Search Results

Search found 9335 results on 374 pages for 'extension modules'.

Page 346/374 | < Previous Page | 342 343 344 345 346 347 348 349 350 351 352 353  | Next Page >

  • Clojure vars and Java static methods

    - by j-g-faustus
    I'm a few days into learning Clojure and are having some teething problems, so I'm asking for advice. I'm trying to store a Java class in a Clojure var and call its static methods, but it doesn't work. Example: user=> (. java.lang.reflect.Modifier isPrivate 1) false user=> (def jmod java.lang.reflect.Modifier) #'user/jmod user=> (. jmod isPrivate 1) java.lang.IllegalArgumentException: No matching method found: isPrivate for class java.lang.Class (NO_SOURCE_FILE:0) at clojure.lang.Compiler.eval(Compiler.java:4543) From the exception it looks like the runtime expects a var to hold an object, so it calls .getClass() to get the class and looks up the method using reflection. In this case the var already holds a class, so .getClass() returns java.lang.Class and the method lookup obviously fails. Is there some way around this, other than writing my own macro? In the general case I'd like to have either an object or a class in a varible and call the appropriate methods on it - duck typing for static methods as well as for instance methods. In this specific case I'd just like a shorter name for java.lang.reflect.Modifier, an alias if you wish. I know about import, but looking for something more general, like the Clojure namespace alias but for Java classes. Are there other mechanisms for doing this? Edit: Maybe I'm just confused about the calling conventions here. I thought the Lisp (and by extension Clojure) model was to evaluate all arguments and call the first element in the list as a function. In this case (= jmod java.lang.reflect.Modifier) returns true, and (.getName jmod) and (.getName java.lang.reflect.Modifier) both return the same string. So the variable and the class name clearly evaluate to the same thing, but they still cannot be called in the same fashion. What's going on here? Edit 2 Answering my second question (what is happening here), the Clojure doc says that If the first operand is a symbol that resolves to a class name, the access is considered to be to a static member of the named class... Otherwise it is presumed to be an instance member http://clojure.org/java_interop under "The Dot special form" "Resolving to a class name" is apparently not the same as "evaluating to something that resolves to a class name", so what I am trying to do here is something the dot special form does not support.

    Read the article

  • Using PHP session_id() to Make Sure iframe is Generated by Our Server Dynamically

    - by Michael Robinson
    We use iframes to show ads on our site. Iframes are used to allow us to keep the ad generation code and other site modules separate. As we track ad views on our site, and need to be able to keep an accurate count of which pagetype gets what views, I must ensure that users can't simply copy-paste the iframe in which the ad is loaded onto another site. This would cause ad count to become inflated for this page, and the count would not match the view count of the page the iframe "should" be displayed in. Before anyone says so: no I can't simply compare the page view count with the ad view count, or use the page view count * number of ads per page, as # of ads per page will not necessarily be static. I need to come up with a solution that will allow ads to be shown only for iframes that are generated dynamically and are shown on our pages. I am not familiar with PHP sessions, but from what little reading I have had time to do, the following seems to be to be an acceptable solution: Add "s = session_id()" to the src of the ad's iframe. In the code that receives and processes ad requests, only return (and count) and ad if s == session_id(). Please correct me if I'm wrong, but this would ensure: Ads would only be returned to iframes whose src was generated alongside the rest of the page's content, as is the case during normal use. We can return our logo to ad calls with an invalid session_id. So a simple example would be: One of our pages: <?php session_start(); ?> <div id="someElement"> <!-- EVERYONE LOVES ADS --> <iframe src="http//awesomesite.com/ad/can_has_ad.php?s=<?php echo session_id(); ?>></iframe> </div> ad/can_has_ad.php: <?php session_start(); ?> if($_GET['s'] == session_id()){ echo 'can has ad'; } else{ echo '<img src="http://awesomesite.com/images/canhaslogo.jpg"/>'; } And finally, copied code with static 's' parameter: <!-- HAHA LULZ I WILL SCREW WITH YOUR AD VIEW COUNTS LULZ HAHA --> <iframe src="http//awesomesite.com/ad/can_has_ad.php?s=77f2b5fcdab52f52607888746969b0ad></iframe> Which would give them an iframe showing our awesome site's logo, and not screw with our view counts. I made some basic test cases: two files, one that generates the iframe and echos it, and one that the iframe's src is pointed to, that checks the 's' parameter and shows an appropriate message depending on the result. I copied the iframe into a file and hosted it on a different server, and the correct message was displayed (cannot has ad). So, my question is: Would this work or am I being a PHP session noob, with the above test being a total fluke? Thanks for your time! Edit: I'm trying to solve this without touching the SQL server

    Read the article

  • jquery 1.4.1 breaks my slideshow

    - by JMC Creative
    After toying with the jquery slideshow extension, I created my own that better suited my purposes ( I didn't like that all the images needed to load at the beginning for instance). Now, upon upgrading to jQuery 1.4.2 (I know I'm late), the slideshow loads the first image fine ( from the line$('div#slideshow img#ssone').fadeIn(1500); towards the bottom), but doesn't do anything beyond that. Does anyone have any idea which jquery construct is killing my script? The live page is at lplonline.org which is using 1.3.2 for the time being. Thanks in advance. Array.prototype.random = function( r ) { var i = 0, l = this.length; if( !r ) { r = this.length; } else if( r > 0 ) { r = r % l; } else { i = r; r = l + r % l; } return this[ Math.floor( r * Math.random() - i ) ]; }; jQuery(function($){ var imgArr = new Array(); imgArr[1] = "wp-content/uploads/rotator/Brbrshop4-hrmnywkshp72006.jpg"; imgArr[2] = "wp-content/uploads/rotator/IMGA0125.JPG"; //etc, etc, about 30 of these are created dynamically from a db function randImgs () { var randImg = imgArr.random(); var img1 = $('div#slideshow img#ssone'); var img2 = $('div#slideshow img#sstwo'); if(img1.is(':visible') ) { img2.fadeIn(1500); img1.fadeOut(1500,function() { img1.attr({src : randImg}); }); } else { img1.fadeIn(1500); img2.fadeOut(1500,function() { img2.attr({src : randImg}); }); } } setInterval(randImgs,9000); // 9 SECONDS $('div#slideshow img#ssone').fadeIn(1500); }); </script> <div id="slideshow"> <img id="ssone" style="display:none;" src="wp-content/uploads/rotator/quote-investments.png" alt="" /> <img id="sstwo" style="display:none;" src="wp-content/uploads/rotator/quote-drugs.png" alt="" /> </div>

    Read the article

  • Using pointers, references, handles to generic datatypes, as generic and flexible as possible

    - by Patrick
    In my application I have lots of different data types, e.g. Car, Bicycle, Person, ... (they're actually other data types, but this is just for the example). Since I also have quite some 'generic' code in my application, and the application was originally written in C, pointers to Car, Bicycle, Person, ... are often passed as void-pointers to these generic modules, together with an identification of the type, like this: Car myCar; ShowNiceDialog ((void *)&myCar, DATATYPE_CAR); The 'ShowNiceDialog' method now uses meta-information (functions that map DATATYPE_CAR to interfaces to get the actual data out of Car) to get information of the car, based on the given data type. That way, the generic logic only has to be written once, and not every time again for every new data type. Of course, in C++ you could make this much easier by using a common root class, like this class RootClass { public: string getName() const = 0; }; class Car : public RootClass { ... }; void ShowNiceDialog (RootClass *root); The problem is that in some cases, we don't want to store the data type in a class, but in a totally different format to save memory. In some cases we have hundreds of millions of instances that we need to manage in the application, and we don't want to make a full class for every instance. Suppose we have a data type with 2 characteristics: A quantity (double, 8 bytes) A boolean (1 byte) Although we only need 9 bytes to store this information, putting it in a class means that we need at least 16 bytes (because of the padding), and with the v-pointer we possibly even need 24 bytes. For hundreds of millions of instances, every byte counts (I have a 64-bit variant of the application and in some cases it needs 6 GB of memory). The void-pointer approach has the advantage that we can almost encode anything in a void-pointer and decide how to use it if we want information from it (use it as a real pointer, as an index, ...), but at the cost of type-safety. Templated solutions don't help since the generic logic forms quite a big part of the application, and we don't want to templatize all this. Additionally, the data model can be extended at run time, which also means that templates won't help. Are there better (and type-safer) ways to handle this than a void-pointer? Any references to frameworks, whitepapers, research material regarding this?

    Read the article

  • Is "Systems Designer" the job title that best describes what I do? [closed]

    - by ivo-rossi
    After having worked as Java developer for almost 3 years in the same company that I currently work at, I moved to a new position associated with the development of the same application. I’m in this new position for more than 1 year now. My official job title is Systems Designer, but I’m not sure this is a title that expresses well what I do. So my question here is what would be the most appropriate job title for me? I see this question as important for my career development. After all, I should be able to explain in one word what I do. And it’s no longer “Java Developer”. Well, in more than one word, this is what I do: The business analysts gather requirements / business problems to be solved with the clients and then discuss these requirements with me. Given the requirements, I design the high level solutions to be implemented in our system (e.g. a new screen on the client application, modifications to existing reports, extension to the XML export format of some objects, etc). I base my decision on the current capabilities of the system, the overall impact that the solutions would have on the system and the estimated effort to implement them (as I was a developer of this same application for almost 3 years before I moved to this position, I’m confident in my estimates). The solutions are discussed iteratively with the business analysts until we agree that they are good. The outcome of this analysis is what we call the “requirements design” document, which is written by me, shared with clients for approval and then also with the team that is going to implement the solutions and test them. Note that there are a few problems that I need to find a solution for that are non-functional. If the users are unhappy with the performance of a certain tool, I will investigate what can be done to speed it up. I will do some research – often based in the Java code itself - to identify possibilities of optimizations. But in this new position I no longer code, the main outcome of my work is really the “requirements design”. Is “Systems Designer” really the most appropriate job title?

    Read the article

  • Myself throwing NullReferenceException... needs help

    - by Amit Ranjan
    I know it might be a weird question and its Title too, but i need your help. I am a .net dev , working on platform for the last 1.5 years. I am bit confused on the term usually we say " A Good Programmer ". I dont know ,what are the qualities of a good programmer ? Is the guy who writes a bug free code? or Can develop applications solely? or blah blah blah...lots of points. I dont know... But as far i am concerned , I know I am not a good programmer, still in learning phase an needs a lot to learn in coming days. So you guys are requested to please help me with this two problems of mine My first problem is regarding the proper Error Handling, which is a most debatable aspect of programming. We all know we use ` try { } catch { } finally { } ` in our code to manage exception. But even if I use try { } catch(exception ex) { throw ex } finally { } , different guys have different views. I still dont know the good way to handle errors. I can write code, use try-catch but still i feel I lacks something. When I saw the codes generated by .net fx tools even they uses throw ex or `throw new Exception("this is my exception")`.. I am just wondering what will be the best way to achieve the above. All means the same thing but why we avoid something. If it has some demerits then it must be made obselete.Anyways I still dont have one [how to handle errors efficiently?]. I generally follow the try-catch(execoption ex){throw ex}, and usually got stucked in debates with leads why you follow this why not that... 2.Converting your entire code blocks in modules using Design patterns of some OOPs concepts. How do you guys decide what architeture or pattern will be the best for my upcoming application based on its working, flow etc. I need to know what you guys can see that I can't. Since I know , I dont have that much experience but I can say, with my experience that experience doesnot comes either from degree/certificates or success you made instead it cames from failures you faced or got stucking situations. Pleas help me out.

    Read the article

  • How to perform add/update of a model object that contains EntitySet

    - by David Liddle
    I have a similar concept to the SO questions/tags scenario however am trying to decide the best way of implementation. Tables Questions, QuestionTags and Tags Questions QuestionTags Tags --------- ------------ ---- QID QID TID QName TID TName When adding/updating a question I have 2 textboxes. The important part is a single textbox that allows users to enter in multiple Tags separated by spaces. I am using Linq2Sql so the Questions model has an EntitySet of QuestionTags with then link to Tags. My question is regarding the adding/updating of Questions (part 1), and also how to best show QuestionTags for a Question (part 2). Part 1 Before performing an add/update, my service layer needs to deal with 3 scenarios before passing to their respective repositories. Insert Tags that do not already exist Insert/Update Question Insert QuestionTags - when updating need to remove existing QuestionTags Here is my code below however started to get into a bit of a muddle. I've created extension methods on my repositories to get Tags WithNames etc. public void Add(Question q, string tags) { var tagList = tags.Split(new string[] { " " }, StringSplitOptions.RemoveEmptyEntries).ToList(); using (DB.TransactionScope ts = new DB.TransactionScope()) { var existingTags = TagsRepository.Get() .WithName(tagList) .ToList(); var newTags = (from t in tagList select new Tag { TName = t }).Except(existingTags, new TagsComparer()).ToList(); TagsRepository.Add(newTags); //need to insert QuestionTags QuestionsRepository.Add(q); ts.Complete(); } } Part 2 My second question is, when displaying a list of Questions how is it best to show their QuestionTags? For example, I have an Index view that shows a list of Questions in a table. One of the columns shows an image and when the user hovers over it shows the list of Tags. My current implementation is to create a custom ViewModel and show a List of QuestionIndexViewModel in the View. QuestionIndexViewModel { Question Question { get; set; } string Tags { get; set; } } However, this seems a bit clumsy and quite a few DB calls. public ViewResult Index() { var model= new List<QuestionIndexViewModel>(); //make a call to get a list of questions //foreach question make a call to get their QuestionTags, //to be able to get their Tag names and then join them //to form a single string. return View(model); } Also, just for test purposes using SQL Profiler, I decided to iterate through the QuestionTags entity set of a Question in my ViewModel however nothing was picked up in Profiler? What would be the reason for this?

    Read the article

  • CMake: Mac OS X: ld: unknown option: -soname

    - by Alex Ivasyuv
    I try to build my app with CMake on Mac OS X, I get the following error: Linking CXX shared library libsml.so ld: unknown option: -soname collect2: ld returned 1 exit status make[2]: *** [libsml.so] Error 1 make[1]: *** [CMakeFiles/sml.dir/all] Error 2 make: *** [all] Error 2 This is strange, as Mac has .dylib extension instead of .so. There's my CMakeLists.txt: cmake_minimum_required(VERSION 2.6) PROJECT (SilentMedia) SET(SourcePath src/libsml) IF (DEFINED OSS) SET(OSS_src ${SourcePath}/Media/Audio/SoundSystem/OSS/DSP/DSP.cpp ${SourcePath}/Media/Audio/SoundSystem/OSS/Mixer/Mixer.cpp ) ENDIF(DEFINED OSS) IF (DEFINED ALSA) SET(ALSA_src ${SourcePath}/Media/Audio/SoundSystem/ALSA/DSP/DSP.cpp ${SourcePath}/Media/Audio/SoundSystem/ALSA/Mixer/Mixer.cpp ) ENDIF(DEFINED ALSA) SET(SilentMedia_src ${SourcePath}/Utils/Base64/Base64.cpp ${SourcePath}/Utils/String/String.cpp ${SourcePath}/Utils/Random/Random.cpp ${SourcePath}/Media/Container/FileLoader.cpp ${SourcePath}/Media/Container/OGG/OGG.cpp ${SourcePath}/Media/PlayList/XSPF/XSPF.cpp ${SourcePath}/Media/PlayList/XSPF/libXSPF.cpp ${SourcePath}/Media/PlayList/PlayList.cpp ${OSS_src} ${ALSA_src} ${SourcePath}/Media/Audio/Audio.cpp ${SourcePath}/Media/Audio/AudioInfo.cpp ${SourcePath}/Media/Audio/AudioProxy.cpp ${SourcePath}/Media/Audio/SoundSystem/SoundSystem.cpp ${SourcePath}/Media/Audio/SoundSystem/libao/AO.cpp ${SourcePath}/Media/Audio/Codec/WAV/WAV.cpp ${SourcePath}/Media/Audio/Codec/Vorbis/Vorbis.cpp ${SourcePath}/Media/Audio/Codec/WavPack/WavPack.cpp ${SourcePath}/Media/Audio/Codec/FLAC/FLAC.cpp ) SET(SilentMedia_LINKED_LIBRARY sml vorbisfile FLAC++ wavpack ao #asound boost_thread-mt boost_filesystem-mt xspf gtest ) INCLUDE_DIRECTORIES( /usr/include /usr/local/include /usr/include/c++/4.4 /Users/alex/Downloads/boost_1_45_0 ${SilentMedia_SOURCE_DIR}/src ${SilentMedia_SOURCE_DIR}/${SourcePath} ) #link_directories( # /usr/lib # /usr/local/lib # /Users/alex/Downloads/boost_1_45_0/stage/lib #) IF(LibraryType STREQUAL "static") ADD_LIBRARY(sml-static STATIC ${SilentMedia_src}) # rename library from libsml-static.a => libsml.a SET_TARGET_PROPERTIES(sml-static PROPERTIES OUTPUT_NAME "sml") SET_TARGET_PROPERTIES(sml-static PROPERTIES CLEAN_DIRECT_OUTPUT 1) ELSEIF(LibraryType STREQUAL "shared") ADD_LIBRARY(sml SHARED ${SilentMedia_src}) # change compile optimization/debug flags # -Werror -pedantic IF(BuildType STREQUAL "Debug") SET_TARGET_PROPERTIES(sml PROPERTIES COMPILE_FLAGS "-pipe -Wall -W -ggdb") ELSEIF(BuildType STREQUAL "Release") SET_TARGET_PROPERTIES(sml PROPERTIES COMPILE_FLAGS "-pipe -Wall -W -O3 -fomit-frame-pointer") ENDIF() SET_TARGET_PROPERTIES(sml PROPERTIES CLEAN_DIRECT_OUTPUT 1) ENDIF() ### TEST ### IF(Test STREQUAL "true") ADD_EXECUTABLE (bin/TestXSPF ${SourcePath}/Test/Media/PlayLists/XSPF/TestXSPF.cpp) TARGET_LINK_LIBRARIES (bin/TestXSPF ${SilentMedia_LINKED_LIBRARY}) ADD_EXECUTABLE (bin/test1 ${SourcePath}/Test/test.cpp) TARGET_LINK_LIBRARIES (bin/test1 ${SilentMedia_LINKED_LIBRARY}) ADD_EXECUTABLE (bin/TestFileLoader ${SourcePath}/Test/Media/Container/FileLoader/TestFileLoader.cpp) TARGET_LINK_LIBRARIES (bin/TestFileLoader ${SilentMedia_LINKED_LIBRARY}) ADD_EXECUTABLE (bin/testMixer ${SourcePath}/Test/testMixer.cpp) TARGET_LINK_LIBRARIES (bin/testMixer ${SilentMedia_LINKED_LIBRARY}) ENDIF (Test STREQUAL "true") ### TEST ### ADD_CUSTOM_TARGET(doc COMMAND doxygen ${SilentMedia_SOURCE_DIR}/doc/Doxyfile) There was no error on Linux. Build process: cmake -D BuildType=Debug -D LibraryType=shared . make I found, that incorrect command generate in CMakeFiles/sml.dir/link.txt. But why, as the goal of CMake is cross-platforming.. How to fix it?

    Read the article

  • [c++] upload image to imageshack

    - by cinek1lol
    Hi! I would like to send pictures via a program written in C + +. - OK WinExec("C:\\curl\\curl.exe -H Expect: -F \"fileupload=@C:\\curl\\ok.jpg\" -F \"xml=yes\" -# \"http://www.imageshack.us/index.php\" -o data.txt -A \"Mozilla/5.0 (Windows; U; Windows NT 5.1; en-US; rv:1.8.1.1) Gecko/20061204 Firefox/2.0.0.1\" -e \"http://www.imageshack.us\"", NULL); It works, but I would like to send the pictures from pre-loaded carrier to a variable char (you know what I mean? First off, I load the pictures into a variable and then send the variable), cause now I have to specify the path of the picture on a disk. I wanted to write this program in c++ by using the curl library, not through exe. extension. I have also found such a program (which has been modified by me a bit) #include <stdio.h> #include <string.h> #include <iostream> #include <curl/curl.h> #include <curl/types.h> #include <curl/easy.h> int main(int argc, char *argv[]) { CURL *curl; CURLcode res; struct curl_httppost *formpost=NULL; struct curl_httppost *lastptr=NULL; struct curl_slist *headerlist=NULL; static const char buf[] = "Expect:"; curl_global_init(CURL_GLOBAL_ALL); /* Fill in the file upload field */ curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "send", CURLFORM_FILE, "nowy.jpg", CURLFORM_END); curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "nowy.jpg", CURLFORM_COPYCONTENTS, "nowy.jpg", CURLFORM_END); curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "submit", CURLFORM_COPYCONTENTS, "send", CURLFORM_END); curl = curl_easy_init(); headerlist = curl_slist_append(headerlist, buf); if(curl) { curl_easy_setopt(curl, CURLOPT_URL, "http://www.imageshack.us/index.php"); if ( (argc == 2) && (!strcmp(argv[1], "xml=yes")) ) curl_easy_setopt(curl, CURLOPT_HTTPHEADER, headerlist); curl_easy_setopt(curl, CURLOPT_HTTPPOST, formpost); res = curl_easy_perform(curl); curl_easy_cleanup(curl); curl_formfree(formpost); curl_slist_free_all (headerlist); } system("pause"); return 0; }

    Read the article

  • How to move a kinect skeleton to another position

    - by Ewerton
    I am working on a extension method to move one skeleton to a desired position in the kinect field os view. My code receives a skeleton to be moved and the destiny position, i calculate the distance between the received skeleton hip center and the destiny position to find how much to move, then a iterate in the joint applying this factor. My code, actualy looks like this. public static Skeleton MoveTo(this Skeleton skToBeMoved, Vector4 destiny) { Joint newJoint = new Joint(); ///Based on the HipCenter (i dont know if it is reliable, seems it is.) float howMuchMoveToX = Math.Abs(skToBeMoved.Joints[JointType.HipCenter].Position.X - destiny.X); float howMuchMoveToY = Math.Abs(skToBeMoved.Joints[JointType.HipCenter].Position.Y - destiny.Y); float howMuchMoveToZ = Math.Abs(skToBeMoved.Joints[JointType.HipCenter].Position.Z - destiny.Z); float howMuchToMultiply = 1; // Iterate in the 20 Joints foreach (JointType item in Enum.GetValues(typeof(JointType))) { newJoint = skToBeMoved.Joints[item]; // This adjust, try to keeps the skToBeMoved in the desired position if (newJoint.Position.X < 0) howMuchToMultiply = 1; // if the point is in a negative position, carry it to a "more positive" position else howMuchToMultiply = -1; // if the point is in a positive position, carry it to a "more negative" position // applying the new values to the joint SkeletonPoint pos = new SkeletonPoint() { X = newJoint.Position.X + (howMuchMoveToX * howMuchToMultiply), Y = newJoint.Position.Y, // * (float)whatToMultiplyY, Z = newJoint.Position.Z, // * (float)whatToMultiplyZ }; newJoint.Position = pos; skToBeMoved.Joints[item] = newJoint; //if (skToBeMoved.Joints[JointType.HipCenter].Position.X < 0) //{ // if (item == JointType.HandLeft) // { // if (skToBeMoved.Joints[item].Position.X > 0) // { // } // } //} } return skToBeMoved; } Actualy, only X position is considered. Now, THE PROBLEM: If i stand in a negative position, and move my hand to a positive position, a have a strange behavior, look this image To reproduce this behaviour you could use this code using (SkeletonFrame frame = e.OpenSkeletonFrame()) { if (frame == null) return new Skeleton(); if (skeletons == null || skeletons.Length != frame.SkeletonArrayLength) { skeletons = new Skeleton[frame.SkeletonArrayLength]; } frame.CopySkeletonDataTo(skeletons); Skeleton skeletonToTest = skeletons.Where(s => s.TrackingState == SkeletonTrackingState.Tracked).FirstOrDefault(); Vector4 newPosition = new Vector4(); newPosition.X = -0.03412333f; newPosition.Y = 0.0407479f; newPosition.Z = 1.927342f; newPosition.W = 0; // ignored skeletonToTest.MoveTo(newPosition); } I know, this is simple math, but i cant figure it out why this is happen. Any help will be apreciated.

    Read the article

  • Sitecore E-Commerce Module - Discount/Promotional Codes

    - by Zachary Kniebel
    I am working on a project for which I must use Sitecore's E-Commerce Module (and Sitecore 6.5 rev. 120706 - aka 'Update 5') to create a web-store. One of the features that I am trying to implement is a generic promotional/discount code system - customer enters a code at checkout which grants a discount like 'free shipping', '20% off', etc. At the moment, I am looking for some guidance (a high-level solution, a few pseudo-ideas, some references to review, etc) as to how this can be accomplished. Summary: What I am looking for is a way to detect whether or not the user entered a promo code at a previous stage in the checkout line, and to determine what that promo code is, if they did. Progress Thus Far: I have thoroughly reviewed all of the Sitecore E-Commerce Services (SES) documentation, especially "SES Order Line Extension" documentation (which I believe will have to be modified/extended in order to accomplish this task). Additionally, I have thoroughly reviewed the Sitecore Community article Extending Sitecore E-Commerce - Pricing and believe that it may be a useful guide for applying a discount statically, but does not say much in the way of applying a discount dynamically. After reviewing these documents, I have come up with the following possible high-level solution to start from: I create a template to represent a promotional code, which holds all data relevant to the promotion (percent off, free shipping, code, etc). I then create another template (based on the Product Search Group template) that holds a link to an item within a global "Promotional Code" items folder. Next, I use the Product Search Group features of my new template to choose which products to apply the discount to. In the source code for the checkout I create a class that checks if a code has been entered and, if so, somehow carry it through the rest of the checkout process. This is where I get stuck. More Details: No using cookies No GET requests No changing/creating/deleting items in the Sitecore Database during the checkout process (e.g., no manipulation of fields of a discount item during checkout to signal that the discount has been applied) must stay within the scope of C# Last Notes: I will update this post with any more information that I find/progress that I make. I upgrade all answers that are relevant and detailed, thought-provoking, or otherwise useful to me and potentially useful to others, in addition to any high-level answers that serve as a feasible solution to this problem; even if your idea doesn't help me, if I think it will help someone else I will still upgrade it. Thanks, in advance, for all your help! :)

    Read the article

  • Custom onsynctopreference for XUL textbox

    - by Alexey Romanov
    I wanted to enable custom shortcuts in my Firefox extension. The idea is that the user just focuses on a textbox, presses key combination, and it's shown in the textbox and saved to a preference. However, I couldn't get it to work. With this XUL <?xml version="1.0"?> <?xml-stylesheet href="chrome://global/skin/" type="text/css"?> <?xml-stylesheet href="chrome://mozapps/skin/pref/pref.css" type="text/css"?> <!DOCTYPE window SYSTEM "chrome://nextplease/locale/nextplease.dtd"> <prefwindow id="nextpleaseprefs" title="&options.title;" buttons="accept, cancel" xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul"> <prefpane id="nextplease.general" label="&options.general.title;" image="chrome://nextplease/skin/Sound Mixer.png"> <preferences> <preference id="nextkey" name="nextplease.nextkey" type="int"/> </preferences> <vbox flex="1"> <hbox align="center"> <label value="&options.general.nextKey;" /> <textbox id="nextkey" flex="1" editable="false" onkeyup="return nextplease.handleKeySelection(this, event);" preference-editable="true" preference="nextkey" onsynctopreference="alert('syncing'); return nextplease.syncKeySelector(this);"/> </hbox> </vbox> </prefpane> <script type="application/x-javascript" src="chrome://nextplease/content/nextpleaseCommon.js" /> <script type="application/x-javascript" src="chrome://nextplease/content/nextpleaseOptions.js" /> </prefwindow> the event in onkeyup works. But when I click the OK button, I don't see a "syncing" alert. Why isn't onsynctopreference working? Is it impossible to have custom onsynctopreference attribute for a textbox?

    Read the article

  • How to compare filename of uploaded file and string

    - by user225269
    I use this code to upload image files in xammp server: <?php if ((($_FILES["file"]["type"] == "image/gif") || ($_FILES["file"]["type"] == "image/jpeg") || ($_FILES["file"]["type"] == "image/pjpeg")) && ($_FILES["file"]["size"] < 100000)) { if ($_FILES["file"]["error"] > 0) { echo "Return Code: " . $_FILES["file"]["error"] . "<br />"; } else { echo "Upload: " . $_FILES["file"]["name"] . "<br />"; echo "Type: " . $_FILES["file"]["type"] . "<br />"; echo "Size: " . ($_FILES["file"]["size"] / 1024) . " Kb<br />"; echo "Temp file: " . $_FILES["file"]["tmp_name"] . "<br />"; if (file_exists("upload/" . $_FILES["file"]["name"])) { echo $_FILES["file"]["name"] . " already exists. "; } else { move_uploaded_file($_FILES["file"]["tmp_name"], "upload/" . $_FILES["file"]["name"]); echo "Stored in: " . "upload/" . $_FILES["file"]["name"]; } } } else { echo "Invalid file, File must be less than 100Kb in size with .jpg, .jpeg, or .gif file extension"; } ?> What do I do to compare the file name of the uploaded files with the text inputted by the user? My goal is to be able to compare the user input(ID number) and the file name of the image file which should also be an ID number. So that I will be able to display the image that corresponds with the ID Number provided. What do I need to do?Please give me an idea on how can I achieve this. Thanks

    Read the article

  • Newbie - what do I need to do with httpd.conf to make CakePHP work correctly?

    - by EmmyS
    (Not sure if this belongs here or on webmasters; please move if necessary.) I'm a total newbie to Cake and not much better with apache; I've done a lot of PHP but always with a server that's already been set up by someone else. So I'm going through the basic blog tutorial, and it says: A Note On mod_rewrite Occasionally a new user will run in to mod_rewrite issues, so I'll mention them marginally here. If the Cake welcome page looks a little funny (no images or css styles), it probably means mod_rewrite isn't functioning on your system. Here are some tips to help get you up and running: Make sure that an .htaccess override is allowed: in your httpd.conf, you should have a section that defines a section for each Directory on your server. Make sure the AllowOverride is set to All for the correct Directory. Make sure you are editing the system httpd.conf rather than a user- or site-specific httpd.conf. For some reason or another, you might have obtained a copy of CakePHP without the needed .htaccess files. This sometimes happens because some operating systems treat files that start with '.' as hidden, and don't copy them. Make sure your copy of CakePHP is from the downloads section of the site or our SVN repository. Make sure you are loading up mod_rewrite correctly! You should see something like LoadModule rewrite_module libexec/httpd/mod_rewrite.so and AddModule mod_rewrite.c in your httpd.conf." I'm using XAMPP on linux. I've found my httpd.conf file in opt/lampp/ etc, but am not sure what I need to do with it. I've searched for "rewrite", and there's only one line: LoadModule rewrite_module modules/mod_rewrite.so There's nothing about AddModule mod_rewrite.c. Do I just create a Directory section for the directory I've installed Cake in and set AlllowOverride to All? (I created a separate subdirectory of my wwwroot and installed in there, since I also have installs of Joomla and CodeIgniter.) Is there anything else I need to do? My download of Cake did come with two htaccess-type files (._.htaccess and .htaccess) - do I need to do anything with them? Thanks for any help you can provide to this non-server-admin. EDIT TO ADD virtual host sample: <VirtualHost *:80> ServerAdmin [email protected] DocumentRoot /www/docs/dummy-host.example.com ServerName dummy-host.example.com ServerAlias www.dummy-host.example.com ErrorLog logs/dummy-host.example.com-error_log CustomLog logs/dummy-host.example.com-access_log common </VirtualHost>

    Read the article

  • C#/.NET Project - Am I setting things up correctly?

    - by JustLooking
    1st solution located: \Common\Controls\Controls.sln and its project: \Common\Controls\Common.Controls\Common.Controls.csproj Description: This is a library that contains this class: public abstract class OurUserControl : UserControl { // Variables and other getters/setters common to our UserControls } 2nd solution located: \AControl\AControl.sln and its project: \AControl\AControl\AControl.csproj Description: Of the many forms/classes, it will contain this class: using Common.Controls; namespace AControl { public partial class AControl : OurUserControl { // The implementation } } A note about adding references (not sure if this is relevant): When I add references (for projects I create), using the names above: 1. I add Common.Controls.csproj to AControl.sln 2. In AControl.sln I turn off the build of Common.Controls.csproj 3. I add the reference to Common.Controls (by project) to AControl.csproj. This is the (easiest) way I know how to get Debug versions to match Debug References, and Release versions to match Release References. Now, here is where the issue lies (the 3rd solution/project that actually utilizes the UserControl): 3rd solution located: \MainProj\MainProj.sln and its project: \MainProj\MainProj\MainProj.csproj Description: Here's a sample function in one of the classes: private void TestMethod<T>() where T : Common.Controls.OurUserControl, new() { T TheObject = new T(); TheObject.OneOfTheSetters = something; TheObject.AnotherOfTheSetters = something_else; // Do stuff with the object } We might call this function like so: private void AnotherMethod() { TestMethod<AControl.AControl>(); } This builds, runs, and works. No problem. The odd thing is after I close the project/solution and re-open it, I have red squigglies everywhere. I bring up my error list and I see tons of errors (anything that deals with AControl will be noted as an error). I'll see errors such as: The type 'AControl.AControl' cannot be used as type parameter 'T' in the generic type or method 'MainProj.MainClass.TestMethod()'. There is no implicit reference conversion from 'AControl.AControl' to 'Common.Controls.OurUserControl'. or inside the actual method (the properties located in the abstract class): 'AControl.AControl' does not contain a definition for 'OneOfTheSetters' and no extension method 'OneOfTheSetters' accepting a first argument of type 'AControl.AControl' could be found (are you missing a using directive or an assembly reference?) Meanwhile, I can still build and run the project (then the red squigglies go away until I re-open the project, or close/re-open the file). It seems to me that I might be setting up the projects incorrectly. Thoughts?

    Read the article

  • how to register the app to open the pdf file in my app in ipad

    - by uttam
    i want to open the pdf file in my app from pdf page, but i am not getting any option of opening the pdf in my app. this my info.plist file <key>CFBundleDevelopmentRegion</key> <string>English</string> <key>CFBundleDocumentTypes</key> <array> <dict> <key>CFBundleTypeName</key> <string>PDF</string> <key>CFBundleTypeRole</key> <string>Viewer</string> <key>CFBundleTypeIconFiles</key> <string>Icon.png</string> <key>LSItemContentTypes</key> <string>com.neosofttech.pdf</string> <key>LSHandlerRank</key> <string>Owner</string> </dict> </array> <key>UTExportedTypeDeclarations</key> <array> <dict> <key>UTTypeConformsTo</key> <array> <string>public.pdf</string> </array> <key>UTTypeDescription</key> <string>PDFReader File</string> <key>UTTypeIdentifier</key> <string>com.neosofttech.pdf</string> <key>UTTypeTagSpecification</key> <dict> <key>public.filename-extension</key> <string>pdf</string> </dict> </dict> pls tell me where i am wrong in this, how can i open the pdf file in my app.

    Read the article

  • App losing db connection

    - by DaveKub
    I'm having a weird issue with an old Delphi app losing it's database connection. Actually, I think it's losing something else that then makes the connection either drop or be unusable. The app is written in Delphi 6 and uses the Direct Oracle Access component (v4.0.7.1) to connect to an Oracle 9i database. The app runs as a service and periodically queries the db using a TOracleQuery object (qryAlarmList). The method that is called to do this looks like this: procedure TdmMain.RefreshAlarmList; begin try qryAlarmList.Execute; except on E: Exception do begin FStatus := ssError; EventLog.LogError(-1, 'TdmMain.RefreshAlarmList', 'Message: ' + E.Message); end; end; end; It had been running fine for years, until a couple of Perl scripts were added to this machine. These scripts run every 15 minutes and look for datafiles to import into the db, and then they do a some calculations and a bunch of reads/writes to/from the db. For some reason, when they are processing large amounts of data, and then the Delphi app tries to query the db, the Delphi app throws an exception at the "qryAlarmList.Execute" line in the above code listing. The exception is always: Access violation at address 00000000. read of address 00000000 HOW can something that the Perl scripts are doing cause this?? There are other Perl scripts on this machine that load data using the same modules and method calls and we didn't have problems. To make it even weirder, there are two other apps that will also suddenly lose their ability to talk to the database at the same time as the Perl stuff is running. Neither of those apps run on this machine, but both are Delphi 6 apps that use the same DOA component to connect to the same database. We have other apps that connect to the same db, written in Java or C# and they don't seem to have any problems. I've tried adding code before the '.Execute' method is called to: check the session's connection (session.CheckConnection(true); always comes back as 'ccOK'). see whether I can access a field of the qryAlarmList object to see if maybe it's become null; can access it fine. check the state of the qryAlarmList; always says it's qsIdle. Does anyone have any suggestions of something to try? This is driving me nuts! Dave

    Read the article

  • UCA + Natural Sorting

    - by Alix Axel
    I recently learnt that PHP already supports the Unicode Collation Algorithm via the intl extension: $array = array ( 'al', 'be', 'Alpha', 'Beta', 'Álpha', 'Àlpha', 'Älpha', '????', 'img10.png', 'img12.png', 'img1.png', 'img2.png', ); if (extension_loaded('intl') === true) { collator_asort(collator_create('root'), $array); } Array ( [0] => al [2] => Alpha [4] => Álpha [5] => Àlpha [6] => Älpha [1] => be [3] => Beta [11] => img1.png [9] => img10.png [8] => img12.png [10] => img2.png [7] => ???? ) As you can see this seems to work perfectly, even with mixed case strings! The only drawback I've encountered so far is that there is no support for natural sorting and I'm wondering what would be the best way to work around that, so that I can merge the best of the two worlds. I've tried to specify the Collator::SORT_NUMERIC sort flag but the result is way messier: collator_asort(collator_create('root'), $array, Collator::SORT_NUMERIC); Array ( [8] => img12.png [7] => ???? [9] => img10.png [10] => img2.png [11] => img1.png [6] => Älpha [5] => Àlpha [1] => be [2] => Alpha [3] => Beta [4] => Álpha [0] => al ) However, if I run the same test with only the img*.png values I get the ideal output: Array ( [3] => img1.png [2] => img2.png [1] => img10.png [0] => img12.png ) Can anyone think of a way to preserve the Unicode sorting while adding natural sorting capabilities?

    Read the article

  • Problem updating through LINQtoSQL in MVC application using StructureMap, Repository Pattern and UoW

    - by matt
    I have an ASP MVC application using LINQ to SQL for data access. I am trying to use the Repository and Unit of Work patterns, with a service layer consuming the repositories and unit of work. I am experiencing a problem when attempting to perform updates on a particular repository. My application architecture is as follows: My service class: public class MyService { private IRepositoryA _RepositoryA; private IRepositoryB _RepositoryB; private IUnitOfWork _unitOfWork; public MyService(IRepositoryA ARepositoryA, IRepositoryB ARepositoryB, IUnitOfWork AUnitOfWork) { _unitOfWork = AUnitOfWork; _RepositoryA = ARepositoryA; _RepositoryB = ARepositoryB; } public PerformActionOnObject(Guid AID) { MyObject obj = _RepositoryA.GetRecords() .WithID(AID); obj.SomeProperty = "Changed to new value"; _RepositoryA.UpdateRecord(obj); _unitOfWork.Save(); } } Repository interface: public interface IRepositoryA { IQueryable<MyObject> GetRecords(); UpdateRecord(MyObject obj); } Repository LINQtoSQL implementation: public class LINQtoSQLRepositoryA : IRepositoryA { private MyDataContext _DBContext; public LINQtoSQLRepositoryA(IUnitOfWork AUnitOfWork) { _DBConext = AUnitOfWork as MyDataContext; } public IQueryable<MyObject> GetRecords() { return from records in _DBContext.MyTable select new MyObject { ID = records.ID, SomeProperty = records.SomeProperty } } public bool UpdateRecord(MyObject AObj) { MyTableRecord record = (from u in _DB.MyTable where u.ID == AObj.ID select u).SingleOrDefault(); if (record == null) { return false; } record.SomeProperty = AObj.SomePropery; return true; } } Unit of work interface: public interface IUnitOfWork { void Save(); } Unit of work implemented in data context extension. public partial class MyDataContext : DataContext, IUnitOfWork { public void Save() { SubmitChanges(); } } StructureMap registry: public class DataServiceRegistry : Registry { public DataServiceRegistry() { // Unit of work For<IUnitOfWork>() .HttpContextScoped() .TheDefault.Is.ConstructedBy(() => new MyDataContext()); // RepositoryA For<IRepositoryA>() .Singleton() .Use<LINQtoSQLRepositoryA>(); // RepositoryB For<IRepositoryB>() .Singleton() .Use<LINQtoSQLRepositoryB>(); } } My problem is that when I call PerformActionOnObject on my service object, the update never fires any SQL. I think this is because the datacontext in the UnitofWork object is different to the one in RepositoryA where the data is changed. So when the service calls Save() on it's IUnitOfWork, the underlying datacontext does not have any updated data so no update SQL is fired. Is there something I've done wrong in the StrutureMap registry setup? Or is there a more fundamental problem with the design? Many thanks.

    Read the article

  • ASP.NET Application Level vs. Session Level and Global.asax...confused

    - by contactmatt
    The following text is from the book I'm reading, 'MCTS Self-Paced Training Kit (Exam 70-515) Web Applications Development with ASP.NET 4". It gives the rundown of the Application Life Cycle. A user first makes a request for a page in your site. The request is routed to the processing pipeline, which forwards it to the ASP.NET runtime. The ASP.NET runtime creates an instance of the ApplicationManager class; this class instance represents the .NET framework domain that will be used to execute requests for your application. An application domain isolates global variables from other applications and allows each application to load and unload separately, as required. After the application domain has been created, an instance of the HostingEnvironment class is created. This class provides access to items inside the hosting environment, such as directory folders. ASP.NET creates instances of the core objects that will be used to process the request. This includes HttpContext, HttpRequest, and HttpResponse objects. ASP.NET creates an instance of the HttpApplication class (or an instance is reused). This class is also the base class for a site’s Global.asax file. You can use this class to trap events that happen when your application starts or stops. When ASP.NET creates an instance of HttpApplication, it also creates the modules configured for the application, such as the SessionStateModule. Finally, ASP.NET processes request through the HttpApplication pipleline. This pipeline also includes a set of events for validating requests, mapping URLs, accessing the cache, and more. The book then demonstrated an example of using the Global.asax file: <script runat="server"> void Application_Start(object sender, EventArgs e) { Application["UsersOnline"] = 0; } void Session_Start(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] + 1; Application.UnLock(); } void Session_End(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] - 1; Application.UnLock(); } </script> When does an application start? Whats the difference between session and application level? I'm rather confused on how this is managed. I thought that Application level classes "sat on top of" an AppDomain object, and the AppDomain contained information specific to that Session for that user. Could someone please explain how IIS manages Applicaiton level classes, and how an HttpApplication class sits under an AppDomain? Anything is appreciated.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • CSS selectors : should I minimise my use of the class attribute in the HTML or optimise the speed

    - by Laurent Bourgault-Roy
    As I was working on a small website, I decided to use the PageSpeed extension to check if their was some improvement I could do to make the site load faster. However I was quite surprise when it told me that my use of CSS selector was "inefficient". I was always told that you should keep the usage of the class attribute in the HTML to a minimum, but if I understand correctly what PageSpeed tell me, it's much more efficient for the browser to match directly against a class name. It make sense to me, but it also mean that I need to put more CSS classes in my HTML. It also make my .css file a little harder to read. I usually tend to mark my CSS like this : #mainContent p.productDescription em.priceTag { ... } Which make it easy to read : I know this will affect the main content and that it affect something in a paragraph tag (so I wont start to put all sort of layout code in it) that describe a product and its something that need emphasis. However it seem I should rewrite it as .priceTag { ... } Which remove all context information about the style. And if I want to use differently formatted price tag (for example, one in a list on the sidebar and one in a paragraph), I need to use something like that .paragraphPriceTag { ... } .listPriceTag { ... } Which really annoy me since I seem to duplicate the semantic of the HTML in my classes. And that mean I can't put common style in an unqualified .priceTag { ... } and thus I need to replicate the style in both CSS rule, making it harder to make change. (Altough for that I could use multiple class selector, but IE6 dont support them) I believe making code harder to read for the sake of speed has never been really considered a very good practice . Except where it is critical, of course. This is why people use PHP/Ruby/C# etc. instead of C/assembly to code their site. It's easier to write and debug. So I was wondering if I should stick with few CSS classes and complex selector or if I should go the optimisation route and remove my fancy CSS selectors for the sake of speed? Does PageSpeed make over the top recommandation? On most modern computer, will it even make a difference?

    Read the article

  • how to use window.onload?

    - by Patrick
    I'm refactoring a website using MVC. What was a set of huge pages with javascript, php, html etc etc is becoming a series of controllers and views. I'm trying to do it in a modular way so views are split in 'modules' that I can reuse in other pages when needed eg. "view/searchform displays only one div with the searchform "view/display_events displays a list of events and so on. One of the old pages was supposed to load a google map with a marker on it. Amongst the rest of the code, I can identify the relevant bits as follows <head> <script src="http://maps.google.com/maps?file=api&amp;v=2&amp;key=blablabla" type="text/javascript"></script> <script type="text/javascript"> //<![CDATA[ function load() { if (GBrowserIsCompatible()) { var map = new GMap2(document.getElementById("map")); var point = new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>); map.setCenter(new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>), 15); map.addControl(new GLargeMapControl()); map.addControl(new GScaleControl()); map.addOverlay(new GMarker(point)); var marker = createMarker(point,GIcon(),"CIAO"); map.addOverlay(marker); } } //]]> </script> </head> ...then <body onload="load()" onunload="GUnload()"> ...and finally this div where the map should be displayed <div id="map" style="width: 440px; height: 300px"> </div> Don't know much about js, but my understanding is that a) I have to include the scripts in the view module I'm writing (directly in the HTML? I would prefer to load a separate script) b) I have to trigger that function using the equivalent of body onload... (obviously there's no body tag in my view. In my ignorance I've tried div onload=.... but didn't seem to be working :) What do you suggest I do? I've read about window.onload but don't know what's the correct syntax for that. please keep in mind that other parts of the page include other js functions (eg, google adsense) that are called after the footer.

    Read the article

  • using a Singleton to pass credentials in a multi-tenant application a code smell?

    - by Hans Gruber
    Currently working on a multi-tenant application that employs Shared DB/Shared Schema approach. IOW, we enforce tenant data segregation by defining a TenantID column on all tables. By convention, all SQL reads/writes must include a Where TenantID = '?' clause. Not an ideal solution, but hindsight is 20/20. Anyway, since virtually every page/workflow in our app must display tenant specific data, I made the (poor) decision at the project's outset to employ a Singleton to encapsulate the current user credentials (i.e. TenantID and UserID). My thinking at the time was that I didn't want to add a TenantID parameter to each and every method signature in my Data layer. Here's what the basic pseudo-code looks like: public class UserIdentity { public UserIdentity(int tenantID, int userID) { TenantID = tenantID; UserID = userID; } public int TenantID { get; private set; } public int UserID { get; private set; } } public class AuthenticationModule : IHttpModule { public void Init(HttpApplication context) { context.AuthenticateRequest += new EventHandler(context_AuthenticateRequest); } private void context_AuthenticateRequest(object sender, EventArgs e) { var userIdentity = _authenticationService.AuthenticateUser(sender); if (userIdentity == null) { //authentication failed, so redirect to login page, etc } else { //put the userIdentity into the HttpContext object so that //its only valid for the lifetime of a single request HttpContext.Current.Items["UserIdentity"] = userIdentity; } } } public static class CurrentUser { public static UserIdentity Instance { get { return HttpContext.Current.Items["UserIdentity"]; } } } public class WidgetRepository: IWidgetRepository{ public IEnumerable<Widget> ListWidgets(){ var tenantId = CurrentUser.Instance.TenantID; //call sproc with tenantId parameter } } As you can see, there are several code smells here. This is a singleton, so it's already not unit test friendly. On top of that you have a very tight-coupling between CurrentUser and the HttpContext object. By extension, this also means that I have a reference to System.Web in my Data layer (shudder). I want to pay down some technical debt this sprint by getting rid of this singleton for the reasons mentioned above. I have a few thoughts on what an better implementation might be, but if anyone has any guidance or lessons learned they could share, I would be much obliged.

    Read the article

  • Do you use an exception class in your Perl programs? Why or why not?

    - by daotoad
    I've got a bunch of questions about how people use exceptions in Perl. I've included some background notes on exceptions, skip this if you want, but please take a moment to read the questions and respond to them. Thanks. Background on Perl Exceptions Perl has a very basic built-in exception system that provides a spring-board for more sophisticated usage. For example die "I ate a bug.\n"; throws an exception with a string assigned to $@. You can also throw an object, instead of a string: die BadBug->new('I ate a bug.'); You can even install a signal handler to catch the SIGDIE psuedo-signal. Here's a handler that rethrows exceptions as objects if they aren't already. $SIG{__DIE__} = sub { my $e = shift; $e = ExceptionObject->new( $e ) unless blessed $e; die $e; } This pattern is used in a number of CPAN modules. but perlvar says: Due to an implementation glitch, the $SIG{DIE} hook is called even inside an eval(). Do not use this to rewrite a pending exception in $@ , or as a bizarre substitute for overriding CORE::GLOBAL::die() . This strange action at a distance may be fixed in a future release so that $SIG{DIE} is only called if your program is about to exit, as was the original intent. Any other use is deprecated. So now I wonder if objectifying exceptions in sigdie is evil. The Questions Do you use exception objects? If so, which one and why? If not, why not? If you don't use exception objects, what would entice you to use them? If you do use exception objects, what do you hate about them, and what could be better? Is objectifying exceptions in the DIE handler a bad idea? Where should I objectify my exceptions? In my eval{} wrapper? In a sigdie handler? Are there any papers, articles or other resources on exceptions in general and in Perl that you find useful or enlightening.

    Read the article

< Previous Page | 342 343 344 345 346 347 348 349 350 351 352 353  | Next Page >