import the webserver module, and create a server var server = require('webserver').create(); var port = require('system').env.PORT || 7788; console.log("Start Application"); console.log("Listen port " + port); // Create serever and listen port server.listen(port, function(request, response) { // Print some information Just for debbug console.log("We got some requset !!!"); console.log("request method: ", request.method); // request.method POST or GET if(request.method == 'POST' ){ console.log("POST params should be next: "); console.log("POST params: ",request.post); exit; } I first start and run the phantomjs script (myscript.js) from the command line, then I run my php script. The output is: $ phantomjs.exe myscript.js Start Application Listen port 7788 null We got some requset !!! request method: POST POST params should be next: POST params: ------------------------------e70d439800f9 Content-Disposition: form-data; name="first" John ------------------------------e70d439800f9 Content-Disposition: form-data; name="last" Smith ------------------------------e70d439800f9-- I'm confused about the the output. I was expecting something more like: first' => 'John', 'last' => 'Smith Can someone explain why it looks this way? How can I parse the request.post object to assign to variables inside myscript.js

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • Jumping into argv?

    - by jth
    Hi, I`am experimenting with shellcode and stumbled upon the nop-slide technique. I wrote a little tool that takes buffer-size as a parameter and constructs a buffer like this: [ NOP | SC | RET ], with NOP taking half of the buffer, followed by the shellcode and the rest filled with the (guessed) return address. Its very similar to the tool aleph1 described in his famous paper. My vulnerable test-app is the same as in his paper: int main(int argc, char **argv) { char little_array[512]; if(argc>1) strcpy(little_array,argv[1]); return 0; } I tested it and well, it works: jth@insecure:~/no_nx_no_aslr$ ./victim $(./exploit 604 0) $ exit But honestly, I have no idea why. Okay, the saved eip was overwritten as intended, but instead of jumping somewhere into the buffer, it jumped into argv, I think. gdb showed up the following addresses before strcpy() was called: (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x80483ed in main (victim.c:7); saved eip 0x154b56 source language c. Arglist at 0xbffff1e8, args: argc=2, argv=0xbffff294 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec Address of little_array: (gdb) print &little_array[0] $1 = 0xbfffefe8 "\020" After strcpy(): (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x804840d in main (victim.c:10); saved eip 0xbffff458 source language c. Arglist at 0xbffff1e8, args: argc=-1073744808, argv=0xbffff458 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec So, what happened here? I used a 604 byte buffer to overflow little_array, so he certainly overwrote saved ebp, saved eip and argc and also argv with the guessed address 0xbffff458. Then, after returning, EIP pointed at 0xbffff458. But little_buffer resides at 0xbfffefe8, that`s a difference of 1136 byte, so he certainly isn't executing little_array. I followed execution with the stepi command and well, at 0xbffff458 and onwards, he executes NOPs and reaches the shellcode. I'am not quite sure why this is happening. First of all, am I correct that he executes my shellcode in argv, not little_array? And where does the loader(?) place argv onto the stack? I thought it follows immediately after argc, but between argc and 0xbffff458, there is a gap of 620 bytes. How is it possible that he successfully "lands" in the NOP-Pad at Address 0xbffff458, which is way above the saved eip at 0xbffff1ec? Can someone clarify this? I have actually no idea why this is working. My test-machine is an Ubuntu 9.10 32-Bit Machine without ASLR. victim has an executable stack, set with execstack -s. Thanks in advance.

    Read the article

  • Downloading large file with php

    - by Alessandro
    Hi, I have to write a php script to download potentially large files. The file I'm reporting here works fine most of the times. However, if the client's connection is slow the request ends (with status code 200) in the middle of the downloading, but not always at the very same point, and not at the very same time. I tried to overwrite some php.ini variables (see the first statements) but the problem remains. I don't know if it's relevant but my hosting server is SiteGround, and for simple static file requests, the download works fine also with slow connections. I've found Forced downloading large file with php but I didn't understand mario's answer. I'm new to web programming. So here's my code. <?php ini_set('memory_limit','16M'); ini_set('post_max_size', '30M'); set_time_limit(0); include ('../private/database_connection.php'); $downloadFolder = '../download/'; $fileName = $_POST['file']; $filePath = $downloadFolder . $fileName; if($fileName == NULL) { exit; } ob_start(); session_start(); if(!isset($_SESSION['Username'])) { // or redirect to login (remembering this download request) $_SESSION['previousPage'] = 'download.php?file=' . $fileName; header("Location: login.php"); exit; } if (file_exists($filePath)) { header('Content-Description: File Transfer'); header('Content-Type: application/octet-stream'); //header('Content-Disposition: attachment; filename='.$fileName); header("Content-Disposition: attachment; filename=\"$fileName\""); header('Content-Transfer-Encoding: binary'); header('Expires: 0'); header('Cache-Control: must-revalidate, post-check=0, pre-check=0'); //header('Pragma: public'); header('Content-Length: ' . filesize($filePath)); ob_clean(); flush(); // download // 1 // readfile($filePath); // 2 $file = @fopen($filePath,"rb"); if ($file) { while(!feof($file)) { print(fread($file, 1024*8)); flush(); if (connection_status()!=0) { @fclose($file); die(); } } @fclose($file); } exit; } else { header('HTTP/1.1 404 File not found'); exit; } ?>

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • How do I call a function name that is stored in a hash in Perl?

    - by Ether
    I'm sure this is covered in the documentation somewhere but I have been unable to find it... I'm looking for the syntactic sugar that will make it possible to call a method on a class whose name is stored in a hash (as opposed to a simple scalar): use strict; use warnings; package Foo; sub foo { print "in foo()\n" } package main; my %hash = (func => 'foo'); Foo->$hash{func}; If I copy $hash{func} into a scalar variable first, then I can call Foo->$func just fine... but what is missing to enable Foo->$hash{func} to work? (EDIT: I don't mean to do anything special by calling a method on class Foo -- this could just as easily be a blessed object (and in my actual code it is); it was just easier to write up a self-contained example using a class method.) EDIT 2: Just for completeness re the comments below, this is what I'm actually doing (this is in a library of Moose attribute sugar, created with Moose::Exporter): # adds an accessor to a sibling module sub foreignTable { my ($meta, $table, %args) = @_; my $class = 'MyApp::Dir1::Dir2::' . $table; my $dbAccessor = lcfirst $table; eval "require $class" or do { die "Can't load $class: $@" }; $meta->add_attribute( $table, is => 'ro', isa => $class, init_arg => undef, # don't allow in constructor lazy => 1, predicate => 'has_' . $table, default => sub { my $this = shift; $this->debug("in builder for $class"); ### here's the line that uses a hash value as the method name my @args = ($args{primaryKey} => $this->${\$args{primaryKey}}); push @args, ( _dbObject => $this->_dbObject->$dbAccessor ) if $args{fkRelationshipExists}; $this->debug("passing these values to $class -> new: @args"); $class->new(@args); }, ); } I've replaced the marked line above with this: my $pk_accessor = $this->meta->find_attribute_by_name($args{primaryKey})->get_read_method_ref; my @args = ($args{primaryKey} => $this->$pk_accessor); PS. I've just noticed that this same technique (using the Moose meta class to look up the coderef rather than assuming its naming convention) cannot also be used for predicates, as Class::MOP::Attribute does not have a similar get_predicate_method_ref accessor. :(

    Read the article

  • Parsing CSV File to MySQL DB in PHP

    - by Austin
    I have a some 350-lined CSV File with all sorts of vendors that fall into Clothes, Tools, Entertainment, etc.. categories. Using the following code I have been able to print out my CSV File. <?php $fp = fopen('promo_catalog_expanded.csv', 'r'); echo '<tr><td>'; echo implode('</td><td>', fgetcsv($fp, 4096, ',')); echo '</td></tr>'; while(!feof($fp)) { list($cat, $var, $name, $var2, $web, $var3, $phone,$var4, $kw,$var5, $desc) = fgetcsv($fp, 4096); echo '<tr><td>'; echo $cat. '</td><td>' . $name . '</td><td><a href="http://www.' . $web .'" target="_blank">' .$web.'</a></td><td>'.$phone.'</td><td>'.$kw.'</td><td>'.$desc.'</td>' ; echo '</td></tr>'; } fclose($file_handle); show_source(__FILE__); ?> First thing you will probably notice is the extraneous vars within the list(). this is because of how the excel spreadsheet/csv file: Category,,Company Name,,Website,,Phone,,Keywords,,Description ,,,,,,,,,, Clothes,,4imprint,,4imprint.com,,877-466-7746,,"polos, jackets, coats, workwear, sweatshirts, hoodies, long sleeve, pullovers, t-shirts, tees, tshirts,",,An embroidery and apparel company based in Wisconsin. ,,Apollo Embroidery,,apolloemb.com,,1-800-982-2146,,"hats, caps, headwear, bags, totes, backpacks, blankets, embroidery",,An embroidery sales company based in California. One thing to note is that the last line starts with two commas as it is also listed within "Clothes" category. My concern is that I am going about the CSV output wrong. Should I be using a foreach loop instead of this list way? Should I first get rid of any unnecessary blank columns? Please advise any flaws you may find, improvements I can use so I can be ready to import this data to a MySQL DB.

    Read the article

  • go programming POST FormValue can't be printed

    - by poor_programmer
    Before I being a bit of background, I am very new to go programming language. I am running go on Win 7, latest go package installer for windows. I'm not good at coding but I do like some challenge of learning a new language. I wanted to start learn Erlang but found go very interesting based on the GO I/O videos in youtube. I'm having problem with capturing POST form values in GO. I spend three hours yesterday to get go to print a POST form value in the browser and failed miserably. I don't know what I'm doing wrong, can anyone point me to the right direction? I can easily do this in another language like C#, PHP, VB, ASP, Rails etc. I have search the entire interweb and haven't found a working sample. Below is my sample code. Here is Index.html page {{ define "title" }}Homepage{{ end }} {{ define "content" }} <h1>My Homepage</h1> <p>Hello, and welcome to my homepage!</p> <form method="POST" action="/"> <p> Enter your name : <input type="text" name="username"> </P> <p> <button>Go</button> </form> <br /><br /> {{ end }} Here is the base page <!DOCTYPE html> <html lang="en"> <head> <title>{{ template "title" . }}</title> </head> <body> <section id="contents"> {{ template "content" . }} </section> <footer id="footer"> My homepage 2012 copy </footer> </body> </html> now some go code package main import ( "fmt" "http" "strings" "html/template" ) var index = template.Must(template.ParseFiles( "templates/_base.html", "templates/index.html", )) func GeneralHandler(w http.ResponseWriter, r *http.Request) { index.Execute(w, nil) if r.Method == "POST" { a := r.FormValue("username") fmt.Fprintf(w, "hi %s!",a); //<-- this variable does not rendered in the browser!!! } } func helloHandler(w http.ResponseWriter, r *http.Request) { remPartOfURL := r.URL.Path[len("/hello/"):] fmt.Fprintf(w, "Hello %s!", remPartOfURL) } func main() { http.HandleFunc("/", GeneralHandler) http.HandleFunc("/hello/", helloHandler) http.ListenAndServe("localhost:81", nil) } Thanks! PS: Very tedious to add four space before every line of code in stackoverflow especially when you are copy pasting. Didn't find it very user friendly or is there an easier way?

    Read the article

  • Having problems creating an array from XML data in Acrobat Javascript, please help if you can

    - by Kevin Minke
    I have a manually created array that already works example below: var PartsData = { 179: { ref:"", partNum: "201-2007-C00-00", descript: "System Monitor Card (Tracewell Only)", cage: "39764", qty: "1", SMR: "XBOZZ", UOC: "A" }}; Now this array above is is just one value in the array and it works fine. Here is the XML that I am trying to use to dynamically change the values. <?xml version="1.0" encoding="utf-8"?> <partsTables> <partsList> <part sheetNum="ta1"> <breakDownIndexNo>-1 </breakDownIndexNo> <referenceDesg/> <indent>20534220P01 </indent> <description/> <cage>TAC RI, GRADE-A SHOCK (TEC RACK), ALT P/N 72304-1</cage> <qtyPerAssy>23991 </qtyPerAssy> <smr>1 </smr> <uoc>ADODD </uoc> <blank/> </part> </partsList> </partsTables> I have this parsing just fine in Acrobat. Now I want to make the array work for me in using these values. if I have the following below it will work. Where part.item(i).indent.value equals the value of the indent node, etc. newArr = { 179: { ref: part.item(i).referenceDesg.value, partNum: part.item(i).indent.value, descript: part.item(i).cage.value, cage: part.item(i).qtyPerAssy.value, qty: part.item(i).smr.value, SMR: part.item(i).uoc.value, UOC: part.item(i).blank.value}}; As soon as I try to make the 179 value, which is in the breakDownIndexNo node, dynamic by using the direct part.item(i).breakDownIndexNo.value it will not compile. Acrobat is using javascript so I'm not sure why I can not get this to parse. I have tried to create a variable out of the breakDownIndexNo node and typed it to both a String and an Integer. this will let it create the array but it will not let me output from the array. newArr[indexNum].partNum gives me "no properties" where newArr[179].partNum if I were to manually set the index number to 179 will print out the value of part.item(i).indent.value. If any of you have an idea or an answer please let me know.

    Read the article

  • How to populate GridView if Internet not available but images already cached to SD Card

    - by Sophie
    Hello I am writing an Application in which i am parsing JSON Images and then caching into SD Card. What I want to do ? I want to load images into GridView from JSON (by caching images into SD Card), and wanna populate GridView (no matter Internet available or not) once images already downloaded into SD Card. What I am getting ? I am able to cache images into SD Card, also to populate GridView, but not able to show images into GridView (if Internet not available) but images cached into SD Card @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { myGridView = inflater.inflate(R.layout.fragment_church_grid, container, false); if (isNetworkAvailable()) { new DownloadJSON().execute(); } else { Toast.makeText(getActivity(), "Internet not available !", Toast.LENGTH_LONG).show(); } return myGridView ; } private boolean isNetworkAvailable() { ConnectivityManager cm = (ConnectivityManager) getActivity().getSystemService(Context.CONNECTIVITY_SERVICE); NetworkInfo info = cm.getActiveNetworkInfo(); return (info != null); } // DownloadJSON AsyncTask private class DownloadJSON extends AsyncTask<Void, Void, Void> { @Override protected void onPreExecute() { super.onPreExecute(); // Create a progressdialog mProgressDialog = new ProgressDialog(getActivity()); // Set progressdialog title mProgressDialog.setTitle("Church Application"); // Set progressdialog message mProgressDialog.setMessage("Loading Images..."); mProgressDialog.setIndeterminate(false); // Show progressdialog mProgressDialog.show(); } @Override protected Void doInBackground(Void... params) { // Create an array arraylist = new ArrayList<HashMap<String, String>>(); // Retrieve JSON Objects from the given URL address jsonobject = JSONfunctions .getJSONfromURL("http://snapoodle.com/APIS/android/feed.php"); try { // Locate the array name in JSON jsonarray = jsonobject.getJSONArray("print"); for (int i = 0; i < jsonarray.length(); i++) { HashMap<String, String> map = new HashMap<String, String>(); jsonobject = jsonarray.getJSONObject(i); // Retrive JSON Objects map.put("saved_location", jsonobject.getString("saved_location")); // Set the JSON Objects into the array arraylist.add(map); } } catch (JSONException e) { Log.e("Error", e.getMessage()); e.printStackTrace(); } return null; } @Override protected void onPostExecute(Void args) { // Locate the listview in listview_main.xml listview = (GridView) shriRamView.findViewById(R.id.listview); // Pass the results into ListViewAdapter.java adapter = new ChurchImagesAdapter(getActivity(), arraylist); // Set the adapter to the ListView listview.setAdapter(adapter); // Close the progressdialog mProgressDialog.dismiss(); } } }

    Read the article

  • Thread sleep and thread join.

    - by Dhruv Gairola
    hi guys, if i put a thread to sleep in a loop, netbeans gives me a caution saying Invoking Thread.sleep in loop can cause performance problems. However, if i were to replace the sleep with join, no such caution is given. Both versions compile and work fine tho. My code is below (check the last few lines for "Thread.sleep() vs t.join()"). public class Test{ //Display a message, preceded by the name of the current thread static void threadMessage(String message) { String threadName = Thread.currentThread().getName(); System.out.format("%s: %s%n", threadName, message); } private static class MessageLoop implements Runnable { public void run() { String importantInfo[] = { "Mares eat oats", "Does eat oats", "Little lambs eat ivy", "A kid will eat ivy too" }; try { for (int i = 0; i < importantInfo.length; i++) { //Pause for 4 seconds Thread.sleep(4000); //Print a message threadMessage(importantInfo[i]); } } catch (InterruptedException e) { threadMessage("I wasn't done!"); } } } public static void main(String args[]) throws InterruptedException { //Delay, in milliseconds before we interrupt MessageLoop //thread (default one hour). long patience = 1000 * 60 * 60; //If command line argument present, gives patience in seconds. if (args.length > 0) { try { patience = Long.parseLong(args[0]) * 1000; } catch (NumberFormatException e) { System.err.println("Argument must be an integer."); System.exit(1); } } threadMessage("Starting MessageLoop thread"); long startTime = System.currentTimeMillis(); Thread t = new Thread(new MessageLoop()); t.start(); threadMessage("Waiting for MessageLoop thread to finish"); //loop until MessageLoop thread exits while (t.isAlive()) { threadMessage("Still waiting..."); //Wait maximum of 1 second for MessageLoop thread to //finish. /*******LOOK HERE**********************/ Thread.sleep(1000);//issues caution unlike t.join(1000) /**************************************/ if (((System.currentTimeMillis() - startTime) > patience) && t.isAlive()) { threadMessage("Tired of waiting!"); t.interrupt(); //Shouldn't be long now -- wait indefinitely t.join(); } } threadMessage("Finally!"); } } As i understand it, join waits for the other thread to complete, but in this case, arent both sleep and join doing the same thing? Then why does netbeans throw the caution?

    Read the article

  • How to return the value from MySql Stored Proc ??

    - by karthik
    I am using the below storedproc to generate the Insert statements of a specified table It is build-ed without any errors. Now i want to return the result set in "V_string" as output of the SP DELIMITER $$ DROP PROCEDURE IF EXISTS `demo`.`InsertGenerator` $$ CREATE DEFINER=`root`@`localhost` PROCEDURE `InsertGenerator`() SWL_return: BEGIN -- SQLWAYS_EVAL# to retrieve column specific information -- SQLWAYS_EVAL# table DECLARE v_string NATIONAL VARCHAR(3000); -- SQLWAYS_EVAL# first half -- SQLWAYS_EVAL# tement DECLARE v_stringData NATIONAL VARCHAR(3000); -- SQLWAYS_EVAL# data -- SQLWAYS_EVAL# statement DECLARE v_dataType NATIONAL VARCHAR(1000); -- SQLWAYS_EVAL# -- SQLWAYS_EVAL# columns DECLARE v_colName NATIONAL VARCHAR(50); DECLARE NO_DATA INT DEFAULT 0; DECLARE cursCol CURSOR FOR SELECT column_name,data_type FROM `columns` -- WHERE table_name = v_tableName; WHERE table_name = 'tbl_users'; DECLARE CONTINUE HANDLER FOR SQLEXCEPTION BEGIN SET NO_DATA = -2; END; DECLARE CONTINUE HANDLER FOR NOT FOUND SET NO_DATA = -1; OPEN cursCol; SET v_string = CONCAT('INSERT ',v_tableName,'('); SET v_stringData = ''; SET NO_DATA = 0; FETCH cursCol INTO v_colName,v_dataType; IF NO_DATA <> 0 then -- NOT SUPPORTED print CONCAT('Table ',@tableName, ' not found, processing skipped.') close cursCol; LEAVE SWL_return; end if; WHILE NO_DATA = 0 DO IF v_dataType in('varchar','char','nchar','nvarchar') then SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# ll(',v_colName,'SQLWAYS_EVAL# ''+'); ELSE if v_dataType in('text','ntext') then -- SQLWAYS_EVAL# -- SQLWAYS_EVAL# else SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# ll(cast(',v_colName,'SQLWAYS_EVAL# 00)),'''')+'''''',''+'); ELSE IF v_dataType = 'money' then -- SQLWAYS_EVAL# doesn't get converted -- SQLWAYS_EVAL# implicitly SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# y,''''''+ isnull(cast(',v_colName,'SQLWAYS_EVAL# 0)),''0.0000'')+''''''),''+'); ELSE IF v_dataType = 'datetime' then SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# time,''''''+ isnull(cast(',v_colName, 'SQLWAYS_EVAL# 0)),''0'')+''''''),''+'); ELSE IF v_dataType = 'image' then SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# ll(cast(convert(varbinary,',v_colName, 'SQLWAYS_EVAL# 6)),''0'')+'''''',''+'); ELSE SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# ll(cast(',v_colName,'SQLWAYS_EVAL# 0)),''0'')+'''''',''+'); end if; end if; end if; end if; end if; SET v_string = CONCAT(v_string,v_colName,','); SET NO_DATA = 0; FETCH cursCol INTO v_colName,v_dataType; END WHILE; END $$ DELIMITER ;

    Read the article

  • How much time should it take to find the sum of all prime numbers less than 2 million?

    - by Shahensha
    I was trying to solve this Project Euler Question. I implemented the sieve of euler as a helper class in java. It works pretty well for the small numbers. But when I input 2 million as the limit it doesn't return the answer. I use Netbeans IDE. I waited for a lot many hours once, but it still didn't print the answer. When I stopped running the code, it gave the following result Java Result: 2147483647 BUILD SUCCESSFUL (total time: 2,097 minutes 43 seconds) This answer is incorrect. Even after waiting for so much time, this isn't correct. While the same code returns correct answers for smaller limits. Sieve of euler has a very simple algo given at the botton of this page. My implementation is this: package support; import java.util.ArrayList; import java.util.List; /** * * @author admin */ public class SieveOfEuler { int upperLimit; List<Integer> primeNumbers; public SieveOfEuler(int upperLimit){ this.upperLimit = upperLimit; primeNumbers = new ArrayList<Integer>(); for(int i = 2 ; i <= upperLimit ; i++) primeNumbers.add(i); generatePrimes(); } private void generatePrimes(){ int currentPrimeIndex = 0; int currentPrime = 2; while(currentPrime <= Math.sqrt(upperLimit)){ ArrayList<Integer> toBeRemoved = new ArrayList<Integer>(); for(int i = currentPrimeIndex ; i < primeNumbers.size() ; i++){ int multiplier = primeNumbers.get(i); toBeRemoved.add(currentPrime * multiplier); } for(Integer i : toBeRemoved){ primeNumbers.remove(i); } currentPrimeIndex++; currentPrime = primeNumbers.get(currentPrimeIndex); } } public List getPrimes(){ return primeNumbers; } public void displayPrimes(){ for(double i : primeNumbers) System.out.println(i); } } I am perplexed! My questions is 1) Why is it taking so much time? Is there something wrong in what I am doing? Please suggest ways for improving my coding style, if you find something wrong.

    Read the article

  • How to interpret kernel panics?

    - by Owen
    Hi all, I'm new to linux kernel and could barely understand how to debug kernel panics. I have this error below and I don't know where in the C code should I start checking. I was thinking maybe I could echo what functions are being called so I could check where in the code is this null pointer dereferenced. What print function should I use ? How do you interpret the error message below? Unable to handle kernel NULL pointer dereference at virtual address 0000000d pgd = c7bdc000 [0000000d] *pgd=4785f031, *pte=00000000, *ppte=00000000 Internal error: Oops: 17 [#1] PREEMPT Modules linked in: bcm5892_secdom_fw(P) bcm5892_lcd snd_bcm5892 msr bcm5892_sci bcm589x_ohci_p12 bcm5892_skeypad hx_decoder(P) pinnacle hx_memalloc(P) bcm_udc_dwc scsi_mod g_serial sd_mod usb_storage CPU: 0 Tainted: P (2.6.27.39-WR3.0.2ax_standard #1) PC is at __kmalloc+0x70/0xdc LR is at __kmalloc+0x48/0xdc pc : [c0098cc8] lr : [c0098ca0] psr: 20000093 sp : c7a9fd50 ip : c03a4378 fp : c7a9fd7c r10: bf0708b4 r9 : c7a9e000 r8 : 00000040 r7 : bf06d03c r6 : 00000020 r5 : a0000093 r4 : 0000000d r3 : 00000000 r2 : 00000094 r1 : 00000020 r0 : c03a4378 Flags: nzCv IRQs off FIQs on Mode SVC_32 ISA ARM Segment user Control: 00c5387d Table: 47bdc008 DAC: 00000015 Process sh (pid: 1088, stack limit = 0xc7a9e260) Stack: (0xc7a9fd50 to 0xc7aa0000) fd40: c7a6a1d0 00000020 c7a9fd7c c7ba8fc0 fd60: 00000040 c7a6a1d0 00000020 c71598c0 c7a9fd9c c7a9fd80 bf06d03c c0098c64 fd80: c71598c0 00000003 c7a6a1d0 bf06c83c c7a9fdbc c7a9fda0 bf06d098 bf06d008 fda0: c7159880 00000000 c7a6a2d8 c7159898 c7a9fde4 c7a9fdc0 bf06d130 bf06d078 fdc0: c79ca000 c7159880 00000000 00000000 c7afbc00 c7a9e000 c7a9fe0c c7a9fde8 fde0: bf06d4b4 bf06d0f0 00000000 c79fd280 00000000 0f700000 c7a9e000 00000241 fe00: c7a9fe3c c7a9fe10 c01c37b4 bf06d300 00000000 c7afbc00 00000000 00000000 fe20: c79cba84 c7463c78 c79fd280 c7473b00 c7a9fe6c c7a9fe40 c00a184c c01c35e4 fe40: 00000000 c7bb0005 c7a9fe64 c79fd280 c7463c78 00000000 c00a1640 c785e380 fe60: c7a9fe94 c7a9fe70 c009c438 c00a164c c79fd280 c7a9fed8 c7a9fed8 00000003 fe80: 00000242 00000000 c7a9feb4 c7a9fe98 c009c614 c009c2a4 00000000 c7a9fed8 fea0: c7a9fed8 00000000 c7a9ff64 c7a9feb8 c00aa6bc c009c5e8 00000242 000001b6 fec0: 000001b6 00000241 00000022 00000000 00000000 c7a9fee0 c785e380 c7473b00 fee0: d8666b0d 00000006 c7bb0005 00000300 00000000 00000000 00000001 40002000 ff00: c7a9ff70 c79b10a0 c79b10a0 00005402 00000003 c78d69c0 ffffff9c 00000242 ff20: 000001b6 c79fd280 c7a9ff64 c7a9ff38 c785e380 c7473b00 00000000 00000241 ff40: 000001b6 ffffff9c 00000003 c7bb0000 c7a9e000 00000000 c7a9ff94 c7a9ff68 ff60: c009c128 c00aa380 4d18b5f0 08000000 00000000 00071214 0007128c 00071214 ff80: 00000005 c0027ee4 c7a9ffa4 c7a9ff98 c009c274 c009c0d8 00000000 c7a9ffa8 ffa0: c0027d40 c009c25c 00071214 0007128c 0007128c 00000241 000001b6 00000000 ffc0: 00071214 0007128c 00071214 00000005 00073580 00000003 000713e0 400010d0 ffe0: 00000001 bef0c7b8 000269cc 4d214fec 60000010 0007128c 00000000 00000000 Backtrace: [] (__kmalloc+0x0/0xdc) from [] (gs_alloc_req+0x40/0x70 [g_serial]) r8:c71598c0 r7:00000020 r6:c7a6a1d0 r5:00000040 r4:c7ba8fc0 [] (gs_alloc_req+0x0/0x70 [g_serial]) from [] (gs_alloc_requests+0x2c/0x78 [g_serial]) r7:bf06c83c r6:c7a6a1d0 r5:00000003 r4:c71598c0 [] (gs_alloc_requests+0x0/0x78 [g_serial]) from [] (gs_start_io+0x4c/0xac [g_serial]) r7:c7159898 r6:c7a6a2d8 r5:00000000 r4:c7159880 [] (gs_start_io+0x0/0xac [g_serial]) from [] (gs_open+0x1c0/0x224 [g_serial]) r9:c7a9e000 r8:c7afbc00 r7:00000000 r6:00000000 r5:c7159880 r4:c79ca000 [] (gs_open+0x0/0x224 [g_serial]) from [] (tty_open+0x1dc/0x314) [] (tty_open+0x0/0x314) from [] (chrdev_open+0x20c/0x22c) [] (chrdev_open+0x0/0x22c) from [] (__dentry_open+0x1a0/0x2b8) r8:c785e380 r7:c00a1640 r6:00000000 r5:c7463c78 r4:c79fd280 [] (__dentry_open+0x0/0x2b8) from [] (nameidata_to_filp+0x38/0x50) [] (nameidata_to_filp+0x0/0x50) from [] (do_filp_open+0x348/0x6f4) r4:00000000 [] (do_filp_open+0x0/0x6f4) from [] (do_sys_open+0x5c/0x170) [] (do_sys_open+0x0/0x170) from [] (sys_open+0x24/0x28) r8:c0027ee4 r7:00000005 r6:00071214 r5:0007128c r4:00071214 [] (sys_open+0x0/0x28) from [] (ret_fast_syscall+0x0/0x2c) Code: e59c4080 e59c8090 e3540000 159c308c (17943103) ---[ end trace be196e7cee3cb1c9 ]--- note: sh[1088] exited with preempt_count 2 process '-/bin/sh' (pid 1088) exited. Scheduling for restart. Welcome to Wind River Linux

    Read the article

  • Safely escaping and reading back a file path in ruby

    - by user336851
    I need to save a few informations about some files. Nothing too fancy so I thought I would go with a simple one line per item text file. Something like this : # write io.print "%i %s %s\n" % [File.mtime(fname), fname, Digest::SHA1.file(fname).hexdigest] # read io.each do |line| mtime, name, hash = line.scanf "%i %s %s" end Of course this doesn't work because a file name can contain spaces (breaking scanf) and line breaks (breaking IO#each). The line break problem can be avoided by dropping the use of each and going with a bunch of gets(' ') while not io.eof? mtime = Time.at(io.gets(" ").to_i) name = io.gets " " hash = io.gets "\n" end Dealing with spaces in the names is another matter. Now we need to do some escaping. note : I like space as a record delimiter but I'd have no issue changing it for one easier to use. In the case of filenames though, the only one that could help is ascii nul "\0" but a nul delimited file isn't really a text file anymore... I initially had a wall of text detailing the iterations of my struggle to make a correct escaping function and its reciprocal but it was just boring and not really useful. I'll just give you the final result: def write_name(io, val) io << val.gsub(/([\\ ])/, "\\\\\\1") # yes that' 6 backslashes ! end def read_name(io) name, continued = "", true while continued continued = false name += io.gets(' ').gsub(/\\(.)/) do |c| if c=="\\\\" "\\" elsif c=="\\ " continued=true " " else raise "unexpected backslash escape : %p (%s %i)" % [c, io.path, io.pos] end end end return name.chomp(' ') end I'm not happy at all with read_name. Way too long and akward, I feel it shouldn't be that hard. While trying to make this work I tried to come up with other ways : the bittorrent encoded / php serialize way : prefix the file name with the length of the name then just io.read(name_len.to_i). It works but it's a real pita to edit the file by hand. At this point we're halfway to a binary format. String#inspect : This one looks expressly made for that purpose ! Except it seems like the only way to get the value back is through eval. I hate the idea of eval-ing a string I didn't generate from trusted data. So. Opinions ? Isn't there some lib which can do all this ? Am I missing something obvious ? How would you do that ?

    Read the article

  • CSS Graph- Bars not showing correctly

    - by Olivia
    I'm trying to create a CSS/HTML based graph using this tutorial here. However instead of putting the data directly into the html code I'm importing it from a CSV file using PHP with the following code. <?PHP /* Open CSV file */ $handle = fopen("defects.csv", "r"); $c = 0; /* gets data from csv file */ while (($data = fgetcsv($handle, 1000, ",")) !== FALSE) { /* stores dates as variable $date */ $date[$c] = $data[0]; $c++; /* inserts defect data into html code */ echo "<dd class=\"p" . $data[2] . "\"><span><b>" . $data[2] . "</b></span></dd>"; echo "<dd class=\"sub p" . $data[3] . "\" ><span><b>" . $data[3] . "</b></span></dd>"; } echo "</dl>"; echo "<ul class=\"xAxis\">"; /* X AXIS */ /* inserts date data into html code for x axis */ for ($d=0; $d < $c; $d++) { echo "<li>" . $date[$d] . "</li>"; } ?> The values are being placed correctly on the chart, but the bars aren't appearing. The CSS code I have for the bars is: /* default column styling */ dl#csschart span{ height:50%; background:url(../images/barx.png) repeat-y; } dl#csschart .sub{ margin-left:-33px; } dl#csschart .sub span{ background:url(../images/subBarx.png) repeat-y; } Just in case it helps, I've print screened how the graph should look. You can see it at: http://allured.info/graph/failgraph.png

    Read the article

  • Parsing XML file using a for loop

    - by Johnny Spintel
    I have been working on this program which inserts an XML file into a MYSQL database. I'm new to the whole .jar idea by inserting packages. Im having an issue with parse(), select(), and children(). Can someone inform me how I could fix this issue? Here is my stack trace and my program below: Exception in thread "main" java.lang.Error: Unresolved compilation problems: The method select(String) is undefined for the type Document The method children() is undefined for the type Element The method children() is undefined for the type Element The method children() is undefined for the type Element The method children() is undefined for the type Element at jdbc.parseXML.main(parseXML.java:28) import java.io.*; import java.sql.*; import org.jsoup.Jsoup; import org.w3c.dom.*; import javax.xml.parsers.*; public class parseXML{ public static void main(String xml) { try{ BufferedReader br = new BufferedReader(new FileReader(new File("C:\\staff.xml"))); String line; StringBuilder sb = new StringBuilder(); while((line=br.readLine())!= null){ sb.append(line.trim()); } Document doc = Jsoup.parse(line); StringBuilder queryBuilder; StringBuilder columnNames; StringBuilder values; for (Element row : doc.select("row")) { // Start the query queryBuilder = new StringBuilder("insert into customer("); columnNames = new StringBuilder(); values = new StringBuilder(); for (int x = 0; x < row.children().size(); x++) { // Append the column name and it's value columnNames.append(row.children().get(x).tagName()); values.append(row.children().get(x).text()); if (x != row.children().size() - 1) { // If this is not the last item, append a comma columnNames.append(","); values.append(","); } else { // Otherwise, add the closing paranthesis columnNames.append(")"); values.append(")"); } } // Add the column names and values to the query queryBuilder.append(columnNames); queryBuilder.append(" values("); queryBuilder.append(values); // Print the query System.out.println(queryBuilder); } }catch (Exception err) { System.out.println(" " + err.getMessage ()); } } }

    Read the article

  • php zencart mod - having problems with attributes array

    - by user80151
    I inherited a zencart mod and can't figure out what's wrong. The customer selects a product and an attribute (model#). This is then sent to another form that they complete. When they submit the form, the product and the attribute should be included in the email sent. At this time, only the product is coming through. The attribute just says "array." The interesting part is, when I delete the line that prints the attribute, the products_options_names will print out. So I know that both the product and the products_options_names are working. The attribute is the only thing that is not working right. Here's what I believe to be the significant code. This is the page that has the form, so the attribute should already be passed to the form. //Begin Adding of New features //$productsimage = $product['productsImage']; $productsname = $product['productsName']; $attributes = $product['attributes']; $products_options_name = $value['products_options_name']; $arr_product_list[] = "<strong>Product Name:</strong> $productsname <br />"; $arr_product_list[] .= "<strong>Attributes:</strong> $attributes <br />"; $arr_product_list[] .= "<strong>Products Options Name:</strong> $products_options_name <br />"; $arr_product_list[] .= "---------------------------------------------------------------"; //End Adding of New features } // end foreach ($productArray as $product) ?> Above this, there is another section that has attributes: <?php echo $product['attributeHiddenField']; if (isset($product['attributes']) && is_array($product['attributes'])) { echo '<div class="cartAttribsList">'; echo '<ul>'; reset($product['attributes']); foreach ($product['attributes'] as $option => $value) { ?> Can anyone help me figure out what is wrong? I'm not sure if the problem is on this page or if the attribute isn't being passed to this page. TIA

    Read the article

  • plane bombing problems- help

    - by peiska
    I'm training code problems, and on this one I am having problems to solve it, can you give me some tips how to solve it please. The problem is something like this: Your task is to find the sequence of points on the map that the bomber is expected to travel such that it hits all vital links. A link from A to B is vital when its absence isolates completely A from B. In other words, the only way to go from A to B (or vice versa) is via that link. Notice that if we destroy for example link (d,e), it becomes impossible to go from d to e,m,l or n in any way. A vital link can be hit at any point that lies in its segment (e.g. a hit close to d is as valid as a hit close to e). Of course, only one hit is enough to neutralize a vital link. Moreover, each bomb affects an exact circle of radius R, i.e., every segment that intersects that circle is considered hit. Due to enemy counter-attack, the plane may have to retreat at any moment, so the plane should follow, at each moment, to the closest vital link possible, even if in the end the total distance grows larger. Given all coordinates (the initial position of the plane and the nodes in the map) and the range R, you have to determine the sequence of positions in which the plane has to drop bombs. This sequence should start (takeoff) and finish (landing) at the initial position. Except for the start and finish, all the other positions have to fall exactly in a segment of the map (i.e. it should correspond to a point in a non-hit vital link segment). The coordinate system used will be UTM (Universal Transverse Mercator) northing and easting, which basically corresponds to a Euclidian perspective of the world (X=Easting; Y=Northing). Input Each input file will start with three floating point numbers indicating the X0 and Y0 coordinates of the airport and the range R. The second line contains an integer, N, indicating the number of nodes in the road network graph. Then, the next N (<10000) lines will each contain a pair of floating point numbers indicating the Xi and Yi coordinates (1 No two links will ever cross with each other. Output The program will print the sequence of coordinates (pairs of floating point numbers with exactly one decimal place), each one at a line, in the order that the plane should visit (starting and ending in the airport). Sample input 1 102.3 553.9 0.2 14 342.2 832.5 596.2 638.5 479.7 991.3 720.4 874.8 744.3 1284.1 1294.6 924.2 1467.5 659.6 1802.6 659.6 1686.2 860.7 1548.6 1111.2 1834.4 1054.8 564.4 1442.8 850.1 1460.5 1294.6 1485.1 17 1 2 1 3 2 4 3 4 4 5 4 6 6 7 7 8 8 9 8 10 9 10 10 11 6 11 5 12 5 13 12 13 13 14 Sample output 1 102.3 553.9 720.4 874.8 850.1 1460.5 102.3 553.9

    Read the article

  • Sorted sets and comparators

    - by Jack
    Hello, I'm working with a TreeSetthat is meant to store pathfind locations used during the execution of a A* algorithm. Basically until there are "open" elements (still to be exhaustively visited) the neighbours of every open element are taken into consideration and added to a SortedSetthat keeps them ordered by their cost and heuristic cost. This means that I have a class like: public class PathTileInfo implements Comparable<PathTileInfo> { int cost; int hCost; final int x, y; @Override public int compareTo(PathTileInfo t2) { int c = cost + hCost; int c2 = t2.cost + t2.hCost; int costComp = c < c2 ? -1 : (c > c2 ? 1: 0); return costComp != 0 ? costComp : (x < t2.x || y < t2.y ? -1 : (x > t2.x || y > t2.y ? 1 : 0)); } @Override public boolean equals(Object o2) { if (o2 instanceof PathTileInfo) { PathTileInfo i = (PathTileInfo)o2; return i.cost + i.hCost == cost + hCost && x == i.x && y == i.y; } return false; } } In this way first the total cost is considered, then, since a total ordering is needed (consistency with equals) a ordering according to the x,y coordinate is taken into account. This should work but simply it doesn't, if I iterate over the TreeSet during the algorithm execution like in for (PathTileInfo t : openSet) System.out.print("("+t.x+","+t.y+","+(t.cost+t.hCost)+") "); I get results in which the right ordering is not kept, eg: (7,7,6) (7,6,7) (6,8,6) (6,6,7) (5,8,7) (5,7,7) (6,7,6) (6,6,7) (6,5,7) (5,7,7) (5,5,8) (4,7,7) (4,6,8) (4,5,8) is there something subtle I am missing? Thanks!

    Read the article

  • Delegates does not work properly

    - by Warrior
    I am new to iPhone development. I am converting the date to the desired format and set it to the delegate and get its value in the another view. The session restarts when I tried to get the value from delegate. If I set the original date and not the formatted date in the set delegate, then i able to get the value in the another view. If I also give any static string value, then also I am able to the static string value back. Only the formatted date which is string is set then the session restarts. If i print and check the value of the formatted date it prints the correct formatted date only.Please help me out.Here is my code for date conversion NSString *dateval=[[stories objectAtIndex: storyIndex] objectForKey:@"date"]; NSDateFormatter *inputFormatter = [[NSDateFormatter alloc] init]; [inputFormatter setDateFormat:@"EEE, MMM dd, yyyy"]; NSDate *inputDate = [inputFormatter dateFromString:dateval]; NSDateFormatter *outputFormatter = [[NSDateFormatter alloc] init]; [outputFormatter setDateFormat:@"MMMM dd"]; NSString *outputDate = [outputFormatter stringFromDate:inputDate]; AppDelegate *delegate=(AppDelegate *)[[UIApplication sharedApplication]delegate]; [delegate setCurrentDates:outputDate]; EDIT: This is displayed in console inside view did load [Session started at 2010-04-21 19:12:53 +0530.] GNU gdb 6.3.50-20050815 (Apple version gdb-967) (Tue Jul 14 02:11:58 UTC 2009) Copyright 2004 Free Software Foundation, Inc. GDB is free software, covered by the GNU General Public License, and you are welcome to change it and/or distribute copies of it under certain conditions. Type "show copying" to see the conditions. There is absolutely no warranty for GDB. Type "show warranty" for details. This GDB was configured as "i386-apple-darwin".sharedlibrary apply-load-rules all Attaching to process 4216. (gdb) In another view - (void)viewDidLoad { NSLog(@"inside view did load"); AppDelegate *delegate=(AppDelegate *)[[UIApplication sharedApplication]delegate]; NSString *titleValue=[delegate getCurrentDates]; self.navigationItem.title =titleValue ; } The get does not work properly.It works fine if i give any static string or the "dateval". Thanks.

    Read the article

  • Dynamically loading modules in Python (+ threading question)

    - by morpheous
    I am writing a Python package which reads the list of modules (along with ancillary data) from a configuration file. I then want to iterate through each of the dynamically loaded modules and invoke a do_work() function in it which will spawn a new thread, so that the code runs in a separate thread. At the moment, I am importing the list of all known modules at the beginning of my main script - this is a nasty hack I feel, and is not very flexible, as well as being a maintenance pain. This is the function that spawns the threads. I will like to modify it to dynamically load the module when it is encountered. The key in the dictionary is the name of the module containing the code: def do_work(work_info): for (worker, dataset) in work_info.items(): #import the module defined by variable worker here... t = threading.Thread(target=worker.do_work, args=[dataset]) # I'll NOT dameonize since spawned children need to clean up on shutdown # Since the threads will be holding resources #t.daemon = True t.start() Question 1 When I call the function in my script (as written above), I get the following error: AttributeError: 'str' object has no attribute 'do_work' Which makes sense, since the dictionary key is a string (name of the module to be imported). When I add the statement: import worker before spawning the thread, I get the error: ImportError: No module named worker This is strange, since the variable name rather than the value it holds are being used - when I print the variable, I get the value (as I expect) whats going on? Question 2 As I mentioned in the comments section, I realize that the do_work() function written in the spawned children needs to cleanup after itself. My understanding is to write a clean_up function that is called when do_work() has completed successfully, or an unhandled exception is caught - is there anything more I need to do to ensure resources don't leak or leave the OS in an unstable state? Question 3 If I comment out the t.daemon flag statement, will the code stil run ASYNCHRONOUSLY?. The work carried out by the spawned children are pretty intensive, and I don't want to have to be waiting for one child to finish before spawning another child. BTW, I am aware that threading in Python is in reality, a kind of time sharing/slicing - thats ok Lastly is there a better (more Pythonic) way of doing what I'm trying to do?

    Read the article

  • python object to native c++ pointer

    - by Lodle
    Im toying around with the idea to use python as an embedded scripting language for a project im working on and have got most things working. However i cant seem to be able to convert a python extended object back into a native c++ pointer. So this is my class: class CGEGameModeBase { public: virtual void FunctionCall()=0; virtual const char* StringReturn()=0; }; class CGEPYGameMode : public CGEGameModeBase, public boost::python::wrapper<CGEPYGameMode> { public: virtual void FunctionCall() { if (override f = this->get_override("FunctionCall")) f(); } virtual const char* StringReturn() { if (override f = this->get_override("StringReturn")) return f(); return "FAILED TO CALL"; } }; Boost wrapping: BOOST_PYTHON_MODULE(GEGameMode) { class_<CGEGameModeBase, boost::noncopyable>("CGEGameModeBase", no_init); class_<CGEPYGameMode, bases<CGEGameModeBase> >("CGEPYGameMode", no_init) .def("FunctionCall", &CGEPYGameMode::FunctionCall) .def("StringReturn", &CGEPYGameMode::StringReturn); } and the python code: import GEGameMode def Ident(): return "Alpha" def NewGamePlay(): return "NewAlpha" def NewAlpha(): import GEGameMode import GEUtil class Alpha(GEGameMode.CGEPYGameMode): def __init__(self): print "Made new Alpha!" def FunctionCall(self): GEUtil.Msg("This is function test Alpha!") def StringReturn(self): return "This is return test Alpha!" return Alpha() Now i can call the first to functions fine by doing this: const char* ident = extract< const char* >( GetLocalDict()["Ident"]() ); const char* newgameplay = extract< const char* >( GetLocalDict()["NewGamePlay"]() ); printf("Loading Script: %s\n", ident); CGEPYGameMode* m_pGameMode = extract< CGEPYGameMode* >( GetLocalDict()[newgameplay]() ); However when i try and convert the Alpha class back to its base class (last line above) i get an boost error: TypeError: No registered converter was able to extract a C++ pointer to type class CGEPYGameMode from this Python object of type Alpha I have done alot of searching on the net but cant work out how to convert the Alpha object into its base class pointer. I could leave it as an object but rather have it as a pointer so some non python aware code can use it. Any ideas?

    Read the article

  • IContextMenu::GetCommandString Not showing help text in Windows Explorer

    - by Grant
    Hi, i am implementing a shell context menu for windows explorer and have successfully created the menu's. What i am having trouble with is the IContextMenu::GetCommandString method that displays the help text in the status bar when you hover over the selected menu item. When i do hover over each item nothing is displayed, but whats weird is that some of the other items that i didnt create, eg - open, or print have had their help text turned into garbage.. Here is a code sample of IContextMenu::QueryContextMenu & IContextMenu::GetCommandString.. int ShellExtLib.IContextMenu.QueryContextMenu(IntPtr hMenu, uint indexMenu, uint idCmdFirst, uint idCmdLast, uint uFlags) { uint idCmd = idCmdFirst; StringBuilder sb = new StringBuilder(1024); try { if ((uFlags & 0xf) == 0 || (uFlags & (uint)ShellExtLib.CMF.CMF_EXPLORE) != 0) { uint selectedFileCount = Helpers.DragQueryFile(m_hDrop, 0xffffffff, null, 0); if (selectedFileCount == 1) { Helpers.DragQueryFile(m_hDrop, 0, sb, sb.Capacity + 1); Documents.Add(sb.ToString()); } else { // MULTIPLE FILES SELECTED. for (uint i = 0; i < selectedFileCount; i++) { Helpers.DragQueryFile(m_hDrop, i, sb, sb.Capacity + 1); Documents.Add(sb.ToString()); } } Helpers.InsertMenu(hMenu, indexMenu++, ShellExtLib.UFLAGS.MF_SEPARATOR | ShellExtLib.UFLAGS.MF_BYPOSITION, 0, null); IntPtr hSubMenu = Helpers.CreateMenu(); if (hSubMenu != IntPtr.Zero) { Helpers.InsertMenu(hSubMenu, 0, ShellExtLib.UFLAGS.MF_STRING | ShellExtLib.UFLAGS.MF_BYPOSITION, idCmd++, "Item 1"); Helpers.InsertMenu(hSubMenu, 1, ShellExtLib.UFLAGS.MF_STRING | ShellExtLib.UFLAGS.MF_BYPOSITION, idCmd++, "Item 2"); Helpers.InsertMenu(hSubMenu, 2, ShellExtLib.UFLAGS.MF_SEPARATOR | ShellExtLib.UFLAGS.MF_BYPOSITION, idCmd++, null); Helpers.InsertMenu(hSubMenu, 3, ShellExtLib.UFLAGS.MF_STRING | ShellExtLib.UFLAGS.MF_BYPOSITION, idCmd++, "Item 3"); Helpers.InsertMenu(hSubMenu, 4, ShellExtLib.UFLAGS.MF_SEPARATOR | ShellExtLib.UFLAGS.MF_BYPOSITION, idCmd++, null); Helpers.InsertMenu(hSubMenu, 5, ShellExtLib.UFLAGS.MF_STRING | ShellExtLib.UFLAGS.MF_BYPOSITION, idCmd++, "Item 4"); Helpers.InsertMenu(hSubMenu, 6, ShellExtLib.UFLAGS.MF_STRING | ShellExtLib.UFLAGS.MF_BYPOSITION, idCmd++, "Item 5"); } Helpers.InsertMenu(hMenu, indexMenu++, ShellExtLib.UFLAGS.MF_STRING | ShellExtLib.UFLAGS.MF_BYPOSITION | ShellExtLib.UFLAGS.MF_POPUP, (uint)hSubMenu, "Main Menu"); Helpers.InsertMenu(hMenu, indexMenu++, ShellExtLib.UFLAGS.MF_SEPARATOR | ShellExtLib.UFLAGS.MF_BYPOSITION, 0, null); return (int)(idCmd - idCmdFirst); } } catch { } return 0; } void ShellExtLib.IContextMenu.GetCommandString(int idCmd, uint uFlags, int pwReserved, StringBuilder commandString, int cchMax) { switch (uFlags) { case (uint)ShellExtLib.GCS.VERB: commandString = new StringBuilder("x"); break; case (uint)ShellExtLib.GCS.HELPTEXTA: commandString = new StringBuilder("y"); break; } } Does anyone have any suggestions? I have read a number of articles on how to build shell extensions and have also been reading MSDN as well.. Thanks.

    Read the article

< Previous Page | 334 335 336 337 338 339 340 341 342 343 344 345  | Next Page >