Search Results

Search found 9182 results on 368 pages for 'import hooks'.

Page 349/368 | < Previous Page | 345 346 347 348 349 350 351 352 353 354 355 356  | Next Page >

  • App losing db connection

    - by DaveKub
    I'm having a weird issue with an old Delphi app losing it's database connection. Actually, I think it's losing something else that then makes the connection either drop or be unusable. The app is written in Delphi 6 and uses the Direct Oracle Access component (v4.0.7.1) to connect to an Oracle 9i database. The app runs as a service and periodically queries the db using a TOracleQuery object (qryAlarmList). The method that is called to do this looks like this: procedure TdmMain.RefreshAlarmList; begin try qryAlarmList.Execute; except on E: Exception do begin FStatus := ssError; EventLog.LogError(-1, 'TdmMain.RefreshAlarmList', 'Message: ' + E.Message); end; end; end; It had been running fine for years, until a couple of Perl scripts were added to this machine. These scripts run every 15 minutes and look for datafiles to import into the db, and then they do a some calculations and a bunch of reads/writes to/from the db. For some reason, when they are processing large amounts of data, and then the Delphi app tries to query the db, the Delphi app throws an exception at the "qryAlarmList.Execute" line in the above code listing. The exception is always: Access violation at address 00000000. read of address 00000000 HOW can something that the Perl scripts are doing cause this?? There are other Perl scripts on this machine that load data using the same modules and method calls and we didn't have problems. To make it even weirder, there are two other apps that will also suddenly lose their ability to talk to the database at the same time as the Perl stuff is running. Neither of those apps run on this machine, but both are Delphi 6 apps that use the same DOA component to connect to the same database. We have other apps that connect to the same db, written in Java or C# and they don't seem to have any problems. I've tried adding code before the '.Execute' method is called to: check the session's connection (session.CheckConnection(true); always comes back as 'ccOK'). see whether I can access a field of the qryAlarmList object to see if maybe it's become null; can access it fine. check the state of the qryAlarmList; always says it's qsIdle. Does anyone have any suggestions of something to try? This is driving me nuts! Dave

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Write PEM encoded certificate in file - java

    - by user1349407
    Good day. I recently create X.509 certificate by using bouncy castle API. I need to save the certificate result rather than display the result. I tried to use FileOutputStream, but it does not work. regards the result is like follows -----BEGIN CERTIFICATE----- MIICeTCCAeKgAwIBAgIGATs8OWsXMA0GCSqGSIb3DQEBCwUAMBsxGTAXBgNVBAMT... -----END CERTIFICATE----- The code is belows import java.io.FileOutputStream; //example of a basic CA public class PKCS10CertCreateExample { public static X509Certificate[] buildChain() throws Exception { //create the certification request KeyPair pair = chapter7.Utils.generateRSAKeyPair(); PKCS10CertificationRequest request = PKCS10ExtensionExample.generateRequest(pair); //create a root certificate KeyPair rootPair=chapter7.Utils.generateRSAKeyPair(); X509Certificate rootCert = X509V1CreateExample.generateV1Certificate (rootPair); //validate the certification request if(!request.verify("BC")) { System.out.println("request failed to verify!"); System.exit(1); } //create the certificate using the information in the request X509V3CertificateGenerator certGen = new X509V3CertificateGenerator(); certGen.setSerialNumber(BigInteger.valueOf(System.currentTimeMillis())); certGen.setIssuerDN(rootCert.getSubjectX500Principal()); certGen.setNotBefore(new Date(System.currentTimeMillis())); certGen.setNotAfter(new Date(System.currentTimeMillis()+50000)); certGen.setSubjectDN(request.getCertificationRequestInfo().getSubject()); certGen.setPublicKey(request.getPublicKey("BC")); certGen.setSignatureAlgorithm("SHA256WithRSAEncryption"); certGen.addExtension(X509Extensions.AuthorityKeyIdentifier, false, new AuthorityKeyIdentifierStructure(rootCert)); certGen.addExtension(X509Extensions.SubjectKeyIdentifier, false, new SubjectKeyIdentifierStructure(request.getPublicKey("BC"))); certGen.addExtension(X509Extensions.BasicConstraints, true, new BasicConstraints(false)); //certGen.addExtension(X509Extensions.KeyUsage, true, new BasicConstraints(false)); certGen.addExtension(X509Extensions.KeyUsage, true, new KeyUsage(KeyUsage.digitalSignature | KeyUsage.keyEncipherment)); certGen.addExtension(X509Extensions.ExtendedKeyUsage, true, new ExtendedKeyUsage(KeyPurposeId.id_kp_serverAuth)); //extract the extension request attribute ASN1Set attributes = request.getCertificationRequestInfo().getAttributes(); for(int i=0;i!=attributes.size();i++) { Attribute attr = Attribute.getInstance(attributes.getObjectAt(i)); //process extension request if(attr.getAttrType().equals(PKCSObjectIdentifiers.pkcs_9_at_extensionRequest)) { X509Extensions extensions = X509Extensions.getInstance(attr.getAttrValues().getObjectAt(0)); Enumeration<?> e = extensions.oids(); while(e.hasMoreElements()) { DERObjectIdentifier oid = (DERObjectIdentifier)e.nextElement(); X509Extension ext = extensions.getExtension(oid); certGen.addExtension(oid, ext.isCritical(), ext.getValue().getOctets()); } } } X509Certificate issuedCert = certGen.generateX509Certificate(rootPair.getPrivate()); return new X509Certificate[]{issuedCert, rootCert}; } public static void main(String[] args) throws Exception { X509Certificate[] chain = buildChain(); PEMWriter pemWrt = new PEMWriter(new OutputStreamWriter(System.out)); pemWrt.writeObject(chain[0]); //pemWrt.writeObject(chain[1]); pemWrt.close(); //write it out //FileOutputStream fOut = new FileOutputStream("pkcs10req.req"); //fOut.write(chain[0].toString()); //fOut.write() //System.out.println(chain[0].toString()); //fOut.close(); } }

    Read the article

  • Can sorting Japanese kanji words be done programatically?

    - by Mason
    I've recently discovered, to my astonishment (having never really thought about it before), machine-sorting Japanese proper nouns is apparently not possible. I work on an application that must allow the user to select a hospital from a 3-menu interface. The first menu is Prefecture, the second is City Name, and the third is Hospital. Each menu should be sorted, as you might expect, so the user can find what they want in the menu. Let me outline what I have found, as preamble to my question: The expected sort order for Japanese words is based on their pronunciation. Kanji do not have an inherent order (there are tens of thousands of Kanji in use), but the Japanese phonetic syllabaries do have an order: ???????????????????... and on for the fifty traditional distinct sounds (a few of which are obsolete in modern Japanese). This sort order is called ???? (gojuu on jun , or '50-sound order'). Therefore, Kanji words should be sorted in the same order as they would be if they were written in hiragana. (You can represent any kanji word in phonetic hiragana in Japanese.) The kicker: there is no canonical way to determine the pronunciation of a given word written in kanji. You never know. Some kanji have ten or more different pronunciations, depending on the word. Many common words are in the dictionary, and I could probably hack together a way to look them up from one of the free dictionary databases, but proper nouns (e.g. hospital names) are not in the dictionary. So, in my application, I have a list of every prefecture, city, and hospital in Japan. In order to sort these lists, which is a requirement, I need a matching list of each of these names in phonetic form (kana). I can't come up with anything other than paying somebody fluent in Japanese (I'm only so-so) to manually transcribe them. Before I do so though: Is it possible that I am totally high on fire, and there actually is some way to do this sorting without creating my own mappings of kanji words to phonetic readings, that I have somehow overlooked? Is there a publicly available mapping of prefecture/city names, from the government or something? That would reduce the manual mapping I'd need to do to only hospital names. Does anybody have any other advice on how to approach this problem? Any programming language is fine--I'm working with Ruby on Rails but I would be delighted if I could just write a program that would take the kanji input (say 40,000 proper nouns) and then output the phonetic representations as data that I could import into my Rails app. ??????????

    Read the article

  • How to access a field's value in an object using reflection

    - by kentcdodds
    My Question: How to overcome an IllegalAccessException to access the value of a an object's field using reflection. Expansion: I'm trying to learn about reflection to make some of my projects more generic. I'm running into an IllegalAccessException when trying to call field.getValue(object) to get the value of that field in that object. I can get the name and type just fine. If I change the declaration from private to public then this works fine. But in an effort to follow the "rules" of encapsulation I don't want to do this. Any help would be greatly appreciated! Thanks! My Code: package main; import java.lang.reflect.Field; public class Tester { public static void main(String args[]) throws Exception { new Tester().reflectionTest(); } public void reflectionTest() throws Exception { Person person = new Person("John Doe", "555-123-4567", "Rover"); Field[] fields = person.getClass().getDeclaredFields(); for (Field field : fields) { System.out.println("Field Name: " + field.getName()); System.out.println("Field Type: " + field.getType()); System.out.println("Field Value: " + field.get(person)); //The line above throws: Exception in thread "main" java.lang.IllegalAccessException: Class main.Tester can not access a member of class main.Tester$Person with modifiers "private final" } } public class Person { private final String name; private final String phoneNumber; private final String dogsName; public Person(String name, String phoneNumber, String dogsName) { this.name = name; this.phoneNumber = phoneNumber; this.dogsName = dogsName; } } } The Output: run: Field Name: name Field Type: class java.lang.String Exception in thread "main" java.lang.IllegalAccessException: Class main.Tester can not access a member of class main.Tester$Person with modifiers "private final" at sun.reflect.Reflection.ensureMemberAccess(Reflection.java:95) at java.lang.reflect.AccessibleObject.slowCheckMemberAccess(AccessibleObject.java:261) at java.lang.reflect.AccessibleObject.checkAccess(AccessibleObject.java:253) at java.lang.reflect.Field.doSecurityCheck(Field.java:983) at java.lang.reflect.Field.getFieldAccessor(Field.java:927) at java.lang.reflect.Field.get(Field.java:372) at main.Tester.reflectionTest(Tester.java:17) at main.Tester.main(Tester.java:8) Java Result: 1 BUILD SUCCESSFUL (total time: 0 seconds)

    Read the article

  • JSP to Bean to Java class Validation

    - by littlevahn
    I have a rather simple form in JSP that looks like this: <form action="response.jsp" method="POST"> <label>First Name:</label><input type="text" name="firstName" /><br> <label>Last Name:</label><input type="text" name="lastName" /><br> <label>Email:</label><input type="text" name="email" /><br> <label>Re-enter Email:</label><input type="text" name="emailRe" /><br> <label>Address:</label><input type="text" name="address" /><br> <label>Address 2:</label><input type="text" name="address2" /><br> <label>City:</label><input type="text" name="city" /><br> <label>Country:</label> <select name="country"> <option value="0">--Country--</option> <option value="1">United States</option> <option value="2">Canada</option> <option value="3">Mexico</option> </select><br> <label>Phone:</label><input type="text" name="phone" /><br> <label>Alt Phone:</label><input type="text" name="phoneAlt" /><br> <input type="submit" value="submit" /> </form> But when I try and access the value of the select box in my Java class I get null. Ive tried reading it in as a String and an Array of strings neither though seems to be grabbing the right value. The response.jsp looks like this: <%@ page language="java" %> <%@ page import="java.util.*" %> <%@page contentType="text/html" pageEncoding="UTF-8"%> <%! %> <jsp:useBean id="formHandler" class="validation.RegHandler" scope="request"> <jsp:setProperty name="formHandler" property="*" /> </jsp:useBean> <% if (formHandler.validate()) { %> <jsp:forward page="success.jsp"/> <% } else { %> <jsp:forward page="retryReg.jsp"/> <% } %> I already have Java script validation in place but I wanted to make sure I covered validation and checking for non-JS users. The RegHandler just uses the name field to refer to the value in the form. Any Idea how I could access the select box's value?

    Read the article

  • Cross-site request forgery protections: Where do I put all these lines?

    - by brilliant
    Hello, I was looking for a python code that would be able to log in from "Google App Engine" to some of my accounts on some websites (like yahoo or eBay) and was given this code: import urllib, urllib2, cookielib url = "https://login.yahoo.com/config/login?" form_data = {'login' : 'my-login-here', 'passwd' : 'my-password-here'} jar = cookielib.CookieJar() opener = urllib2.build_opener(urllib2.HTTPCookieProcessor(jar)) form_data = urllib.urlencode(form_data) # data returned from this pages contains redirection resp = opener.open(url, form_data) # yahoo redirects to http://my.yahoo.com, so lets go there instead resp = opener.open('http://mail.yahoo.com') print resp.read() Unfortunately, this code didn't work, so I asked another question here and one supporter among other things said this: "You send MD5 hash and not plain password. Also you'd have to play along with all kinds of CSRF protections etc. that they're implementing. Look: <input type="hidden" name=".tries" value="1"> <input type="hidden" name=".src" value="ym"> <input type="hidden" name=".md5" value=""> <input type="hidden" name=".hash" value=""> <input type="hidden" name=".js" value=""> <input type="hidden" name=".last" value=""> <input type="hidden" name="promo" value=""> <input type="hidden" name=".intl" value="us"> <input type="hidden" name=".bypass" value=""> <input type="hidden" name=".partner" value=""> <input type="hidden" name=".u" value="bd5tdpd5rf2pg"> <input type="hidden" name=".v" value="0"> <input type="hidden" name=".challenge" value="5qUiIPGVFzRZ2BHhvtdGXoehfiOj"> <input type="hidden" name=".yplus" value=""> <input type="hidden" name=".emailCode" value=""> <input type="hidden" name="pkg" value=""> <input type="hidden" name="stepid" value=""> <input type="hidden" name=".ev" value=""> <input type="hidden" name="hasMsgr" value="0"> <input type="hidden" name=".chkP" value="Y"> <input type="hidden" name=".done" value="http://mail.yahoo.com"> <input type="hidden" name=".pd" value="ym_ver=0&c=&ivt=&sg="> I am not quite sure where he got all these lines from and where in my code I am supposed to add them. Do You have any idea? I know I was supposed to ask him this question first, and I did, but he never returned, so I decided to ask a separate question here.

    Read the article

  • Parsing CSV File to MySQL DB in PHP

    - by Austin
    I have a some 350-lined CSV File with all sorts of vendors that fall into Clothes, Tools, Entertainment, etc.. categories. Using the following code I have been able to print out my CSV File. <?php $fp = fopen('promo_catalog_expanded.csv', 'r'); echo '<tr><td>'; echo implode('</td><td>', fgetcsv($fp, 4096, ',')); echo '</td></tr>'; while(!feof($fp)) { list($cat, $var, $name, $var2, $web, $var3, $phone,$var4, $kw,$var5, $desc) = fgetcsv($fp, 4096); echo '<tr><td>'; echo $cat. '</td><td>' . $name . '</td><td><a href="http://www.' . $web .'" target="_blank">' .$web.'</a></td><td>'.$phone.'</td><td>'.$kw.'</td><td>'.$desc.'</td>' ; echo '</td></tr>'; } fclose($file_handle); show_source(__FILE__); ?> First thing you will probably notice is the extraneous vars within the list(). this is because of how the excel spreadsheet/csv file: Category,,Company Name,,Website,,Phone,,Keywords,,Description ,,,,,,,,,, Clothes,,4imprint,,4imprint.com,,877-466-7746,,"polos, jackets, coats, workwear, sweatshirts, hoodies, long sleeve, pullovers, t-shirts, tees, tshirts,",,An embroidery and apparel company based in Wisconsin. ,,Apollo Embroidery,,apolloemb.com,,1-800-982-2146,,"hats, caps, headwear, bags, totes, backpacks, blankets, embroidery",,An embroidery sales company based in California. One thing to note is that the last line starts with two commas as it is also listed within "Clothes" category. My concern is that I am going about the CSV output wrong. Should I be using a foreach loop instead of this list way? Should I first get rid of any unnecessary blank columns? Please advise any flaws you may find, improvements I can use so I can be ready to import this data to a MySQL DB.

    Read the article

  • Best way to version control a WCF application with Git?

    - by Sam
    Suppose I have the following projects. The format is [ProjectName] : [ProjectDependency1, ProjectDependency2, etc.] // Service CoolLibrary WcfApp.Core WcfApp.Contracts WcfApp.Services : CoolLibrary, WcfApp.Core, WcfApp.Contracts // Clients CustomerX.App : WcfApp.Contracts CustomerY.App : WcfApp.Contracts CustomerZ.App : WcfApp.Contracts (On a side note, WcfApp.Contracts should not depend on WcfApp.Core, right? Else CustomerX.App would also depend on and thus be exposed to the service domain model?) (CoolLibrary is shared with other applications, so I can't just put it inside of WcfApp.Services.) All of this code is in-house. I was thinking of having 6 repositories for this. The format is [repository folder name] : [Projects included in repository.] 1. CoolLibrary.git : CoolLibrary 2. WcfApp.Contracts.git : WcfApp.Contracts 3. WcfApp.git : WcfApp.Core, WcfApp.Services 4. CustomerX.App.git : CustomerX.App 5. CustomerY.App.git : CustomerY.App 6. CustomerZ.App.git : CustomerZ.App How should I manage my project dependencies? I see three options: I could use binaries which I have to manually copy to each dependent repository. This would be easiest at the start, but my repositories would be a little bloated, and it'd become more tedious as I add more client apps for customers. I could import dependent code as submodules. This is what I will probably end up doing, although I keep reading on the web that submodules are a hassle. I also read that I can use something called the subtree merge strategy, but I am not sure how it is different from just cloning the repo into a subdirectory and adding the subdirectory to .gitignore. Is the difference that the subtree is recorded in the master repository, so (for example) cloning it from a different location will also pull the subtree? I know I asked a lot of questions in this post, but the most important two questions I have are: 1. Am I using the right number and layout of repositories? Should I use less or more? 2. Which of the three dependency management strategies would you recommend? Is there another strategy I haven't considered?

    Read the article

  • Reading three words and sorting them in lexicographic order

    - by Derrick
    I am trying to create a program that asks the User to type three words and sort them in lexicographic order. EXAMPLE; Enter three words separated by spaces: Pear Orange Apple Apple Orange Pear The program is working fine (if I attempt the above example) except for one type of combination example that I will show below. EXAMPLE; Enter three words separated by spaces: Orange Apple Pear Apple Pear Pear The program is skipping the first word (Orange) if it is supposed to appear in the middle of the three words. I believe that this line of code is affecting the program because it says that "this assigned value is never used" but I'm not sure how to fix it since I'm still an entry Java learner. middle = firstWord; Because of that line being unused, it's why Pear appeared twice. import java.util.*; public static void main(String[] args) { Scanner wordInput = new Scanner(System.in); String firstWord; String secondWord; String thirdWord; System.out.println("Enter three words separated by spaces: "); firstWord = wordInput.next(); secondWord = wordInput.next(); thirdWord = wordInput.next(); String top = firstWord; String bottom = firstWord; if( top.compareTo(secondWord) > 0) { top = secondWord; } if( top.compareTo(thirdWord) > 0) { top = thirdWord; } if( bottom.compareTo(secondWord) < 0) { bottom = secondWord; } if( bottom.compareTo(thirdWord) < 0) { bottom = thirdWord; } String middle; if( !firstWord.equals(bottom) && !firstWord.equals(top) ) { middle = firstWord; } if( !secondWord.equals(bottom) && !secondWord.equals(top) ) { middle = secondWord; } else { middle = thirdWord; } System.out.println( top ); System.out.println( middle ); System.out.println( bottom ); } } Does anyone what I am missing or doing wrong? :( Please and thank you for any help!

    Read the article

  • go programming POST FormValue can't be printed

    - by poor_programmer
    Before I being a bit of background, I am very new to go programming language. I am running go on Win 7, latest go package installer for windows. I'm not good at coding but I do like some challenge of learning a new language. I wanted to start learn Erlang but found go very interesting based on the GO I/O videos in youtube. I'm having problem with capturing POST form values in GO. I spend three hours yesterday to get go to print a POST form value in the browser and failed miserably. I don't know what I'm doing wrong, can anyone point me to the right direction? I can easily do this in another language like C#, PHP, VB, ASP, Rails etc. I have search the entire interweb and haven't found a working sample. Below is my sample code. Here is Index.html page {{ define "title" }}Homepage{{ end }} {{ define "content" }} <h1>My Homepage</h1> <p>Hello, and welcome to my homepage!</p> <form method="POST" action="/"> <p> Enter your name : <input type="text" name="username"> </P> <p> <button>Go</button> </form> <br /><br /> {{ end }} Here is the base page <!DOCTYPE html> <html lang="en"> <head> <title>{{ template "title" . }}</title> </head> <body> <section id="contents"> {{ template "content" . }} </section> <footer id="footer"> My homepage 2012 copy </footer> </body> </html> now some go code package main import ( "fmt" "http" "strings" "html/template" ) var index = template.Must(template.ParseFiles( "templates/_base.html", "templates/index.html", )) func GeneralHandler(w http.ResponseWriter, r *http.Request) { index.Execute(w, nil) if r.Method == "POST" { a := r.FormValue("username") fmt.Fprintf(w, "hi %s!",a); //<-- this variable does not rendered in the browser!!! } } func helloHandler(w http.ResponseWriter, r *http.Request) { remPartOfURL := r.URL.Path[len("/hello/"):] fmt.Fprintf(w, "Hello %s!", remPartOfURL) } func main() { http.HandleFunc("/", GeneralHandler) http.HandleFunc("/hello/", helloHandler) http.ListenAndServe("localhost:81", nil) } Thanks! PS: Very tedious to add four space before every line of code in stackoverflow especially when you are copy pasting. Didn't find it very user friendly or is there an easier way?

    Read the article

  • UIScrollView does not scroll

    - by Preston Cheung
    I got a problem about UIScrollView. I am making a custom view which inherits UIView. The view has a UIScrollView on which there are lots of buttons which should scroll left and right. The UIScrollView and buttons can show normally. But I cannot scroll the buttons. Could someone give me some suggestions? Thanks a lot! MZMPhotoCalenderSwitcher.h #import <UIKit/UIKit.h> @interface MZMPhotoCalenderSwitcher : UIView <UIScrollViewDelegate> @property (strong, nonatomic) UIScrollView *topSwitcher; @end MZMPhotoCalenderSwitcher.m - (void)viewDidLoad { [super viewDidLoad]; // Do any additional setup after loading the view. self.topSwitcher = [[UIScrollView alloc] initWithFrame:CGRectMake(0, LABEL_HEIGHT + VIEW_Y, self.view.bounds.size.width, TOP_SWITCHER_HEIGHT)]; self.topSwitcher.backgroundColor = [UIColor greenColor]; self.topSwitcher.pagingEnabled = YES; self.topSwitcher.showsHorizontalScrollIndicator = NO; self.topSwitcher.showsVerticalScrollIndicator = NO; [self add:3 ButtonsOnView:self.topSwitcher withButtonWidth:44.8f andHeight:20.0f]; } - (void)add:(int)num ButtonsOnView:(UIScrollView *)view withButtonWidth:(CGFloat)width andHeight:(CGFloat)height { CGFloat totalTopSwitcherWidth = num * width; [view setContentSize:CGSizeMake(totalTopSwitcherWidth, view.bounds.size.height)]; CGFloat xOffset = 0.0f; for (int i=1; i<=num; i++) { UIButton *button = [UIButton buttonWithType:UIButtonTypeRoundedRect]; [button setFrame:CGRectMake(xOffset, 0, width, height)]; xOffset += width; [button setTitle:[NSString stringWithFormat:@"%d", i] forState:UIControlStateNormal]; button.titleLabel.font = [UIFont systemFontOfSize:10]; [button setTitleColor:[UIColor blueColor] forState:UIControlStateNormal]; [button setTitleColor:[UIColor blackColor] forState:UIControlStateSelected]; [button setTag:i]; [button addTarget:self action:@selector(buttonEvent) forControlEvents:UIControlEventTouchUpInside]; if (i % 2 == 0) [button setBackgroundColor:[UIColor yellowColor]]; else [button setBackgroundColor:[UIColor redColor]]; [view addSubview:button]; } }

    Read the article

  • Python and displaying HTML

    - by Tyler Seymour
    I've gotten pretty comfortable with Python and now I'm looking to make a rudimentary web application. I was somewhat scared of Django and the other Python frameworks so I went caveman on it and decided to generate the HTML myself using another Python script. Maybe this is how you do it anyways - but I'm just figuring this stuff out. I'm really looking for a tip-off on, well, what to do next. My Python script PRINTS the HTML (is this even correct? I need it to be on a webpage!), but now what? Thanks for your continued support during my learning process. One day I will post answers! -Tyler Here's my code: from SearchPhone import SearchPhone phones = ["Iphone 3", "Iphone 4", "Iphone 5","Galaxy s3", "Galaxy s2", "LG Lucid", "LG Esteem", "HTC One S", "Droid 4", "Droid RAZR MAXX", "HTC EVO", "Galaxy Nexus", "LG Optimus 2", "LG Ignite", "Galaxy Note", "HTC Amaze", "HTC Rezound", "HTC Vivid", "HTC Rhyme", "Motorola Photon", "Motorola Milestone", "myTouch slide", "HTC Status", "Droid 3", "HTC Evo 3d", "HTC Wildfire", "LG Optimus 3d", "HTC ThunderBolt", "Incredible 2", "Kyocera Echo", "Galaxy S 4g", "HTC Inspire", "LG Optimus 2x", "Samsung Gem", "HTC Evo Shift", "Nexus S", "LG Axis", "Droid 2", "G2", "Droid x", "Droid Incredible" ] print """<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>table of phones</title> </head> <body> </body> </html> """ #table print '<table width="100%" border="1">' for x in phones: y = SearchPhone(x) print "\t<tr>" print "\t\t<td>" + str(y[0]) + "</td>" print "\t\t<td>" + str(y[1]) + "</td>" print "\t\t<td>" + str(y[2]) + "</td>" print "\t\t<td>" + str(y[3]) + "</td>" print "\t\t<td>" + str(y[4]) + "</td>" print "\t</tr>" print "</table>

    Read the article

  • A question about making a C# class persistent during a file load

    - by Adam
    Apologies for the indescriptive title, however it's the best I could think of for the moment. Basically, I've written a singleton class that loads files into a database. These files are typically large, and take hours to process. What I am looking for is to make a method where I can have this class running, and be able to call methods from within it, even if it's calling class is shut down. The singleton class is simple. It starts a thread that loads the file into the database, while having methods to report on the current status. In a nutshell it's al little like this: public sealed class BulkFileLoader { static BulkFileLoader instance = null; int currentCount = 0; BulkFileLoader() public static BulkFileLoader Instance { // Instanciate the instance class if necessary, and return it } public void Go() { // kick of 'ProcessFile' thread } public void GetCurrentCount() { return currentCount; } private void ProcessFile() { while (more rows in the import file) { // insert the row into the database currentCount++; } } } The idea is that you can get an instance of BulkFileLoader to execute, which will process a file to load, while at any time you can get realtime updates on the number of rows its done so far using the GetCurrentCount() method. This works fine, except the calling class needs to stay open the whole time for the processing to continue. As soon as I stop the calling class, the BulkFileLoader instance is removed, and it stops processing the file. What I am after is a solution where it will continue to run independently, regardless of what happens to the calling class. I then tried another approach. I created a simple console application that kicks off the BulkFileLoader, and then wrapped it around as a process. This fixes one problem, since now when I kick off the process, the file will continue to load even if I close the class that called the process. However, now the problem I have is that cannot get updates on the current count, since if I try and get the instance of BulkFileLoader (which, as mentioned before is a singleton), it creates a new instance, rather than returning the instance that is currently in the executing process. It would appear that singletons don't extend into the scope of other processes running on the machine. In the end, I want to be able to kick off the BulkFileLoader, and at any time be able to find out how many rows it's processed. However, that is even if I close the application I used to start it. Can anyone see a solution to my problem?

    Read the article

  • Programatically created UITableViewCell subclass only working on highlight

    - by squarefrog
    I've created a subclass of UITableViewCell but I'm struggling to get it to work properly. If I use UITableViewStyleDefault then the class only works when highlighted. If I use UITableViewStyleValue1 then it mostly works but I'm unable to change label fonts much. I tried researching but it seems everyone is doing this via a .xib file, but not programatically. Implementation file #import "ASCustomCellWithCount.h" @implementation ASCustomCellWithCount @synthesize primaryLabel,secondaryLabel,contentCountImage,contentCount; - (id)initWithStyle:(UITableViewCellStyle)style reuseIdentifier:(NSString *)reuseIdentifier { self = [super initWithStyle:style reuseIdentifier:reuseIdentifier]; if (self) { // Initialization code contentCountImage = [[UIImageView alloc] initWithImage:[UIImage imageNamed: @"tableCount.png"] ]; primaryLabel = [[UILabel alloc] init]; primaryLabel.textAlignment = UITextAlignmentLeft; primaryLabel.textColor = [UIColor blackColor]; primaryLabel.font = [UIFont systemFontOfSize: 20]; primaryLabel.backgroundColor = [UIColor clearColor]; secondaryLabel = [[UILabel alloc] init]; secondaryLabel.textAlignment = UITextAlignmentLeft; secondaryLabel.textColor = [UIColor blackColor]; secondaryLabel.font = [UIFont systemFontOfSize: 8]; secondaryLabel.backgroundColor = [UIColor clearColor]; contentCount = [[UILabel alloc] init]; contentCount.textAlignment = UITextAlignmentCenter; contentCount.font = [UIFont boldSystemFontOfSize: 15]; contentCount.textColor = [UIColor whiteColor]; contentCount.shadowColor = [UIColor blackColor]; contentCount.shadowOffset = CGSizeMake(1, 1); contentCount.backgroundColor = [UIColor clearColor]; [self.contentView addSubview: contentCountImage]; [self.contentView addSubview: primaryLabel]; [self.contentView addSubview: secondaryLabel]; [self.contentView addSubview: contentCount]; } return self; } - (void)layoutSubviews { [super layoutSubviews]; CGRect contentRect = self.contentView.bounds; // CGFloat boundsX = contentRect.origin.x; primaryLabel.frame = CGRectMake(0 ,0, 200, 25); secondaryLabel.frame = CGRectMake(0, 30, 100, 15); contentCount.frame = CGRectMake(contentRect.size.width - 48, contentRect.size.height / 2 - 13, 36, 24); contentCountImage.frame = CGRectMake(contentRect.size.width - 48, contentRect.size.height / 2 - 12, 36, 24); } - (void)setSelected:(BOOL)selected animated:(BOOL)animated { [super setSelected:selected animated:animated]; // Configure the view for the selected state } - (void)dealloc { [primaryLabel release]; [secondaryLabel release]; [contentCountImage release]; [contentCount release]; } @end And then to create the cell I use - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; ASCustomCellWithCount *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[ASCustomCellWithCount alloc] initWithStyle: UITableViewCellStyleDefault reuseIdentifier:CellIdentifier] autorelease]; } cell.textLabel.text = [NSString stringWithFormat:@"%@", [tempArray objectAtIndex: indexPath.row]]; cell.contentCount.text = @"49"; return cell; }

    Read the article

  • Basic drawing with Quartz 2D on iPhone

    - by wwrob
    My goal is to make a program that will draw points whenever the screen is touched. This is what I have so far: The header file: #import <UIKit/UIKit.h> @interface ElSimView : UIView { CGPoint firstTouch; CGPoint lastTouch; UIColor *pointColor; CGRect *points; int npoints; } @property CGPoint firstTouch; @property CGPoint lastTouch; @property (nonatomic, retain) UIColor *pointColor; @property CGRect *points; @property int npoints; @end The implementation file: //@synths etc. - (id)initWithFrame:(CGRect)frame { return self; } - (id)initWithCoder:(NSCoder *)coder { if(self = [super initWithCoder:coder]) { self.npoints = 0; } return self; } - (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [touches anyObject]; firstTouch = [touch locationInView:self]; lastTouch = [touch locationInView:self]; } - (void)touchesEnded:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [touches anyObject]; lastTouch = [touch locationInView:self]; points = (CGRect *)malloc(sizeof(CGRect) * ++npoints); points[npoints-1] = CGRectMake(lastTouch.x-15, lastTouch.y-15,30,30); [self setNeedsDisplay]; } - (void)touchesMoved:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [touches anyObject]; lastTouch = [touch locationInView:self]; [self setNeedsDisplay]; } - (void)drawRect:(CGRect)rect { CGContextRef context = UIGraphicsGetCurrentContext(); CGContextSetLineWidth(context, 2.0); CGContextSetStrokeColorWithColor(context, [UIColor blackColor].CGColor); CGContextSetFillColorWithColor(context, pointColor.CGColor); for(int i=0; i<npoints; i++) CGContextAddEllipseInRect(context, points[i]); CGContextDrawPath(context, kCGPathFillStroke); } - (void)dealloc { free(points); [super dealloc]; } @end When I load this and click some points, it draws the first points normally, then then next points are drawn along with random ellipses (not even circles). Also I have another question: When is exactly drawRect executed?

    Read the article

  • populate CoreData data model from JSON files prior to app start

    - by johannes_d
    I am creating an iPad App that displays data I got from an API in JSON format. My Core Data model has several entities(Countries, Events, Talks, ...). For each entity I have one .json file that contains all instances of the entity and its attributes as well as its relationships. I would like to populate my Core Data data model with these entities before the start of the App (otherwise it takes about 15 minutes for the iPad to create all the instances of the entities from the several JSON files using factory methods). I am currently importing the data into CoreData like this: -(void)fetchDataIntoDocument:(UIManagedDocument *)document { dispatch_queue_t dataQ = dispatch_queue_create("Data import", NULL); dispatch_async(dataQ, ^{ //Fetching data from application bundle NSURL *tedxgroupsurl = [[NSBundle mainBundle] URLForResource:@"contries" withExtension:@"json"]; NSURL *tedxeventsurl = [[NSBundle mainBundle] URLForResource:@"events" withExtension:@"json"]; //converting the JSON files to NSDictionaries NSError *error = nil; NSDictionary *countries = [NSJSONSerialization JSONObjectWithData:[NSData dataWithContentsOfURL:countriesurl] options:kNilOptions error:&error]; countries = [countries objectForKey:@"countries"]; NSDictionary *events = [NSJSONSerialization JSONObjectWithData:[NSData dataWithContentsOfURL:eventsurl] options:kNilOptions error:&error]; events = [events objectForKey:@"events"]; //creating entities using factory methods in NSManagedObject Subclasses (Country / Event) [document.managedObjectContext performBlock:^{ NSLog(@"creating countries"); for (NSDictionary *country in countries) { [Country countryWithCountryInfo:country inManagedObjectContext:document.managedObjectContext]; //creating Country entities } NSLog(@"creating events"); for (NSDictionary *event in events) { [Event eventWithEventInfo:event inManagedObjectContext:document.managedObjectContext]; // creating Event entities } NSLog(@"done creating, saving document"); [document saveToURL:document.fileURL forSaveOperation:UIDocumentSaveForOverwriting completionHandler:NULL]; }]; }); dispatch_release(dataQ); } This combines the different JSON files into one UIManagedDocument which i can then perform fetchRequests on to populate tableViews, mapView, etc. I'm looking for a way to create this document outside my application & add it to the mainBundle. Then I could copy it once to the apps DocumentsDirectory and be able I use it (instead of creating the Document within the app from the original JSON files). Any help is appreciated!

    Read the article

  • Flex bug?? Get messed up stacked ColumnChart with type="100%"

    - by Nir
    I am trying to do a stacked Column chart with type="100%" and a mixture of positive and negative values. When all the values are positive, is functions well, but when negative numbers come to the game, it looks totally messed up. When I also look at Adobe documentation (look here), I see the following code for stacked column chart involving negative numbers: <?xml version="1.0"?> <!-- charts/StackedNegative.mxml --> <mx:Application xmlns:mx="http://www.adobe.com/2006/mxml"> <mx:Script><![CDATA[ import mx.collections.ArrayCollection; [Bindable] public var expenses:ArrayCollection = new ArrayCollection([ {Month:"Jan", Profit:-2000, Expenses:-1500}, {Month:"Feb", Profit:1000, Expenses:-200}, {Month:"Mar", Profit:1500, Expenses:-500} ]); ]]></mx:Script> <mx:Panel title="Column Chart"> <mx:ColumnChart id="myChart" dataProvider="{expenses}" showDataTips="true"> <mx:horizontalAxis> <mx:CategoryAxis dataProvider="{expenses}" categoryField="Month" /> </mx:horizontalAxis> <mx:series> <mx:ColumnSet type="stacked" allowNegativeForStacked="true"> <mx:series> <mx:ColumnSeries xField="Month" yField="Profit" displayName="Profit" /> <mx:ColumnSeries xField="Month" yField="Expenses" displayName="Expenses" /> </mx:series> </mx:ColumnSet> </mx:series> </mx:ColumnChart> <mx:Legend dataProvider="{myChart}"/> </mx:Panel> </mx:Application> It works fine. But try to change: <mx:ColumnSet type="stacked" allowNegativeForStacked="true"> to: <mx:ColumnSet type="100%" allowNegativeForStacked="true"> and you'll see that it doesn't on January data, where both values are negative, the chart shows as if they are positive, and on the other two where one value is positive and the other is negative, it shows only the positive part as 100%... Isn't it a Flex Bug? I have my own case with such data and it behaves wrong the same way. I'd expect that if it has 800 stacked on -200, it will show 80% up and 20% down, totalling 100%. BTW: Using Flex 4, though these are all mx components. Thanks a lot and regards from Berlin, Germany, Nir.

    Read the article

  • SQLite/iPhone read copyright symbol

    - by Marco A
    Hi All, I am having problems reading the copyright symbol from a sqlite db that I have for my App that I am developing. I import the information manually, ie, from an excel sheet. I have tried two ways of doing it and failed with both: 1) Tried replacing the copyright symbol with "\u00ae" (unicode combination) within excel and then importing the modified file. - Result: I get the combination of \u00ae as a part of the string, it doesnt detect the unicode combination. 2) Tried leaving as it is. Importing the excel with the copyright symbol. - Result: I get a symbol that is different from the copyright, its something like an AE put together.looks like this: Æ Heres my code how I read from DB: -(void) readCategoriesFromDatabase:(NSString *) rest_input { // Init the products Array categories = [[NSMutableArray alloc] init]; // Open the database from the users filessytem rest_input = [rest_input stringByAppendingString:@"'"]; NSString *newString; newString = [@"select distinct category from food where restaurant='" stringByAppendingString:rest_input]; const char *cat_sqlStatement = [newString UTF8String]; sqlite3_stmt *cat_compiledStatement; if(sqlite3_prepare_v2(database, cat_sqlStatement, -1, &cat_compiledStatement, NULL) == SQLITE_OK) { // Loop through the results and add them to the feeds array while(sqlite3_step(cat_compiledStatement) == SQLITE_ROW) { NSString *catName = [NSString stringWithUTF8String:(char *)sqlite3_column_text(cat_compiledStatement,0)]; // Create a new product object with the data from the database Product *category = [[Product alloc] initWithName:catName]; // Add the product object to the respective Array [categories addObject:category]; [category release]; } sqlite3_finalize(cat_compiledStatement); } NSLog(@"Finished Accessing Database to gather Categories...."); } I open the DB with this function: -(void) checkAndCreateDatabase{ NSLog(@"Checking/Creating Database...."); NSFileManager *fileManager = [NSFileManager defaultManager]; success = [fileManager fileExistsAtPath:databasePath]; [fileManager removeFileAtPath:databasePath handler:nil]; NSString *databasePathFromApp = [[[NSBundle mainBundle] resourcePath] stringByAppendingPathComponent:databaseName]; [fileManager copyItemAtPath:databasePathFromApp toPath:databasePath error:nil]; [fileManager release]; if (sqlite3_open([databasePath UTF8String], &database) != SQLITE_OK) { sqlite3_close(database); database = nil; } NSLog(@"Finished Checking/Creating Database...."); } Thanks to anything that can help me out.

    Read the article

  • How can i maintain last cookie value in flex with jsp?

    - by praveen
    Hi All, my login form in flex when I login I have created a cookie in jsp like this name setValueCookie.jsp <%@ page language="java" import="java.util.* , javax.net.*" contentType="text/html; charset=ISO-8859-1" pageEncoding="ISO-8859-1"%> <!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd"> <html> <% String username = request.getParameter("value"); System.out.println("Email got in cookieSet = " + username); if(username==null) username=""; Date now = new Date(); String timestamp = now.toString(); Cookie cookie = new Cookie("username",username); cookie.setMaxAge(365 * 24 * 60 * 60); response.addCookie(cookie); %> <head> <meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"> <title>DashBoard-Cookie</title> </head> <body> </body> </html> now using Http service request parameter i am passing username 'Value' to this jsp. and i am reading cookie value from getValueCookie.jsp like this <% String cookieName = "username"; Cookie cookies [] = request.getCookies (); Cookie myCookie = null; String result; if (cookies != null) { for (int i = 0; i < cookies.length; i++) { if (cookies [i].getName().equals (cookieName)) { myCookie = cookies[i]; break; } } } %> <data> <status><%=myCookie.getValue().toString()%></status> </data> through the httpservice value i am getting but if i open a new window or any new tab cookie value is not getting how can i solve this? Thanks in advance.

    Read the article

  • javascript-aware html parser for Python ~

    - by znetor
    <html> <head> <script type="text/javascript"> document.write('<a href="http://www.google.com">f*** js</a>'); document.write("f*** js!"); </script> </head> <body> <script type="text/javascript"> document.write('<a href="http://www.google.com">f*** js</a>'); document.write("f*** js!"); </script> <div><a href="http://www.google.com">f*** js</a></div> </body> </html> I want use xpath to catch all lable object in the html page above... In [1]: import lxml.html as H In [2]: f = open("test.html","r") In [3]: c = f.read() In [4]: doc = H.document_fromstring(c) In [5]: doc.xpath('//a') Out[5]: [<Element a at a01d17c>] In [6]: a = doc.xpath('//a')[0] In [7]: a.getparent() Out[7]: <Element div at a01d41c> I only get one don't generate by js~ but firefox xpath checker can find all lable!? http://i.imgur.com/0hSug.png how to do that??? thx~! <html> <head> </head> <body> <script language="javascript"> function over(){ a.innerHTML="mouse me" } function out(){ a.innerHTML="<a href='http://www.google.com'>google</a>" } </script> <body><li id="a"onmouseover="over()" onmouseout="out()">mouse me</li> </body> </html>

    Read the article

  • CGAffineTransformMakeRotation goes the other way after 180 degrees (-3.14)

    - by TheKillerDev
    So, i am trying to do a very simple disc rotation (2d), according to the user touch on it, just like a DJ or something. It is working, but there is a problem, after certain amount of rotation, it starts going backwards, this amount is after 180 degrees or as i saw in while logging the angle, -3.14 (pi). I was wondering, how can i achieve a infinite loop, i mean, the user can keep rotating and rotating to any side, just sliding his finger? Also a second question is, is there any way to speed up the rotation? Here is my code right now: #import <UIKit/UIKit.h> @interface Draggable : UIImageView { CGPoint firstLoc; UILabel * fred; double angle; } @property (assign) CGPoint firstLoc; @property (retain) UILabel * fred; @end @implementation Draggable @synthesize fred, firstLoc; - (id)initWithFrame:(CGRect)frame { self = [super initWithFrame:frame]; angle = 0; if (self) { // Initialization code } return self; } -(void)handleObject:(NSSet *)touches withEvent:(UIEvent *)event isLast:(BOOL)lst { UITouch *touch =[[[event allTouches] allObjects] lastObject]; CGPoint curLoc = [touch locationInView:self]; float fromAngle = atan2( firstLoc.y-self.center.y, firstLoc.x-self.center.x ); float toAngle = atan2( curLoc.y-(self.center.y+10), curLoc.x-(self.center.x+10)); float newAngle = angle + (toAngle - fromAngle); NSLog(@"%f",newAngle); CGAffineTransform cgaRotate = CGAffineTransformMakeRotation(newAngle); self.transform = cgaRotate; if (lst) angle = newAngle; } -(void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch =[[[event allTouches] allObjects] lastObject]; firstLoc = [touch locationInView:self]; }; -(void) touchesMoved:(NSSet *)touches withEvent:(UIEvent *)event { [self handleObject:touches withEvent:event isLast:NO]; }; -(void) touchesEnded:(NSSet *)touches withEvent:(UIEvent *)event { [self handleObject:touches withEvent:event isLast:YES]; } @end And in the ViewController: UIImage *tmpImage = [UIImage imageNamed:@"theDisc.png"]; CGRect cellRectangle; cellRectangle = CGRectMake(-1,self.view.frame.size.height,tmpImage.size.width ,tmpImage.size.height ); dragger = [[Draggable alloc] initWithFrame:cellRectangle]; [dragger setImage:tmpImage]; [dragger setUserInteractionEnabled:YES]; dragger.layer.anchorPoint = CGPointMake(.5,.5); [self.view addSubview:dragger]; I am open to new/cleaner/more correct ways of doing this too. Thanks in advance.

    Read the article

  • Twisted + SQLAlchemy and the best way to do it.

    - by Khorkrak
    So I'm writing yet another Twisted based daemon. It'll have an xmlrpc interface as usual so I can easily communicate with it and have other processes interchange data with it as needed. This daemon needs to access a database. We've been using SQL Alchemy in place of hard coding SQL strings for our latest projects - those mostly done for web apps in Pylons. We'd like to do the same for this app and re-use library code that makes use of SQL Alchemy. So what to do? Well of course since that library was written for use in a Pylons app it's all the straight-forward blocking style code that everyone is accustomed to and all of the non-blocking is magically handled by Pylons via threading, thread locals, scoped sessions and so on. So now for Twisted I guess I'm a bit stuck. I could: Just write the sql I need directly if it's minimal and use the dbapi pool in twisted to do runInteractions etc when I need to hit the db. Use the objects and inherently blocking methods in our library and block now and then in my Twisted daemon. Bah. Use sAsync which was last updated in 2008 and kind of reuse the models we have defined already but not really and it does address code that needs to work in Pylons either. Does that even work with the latest version SQL Alchemy? Who knows. That project looked great though - why was it apparently abandoned? Spawn a separate subprocess and have it deal with the library code and all it's blocking, the results being returned back to my daemon when ready as objects marshalled via YAML over xmlrpc. Use deferToThread and then expunge the objects returned having made sure to do eager loads so that I have all my stuff that I might need. Seems kind of ugha to me. I'm also stuck using Python 2.5.4 atm so no 2.6 yet and I don't think I can just do an import from future to get access to the cool new multiprocessing module stuff in there. That's OK though I guess as we've got dealing with interprocess communication down pretty well. So I'm leaning towards option 4 mostly as that would avoid the mortal sin of logic duplication with option 1 while also staying the heck away from threads. Any better ideas?

    Read the article

  • What am I encrypting wrong here?

    - by Katie Krueger
    So I have a wordplay project to do and I have to encrypt some characters. I am at the point where I am stuck, and when I run it and type 1 for encrypt it doesn't shift that many letters. It just prints the work over again. I am wondering what I could do to fix it where if I say "hello" it will print 1 character over and say "ifmmp" Thank you! import java.util.Scanner; public class WordPlayTester{ public static void main(String [] args){ String word, reverse=""; String original; int key= 0; String Menu= "1-Encrypt \n2-Decrypt \n3-Is Palindrome \n0-Quit \n-Select an option-"; Scanner in = new Scanner(System.in); System.out.println("-Type any word-"); word = in.nextLine(); System.out.println(Menu); int choice=in.nextInt(); if(choice==1) { System.out.println("Insert a Key number"); int select= in.nextInt(); for (int i=0; i < word.length(); i++) { char c = word.charAt(i); if (c >= 'A' && c <= 'Z') { c = (char)(c - 64); int n = c+1; n = n % 26; if (n < 0) { n = n + 26; } c = (char)(n + 65); } System.out.println(c); } } else if(choice==3) { int length = word.length(); for ( int i = length - 1 ; i >= 0 ; i-- ) reverse = reverse + word.charAt(i); if (word.equals(reverse)) System.out.println("Your word is a palindrome."); else System.out.println("Your word is not a palindrome."); } else if(choice==0) { System.exit(0); } else { System.out.println(Menu); } } }

    Read the article

  • Assign value to HTML textbox from JSP

    - by prakash_d22
    Hello I am creating a web page to add some information about given product.I need to enter id,name,description and image as information.I need the id to be auto generated.I am using jsp and database as access.I am fetching the count(*)+1 value from database and assigning to my html text box but its showing as null.can i get some help? Code: <body> <%@page import="java.sql.*"%> <%! String no; %> <% try{ Class.forName("sun.jdbc.odbc.JdbcOdbcDriver"); Connection con = DriverManager.getConnection("jdbc:odbc:pd"); ResultSet rs = null; Statement st = con.createStatement(); String sql = ("select count(*)+1 from products"); st.executeUpdate(sql); while (rs.next()) { no=rs.getString("count(*)+1"); } rs.close(); st.close(); con.close(); } catch(Exception e){} %> <Form name='Form1' action="productcode.jsp" method="post"> <table width="1024" border="0"> <tr> <td width="10">&nbsp;</td> <td width="126">Add Product: </td> <td width="277">&nbsp;</td> <td width="583">&nbsp;</td> </tr> <tr> <td>&nbsp;</td> <td>Product Id:</td> <td><label> <input type="text" name="id" value="<%= no%>"/> </label></td> <td>&nbsp;</td> .... and so on

    Read the article

< Previous Page | 345 346 347 348 349 350 351 352 353 354 355 356  | Next Page >