Search Results

Search found 20484 results on 820 pages for 'small projects'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 346/820 | < Previous Page | 342 343 344 345 346 347 348 349 350 351 352 353  | Next Page >

  • Eclipse project artefacts in Maven repository

    - by Georgios Gousios
    I want to use some of the libraries produced by the Eclipse project through Maven. I 've had a look at the main Maven repo and while it looks like that there are a few projects already imported, their versions are old and some important ones are missing (e.g. cdt). Is there any Eclipse project official Maven repository? If not, what would be the best option to use current versions of libraries such as the JDT compiler in a maven-enabled project?

    Read the article

  • Backup of folder + database - Python

    - by RadiantHex
    Hi there, I feel like this is quite delicate, I have various folders whith projects I would like to backup into a zip/tar file, but would like to avoid backing up files such as pyc files and temporary files. I also have a Postgres db I need to backup. Any tips for running this operation as a python script? Also, would there be anyway to stop the process from hogging resources in the process? Help would be very much appreciated.

    Read the article

  • Seo friendly Accordion menu

    - by strakastroukas
    Hello, currently i use the accordion menu provided by the asp.net toolkit. The problem is that it is not Seo friendly. So what i am looking for is an accordion menu with the following characteristics. 1) Seo friendliness 2) Preserving of the selected index, on post-backs. 3) Small in k bytes 4) Free of charge Do you have anything in mind?

    Read the article

  • Where to go from PHP?

    - by dabito
    I'm a seasoned PHP programmer and I really like the way it works and find it very fun to work with (performance could be improved and some functions renamed, but nothing too serious). However, I took a java seminar and now Im very interested in using GWT for upcomming projects, although I think the learning curve can be steep. Should I really go through with this change (PHP JAVA)? Where to begin?

    Read the article

  • Image_tag .blank? - paperclip - Ruby on rails

    - by bgadoci
    I have just installed paperclip into my ruby on rails blog application. Everything is working great...too great. I am trying to figure out how to tell paperclip not to output anything if there is no record in the table so that I don't have broken image links everywhere. How, and where, do I do this? Here is my code: class Post < ActiveRecord::Base has_attached_file :photo, :styles => { :small => "150x150"} validates_presence_of :body, :title has_many :comments, :dependent => :destroy has_many :tags, :dependent => :destroy has_many :ugtags, :dependent => :destroy has_many :votes, :dependent => :destroy belongs_to :user after_create :self_vote def self_vote # I am assuming you have a user_id field in `posts` and `votes` table. self.votes.create(:user => self.user) end cattr_reader :per_page @@per_page = 10 end View <% div_for post do %> <div id="post-wrapper"> <div id="post-photo"> <%= image_tag post.photo.url(:small) %> </div> <h2><%= link_to_unless_current h(post.title), post %></h2> <div class="light-color"> <i>Posted <%= time_ago_in_words(post.created_at) %></i> ago </div> <%= simple_format truncate(post.body, :length => 600) %> <div id="post-options"> <%= link_to "Read More >>", post %> | <%= link_to "Comments (#{post.comments.count})", post %> | <%= link_to "Strings (#{post.tags.count})", post %> | <%= link_to "Contributions (#{post.ugtags.count})", post %> | <%= link_to "Likes (#{post.votes.count})", post %> </div> </div> <% end %>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Why won't the following haskell code compile?

    - by voxcogitatio
    I'm in the process of writing a small lisp interpreter in haskell. In the process i defined this datatype, to get a less typed number; data Number = _Int Integer | _Rational Rational | _Float Double deriving(Eq,Show) Compiling this fails with the following error: ERROR "types.hs":16 - Syntax error in data type declaration (unexpected `|') Line 16 is the line w. the first '|' in the code above.

    Read the article

  • Shopping Cart Suggestions Needed

    - by Maen
    I am building a small web app for a pharmacy to keep track of sales and stocks, so in short, in one page, the pharmacist will enter a bar-code and the item is displayed, pharmacist enters quantity (price will be automatically calculated) then next item and next and so on, I haven't worked with such a problem before so I would appreciate any advices/tips on how to do it, what to use and wither its already done in some tidy neat way I can just import into my page. Am using ASP.net and VB.net, SQL 2008 and all express withing Visual Web Developer (also ExpresS)

    Read the article

  • Consequences of an infinite loop on Google App Engine?

    - by Axidos
    I am not a Google App Engine user. However, I understand you're billed for CPU time and other resources. What are the consequences if you happen to create an infinite loop? Will Google ever terminate it, or will you have to do it yourself manually somehow? I'm a hobbyist developer worried about a small error that might end up costing hundreds.

    Read the article

  • How do you set the default source for the Output window in Visual Studio?

    - by Grank
    We added a SharePoint BDC model project to a solution in Visual Studio 2010. Ever since, whenever the solution is built, instead of showing the Build output in the Output window, it insists on having "SharePoint Tools" selected in the "Show Output from:" drop-down, just to say "Model validation started ... Model validation completed with no errors." Short of shutting off any SharePoint projects in the build configuration, can this behavior be overridden?

    Read the article

  • cannot run java app on mac properly

    - by sneha
    Hello everybody.. I have small problem..I created a java App in windows and my .jar consist of whole app..i copied this jar file to mac and executed it from there it works fine.. Java App consists of bonjour code if i execute .jar on windows it works fine and bonjour starts advertising...But,for mac the app runs fine but doesnot advertise the bonjourservice.. I am not understanding the difference..can anyone explain me y it is so?

    Read the article

  • xml to excel file

    - by Cmptrb
    Hi, I have a xml document holding a small data for my project where I want to convert my xml to an excel file (microsoft office excel 2003 and over) How can I do this? Kind Regards.

    Read the article

  • Is Unit Testing important?

    - by PieterG
    I've recently been catching up on my podcasts and reading and found this article from Joel Spolsky. The Question that I for all of you is the following. Is Unit Testing Important? What do you test? Do you write unit tests on all your projects? I suppose this question is a bit more of a poll on unit test coverage.

    Read the article

  • Grails default root path

    - by srinath
    Hi, Is there a variable where we can find out the root directory of my Grails application? I tried request.getSession().getServletContext().getRealPath("/") But shows tmp/App-Test-0.1/ . My app is located in tomcat "/home/srinath/work/projects/tomcat-6.0.18/webapps/App-Test-0.1" could any one help me . thanks in advance, sri..

    Read the article

  • Images are not appeared in Firefox

    - by moon
    I create small web app and it works in IE but I tried in firefox many css layouts are unavailable and images are not appeared.To appear image and to work in both browsers,how can I handle.Please tell me the way .Thanks

    Read the article

  • 2nd Year College - Learning - Microsoft Server Products

    - by Ryan
    As the title says, I just finished my first year of college (majoring in Software Engineering). Fortunately my school likes Microsoft enough, and I can get pretty much anything I want that Microsoft sells. I also can get IBM Websphere and the like for free as well. Earlier this year, I set up an oldish computer (2.6 Pentium D, x64) to run ubuntu server headless. I'm predominately a Java developer, so Apache, Maven, Nexus, Sonar, SVN, etc made it onto the machine. It worked really well for personal and school projects, especially team projects (quick ramp up). Anyways, I started to pick up C# to complement my Java knowledge (don't judge me :P), and am interested in working with some of the associated Microsoft equivalents. The machine currently has the Ubuntu install, as well as Windows 7 Ultimate. I do all of my actual development work off my laptop, also running Windows 7 Ultimate. I was wondering what software you would recommend putting on the machine. I’m not actually serving anything off the machine itself, but in Ubuntu I had it doing integration tests with Hudson on every commit, and profiling my applications, etc, etc. The machine would be running headless, and I would remote into it. Here is what I am currently leaning towards / wondering about: Windows 7 Ultimate vs Windows Server 2008 (R2) (no one is really clear why I should go with one over the other) Windows Team Foundation Sharepoint (Never used it before, kind of meh about it) IBM Websphere or Glassfish (Some Java EE web server) SQL Server 2008 A DVCS In order to better control product conflicts / limit resource use, I’m wondering if I should install things into virtual machines (I can get VmWare or Microsoft Virtualization Products) I also plan on installing everything I had running under Linux (it’s almost entirely Java based development software, so it’ll run on both, only reason I went with ubuntu during the year was because the apache build seemed better). I’m primarily looking to become familiar with enterprise software development tools, as well as get something functional that will help my development process. (IE, I’ll still use project and assign tasks even though I might be the only one to assign tasks to, just to practice doing so). Is there any other software / configuration details I should explore? Opinions on my current list? I primarily use C#, Java, and PHP. I'm familiar with ruby, and python as well. Thanks!

    Read the article

  • .Net 3.5 Windows Service hide WCF Service Host

    - by Melursus
    I got a Windows service installed on my development machine (that I made) and I want to interact with it. For a reason I don't know, each time I start the client, a WCF Service Host pop and said that the address is already in use ... which is true ... but how can I do to NOT start that Windows ? Is it because my two projects (server and client) are in the same solution ?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 342 343 344 345 346 347 348 349 350 351 352 353  | Next Page >