Search Results

Search found 9182 results on 368 pages for 'import hooks'.

Page 348/368 | < Previous Page | 344 345 346 347 348 349 350 351 352 353 354 355  | Next Page >

  • CoGetClassObject gives many First-chance exceptions in ATL project. Should I worry?

    - by Andrew
    Hello, I have written a COM object that in turn uses a thrid party ActiveX control. In my FinalConstruct() for my COM object, I instantiate the ActiveX control with the follow code: HRESULT hRes; LPCLASSFACTORY2 pClassFactory; hRes = CoInitializeEx(NULL,COINIT_APARTMENTTHREADED); bool bTest = SUCCEEDED(hRes); if (!bTest) return E_FAIL; if (SUCCEEDED(CoGetClassObject(__uuidof(SerialPortSniffer), CLSCTX_INPROC_SERVER, NULL, IID_IClassFactory2, (LPVOID *)(&pClassFactory)))) { ... more set up code When I step over the line if (SUCCEEDED(CoGetClassObject(__uuidof(SerialPortSniffer), ..., I get 20+ lines in the Output window stating: First-chance exception at 0x0523f82e in SillyComDriver.exe: 0xC0000005: Access violation writing location 0x00000000. I also get the lines: First-chance exception at 0x051e3f3d in SillyComDriver.exe: 0xC0000096: Privileged instruction. First-chance exception at 0x100ab9e6 in SillyComDriver.exe: 0xC000001D: Illegal Instruction. Notice these are first-chance exceptions. The program runs as expected I can access the third party methods/properties. Still, I'm left wondering why they are occurring. Perhaps my way of instantiating the ActiveX control (for which I want use of it's methods/properties and not it's GUI stuff) is incorrect? Besides the code I'm showing, I also put the line import "spsax.dll" no_namespace in the stdafx.h That's all the code necessary for my simple demo project. I noticed this problem because I had (inadvertently) set the "break on exceptions" options in my "real" project and it was breaking on this line. Once I removed it, it also works. If you're read this far thank you, and perhaps I can ask one other minor question. In my demo project, if I right click on SerialPortSniffer and "go to definition", it takes me to the file C:....\AppData\Local\Temp\spsax.tlh. Can someone explain that? Finally, in my "real" project, right clicking on SerialPortSniffer and going to difinition leads to "The symbol 'SerialPortSniffer' is not defined". It doesn't seem to affect the program though. Is there some setting I've messed up? By the way, all my code is written w/ VS2008. Thanks, Dave

    Read the article

  • Is do-notation specific to "base:GHC.Base.Monad"?

    - by yairchu
    The idea that the standard Monad class is flawed and that it should actually extend Functor or Pointed is floating around. I'm not necessarily claiming that it is the right thing to do, but suppose that one was trying to do it: import Prelude hiding (Monad(..)) class Functor m => Monad m where return :: a -> m a join :: m (m a) -> m a join = (>>= id) (>>=) :: m a -> (a -> m b) -> m b a >>= t = join (fmap t a) (>>) :: m a -> m b -> m b a >> b = a >>= const b So far so good, but then when trying to use do-notation: whileM :: Monad m => m Bool -> m () whileM iteration = do done <- iteration if done then return () else whileM iteration The compiler complains: Could not deduce (base:GHC.Base.Monad m) from the context (Monad m) Question: Does do-notation work only for base:GHC.Base.Monad? Is there a way to make it work with an alternative Monad class? Extra context: What I really want to do is replace base:Control.Arrow.Arrow with a "generalized" Arrow class: {-# LANGUAGE TypeFamilies #-} class Category a => Arrow a where type Pair a :: * -> * -> * arr :: (b -> c) -> a b c first :: a b c -> a (Pair a b d) (Pair a c d) second :: a b c -> a (Pair a d b) (Pair a d c) (***) :: a b c -> a b' c' -> a (Pair a b b') (Pair a c c') (&&&) :: a b c -> a b c' -> a b (Pair a c c') And then use the Arrow's proc-notation with my Arrow class, but that fails like in the example above of do-notation and Monad. I'll use mostly Either as my pair type constructor and not the (,) type constructor as with the current Arrow class. This might allow to make the code of my toy RTS game (cabal install DefendTheKind) much prettier.

    Read the article

  • Connect to SQLite Database using Eclipse (Java)

    - by bnabilos
    Hello, I'm trying to connect to SQLite database with Ecplise but I have some errors. This is my Java code and the errors that I get on output. Please see if you can help me. Thank you in advance. package jdb; import java.sql.*; public class Test { public static void main(String[] args) throws Exception { Class.forName("org.sqlite.JDBC"); Connection conn = DriverManager.getConnection("jdbc:sqlite:/Applications/MAMP/db/sqlite/test.sqlite"); Statement stat = conn.createStatement(); stat.executeUpdate("drop table if exists people;"); stat.executeUpdate("create table people (name, occupation);"); PreparedStatement prep = conn.prepareStatement( "insert into people values (?, ?);"); prep.setString(1, "Gandhi"); prep.setString(2, "politics"); prep.addBatch(); prep.setString(1, "Turing"); prep.setString(2, "computers"); prep.addBatch(); prep.setString(1, "Wittgenstein"); prep.setString(2, "smartypants"); prep.addBatch(); conn.setAutoCommit(false); prep.executeBatch(); conn.setAutoCommit(true); ResultSet rs = stat.executeQuery("select * from people;"); while (rs.next()) { System.out.println("name = " + rs.getString("name")); System.out.println("job = " + rs.getString("occupation")); } rs.close(); conn.close(); } } ans that what I get in Ecplise : Exception in thread "main" java.lang.ClassNotFoundException: org.sqlite.JDBC at java.net.URLClassLoader$1.run(URLClassLoader.java:200) at java.security.AccessController.doPrivileged(Native Method) at java.net.URLClassLoader.findClass(URLClassLoader.java:188) at java.lang.ClassLoader.loadClass(ClassLoader.java:315) at sun.misc.Launcher$AppClassLoader.loadClass(Launcher.java:330) at java.lang.ClassLoader.loadClass(ClassLoader.java:250) at java.lang.ClassLoader.loadClassInternal(ClassLoader.java:398) at java.lang.Class.forName0(Native Method) at java.lang.Class.forName(Class.java:169) at jdb.Test.main(Test.java:7) Thank you

    Read the article

  • How can I prevent external MSBuild files from being cached (by Visual Studio) during a project build

    - by Damian Powell
    I have a project in my solution which started life as a C# library project. It's got nothing of any interest in it in terms of code, it is merely used as a dependency in the other projects in my solution in order to ensure that it is built first. One of the side-effects of building this project is that a shared AssemblyInfo.cs is created which contains the version number in use by the other projects. I have done this by adding the following to the .csproj file: <ItemGroup> <None Include="Properties\AssemblyInfo.Shared.cs.in" /> <Compile Include="Properties\AssemblyInfo.Shared.cs" /> <None Include="VersionInfo.targets" /> </ItemGroup> <Import Project="$(ProjectDir)VersionInfo.targets" /> <Target Name="BeforeBuild" DependsOnTargets="UpdateSharedAssemblyInfo" /> The referenced file, VersionInfo.targets, contains the following: <Project ToolsVersion="4.0" DefaultTargets="Build" xmlns="http://schemas.microsoft.com/developer/msbuild/2003"> <PropertyGroup> <!-- Some properties defining tool locations and the name of the AssemblyInfo.Shared.cs.in file etc. --> </PropertyGroup> <Target Name="UpdateSharedAssemblyInfo"> <!-- Uses the Exec task to run one of the tools to generate AssemblyInfo.Shared.cs based on the location of AssemblyInfo.Shared.cs.in and some of the other properties. --> </Target> </Project> The contents of the VersionInfo.targets file could simply be embedded within the .csproj file but it is external because I am trying to turn all of this into a project template. I want the users of the template to be able to add the new project to the solution, edit the VersionInfo.targets file, and run the build. The problem is that modifying and saving the VersionInfo.targets file and rebuilding the solution has no effect - the project file uses the values from the .targets file as they were when the project was opened. Even unloading and reloading the project has no effect. In order to get the new values, I need to close Visual Studio and reopen it (or reload the solution). How can I set this up so that the configuration is external to the .csproj file and not cached between builds?

    Read the article

  • sharepoint: editing webpart caml

    - by Jack
    I added this code to my sharepoint content query web part, which is looking at an events list from my calender, .webpart file in order to only show recurring events within the next month and regular events within the next month. However, I can't get the web part imported and working. Also is there any way to replace <Month /> with a range like <Today:Today OffsetDays="30"/> except with valid code? Here is the code: <property name="QueryOverride" type="string"> <Where> <Or> <And> <Neq> <FieldRef Name="FRecurrence"/> <Value Type="Recurrance">1</Value> </Neq> <And> <Lt> <FieldRef Name="EventDate" Type="DateTime"/> <Value Type="DateTime"><Today OffsetDays="30"/></Value> </Lt> <Gt> <FieldRef Name="EventDate" Type="DateTime"/> <Value Type="DateTime"><Today /></Value> </Gt> </And> </And> <DataRangesOverlap> <FieldRef Name="EventDate" /> <FieldRef Name="EndDate" /> <FieldRef Name="RecirrenceId" /> <Value Type="DateTime"><Month /></Value> </DataRangesOverlap> </Or> </Where> </property> When I upload this I get "Unable to add selected web part(s). The file format is not valid" and when I add <![CDATA[ and ]]> I can import it but the query doesn't return anything. How can I get this to work?

    Read the article

  • Clojure vars and Java static methods

    - by j-g-faustus
    I'm a few days into learning Clojure and are having some teething problems, so I'm asking for advice. I'm trying to store a Java class in a Clojure var and call its static methods, but it doesn't work. Example: user=> (. java.lang.reflect.Modifier isPrivate 1) false user=> (def jmod java.lang.reflect.Modifier) #'user/jmod user=> (. jmod isPrivate 1) java.lang.IllegalArgumentException: No matching method found: isPrivate for class java.lang.Class (NO_SOURCE_FILE:0) at clojure.lang.Compiler.eval(Compiler.java:4543) From the exception it looks like the runtime expects a var to hold an object, so it calls .getClass() to get the class and looks up the method using reflection. In this case the var already holds a class, so .getClass() returns java.lang.Class and the method lookup obviously fails. Is there some way around this, other than writing my own macro? In the general case I'd like to have either an object or a class in a varible and call the appropriate methods on it - duck typing for static methods as well as for instance methods. In this specific case I'd just like a shorter name for java.lang.reflect.Modifier, an alias if you wish. I know about import, but looking for something more general, like the Clojure namespace alias but for Java classes. Are there other mechanisms for doing this? Edit: Maybe I'm just confused about the calling conventions here. I thought the Lisp (and by extension Clojure) model was to evaluate all arguments and call the first element in the list as a function. In this case (= jmod java.lang.reflect.Modifier) returns true, and (.getName jmod) and (.getName java.lang.reflect.Modifier) both return the same string. So the variable and the class name clearly evaluate to the same thing, but they still cannot be called in the same fashion. What's going on here? Edit 2 Answering my second question (what is happening here), the Clojure doc says that If the first operand is a symbol that resolves to a class name, the access is considered to be to a static member of the named class... Otherwise it is presumed to be an instance member http://clojure.org/java_interop under "The Dot special form" "Resolving to a class name" is apparently not the same as "evaluating to something that resolves to a class name", so what I am trying to do here is something the dot special form does not support.

    Read the article

  • Django: Grouping by Dates and Servers

    - by TheLizardKing
    So I am trying to emulate google app's status page: http://www.google.com/appsstatus#hl=en but for backups for our own servers. Instead of service names on the left it'll be server names but the dates and hopefully the pagination will be there too. My models look incredibly similar to this: from django.db import models STATUS_CHOICES = ( ('UN', 'Unknown'), ('NI', 'No Issue'), ('IS', 'Issue'), ('NR', 'Not Running'), ) class Server(models.Model): name = models.CharField(max_length=32) def __unicode__(self): return self.name class Backup(models.Model): server = models.ForeignKey(Server) created = models.DateField(auto_now_add=True) modified = models.DateTimeField(auto_now=True) status = models.CharField(max_length=2, choices=STATUS_CHOICES, default='UN') issue = models.TextField(blank=True) def __unicode__(self): return u'%s: %s' % (self.server, self.get_status_display()) My issue is that I am having a hell of a time displaying the information I need. Everyday a little after midnight a cron job will run and add a row for each server for that day, defaulting on status unknown (UN). My backups.html: {% extends "base.html" %} {% block content %} <table> <tr> <th>Name</th> {% for server in servers %} <th>{{ created }}</th> </tr> <tr> <td>{{ server.name }}</td> {% for backup in server.backup_set.all %} <td>{{ backup.get_status_display }}</td> {% endfor %} </tr> {% endfor %} </table> {% endblock content %} This actually works but I do not know how to get the dates to show. Obviously {{ created }} doesn't do anything but the servers don't have create dates. Backups do and because it's a cron job there should only be X number of rows with any particular date (depending on how many servers we are following for that day). Summary I want to create a table, X being server names, Y being dates starting at today while all the cells being the status of a backup. The above model and template should hopefully give you an idea what my thought process but I am willing to alter anything. Basically I am create a fancy excel spreadsheet.

    Read the article

  • Best way to run remote VBScript in ASP.net? WMI or PsExec?

    - by envinyater
    I am doing some research to find out the best and most efficient method for this. I will need to execute remote scripts on a number of Window Servers/Computers (while we are building them). I have a web application that is going to automate this task, I currently have my prototype working to use PsExec to execute remote scripts. This requires PsExec to be installed on the system. A colleague suggested I should use WMI for this. I did some research in WMI and I couldn't find what I'm looking for. I want to either upload the script to the server and execute it and read the results, or already have the script on the server and execute it and read the results. I would prefer the first option though! Which is more ideal, PsExec or WMI? For reference, this is my prototype PsExec code. This script is only executing a small script to get the Windows OS and Service Pack Info. Protected Sub windowsScript(ByVal COMPUTERNAME As String) ' Create an array to store VBScript results Dim winVariables(2) As String nameLabel.Text = Name.Text ' Use PsExec to execute remote scripts Dim Proc As New System.Diagnostics.Process ' Run PsExec locally Proc.StartInfo = New ProcessStartInfo("C:\Windows\psexec.exe") ' Pass in following arguments to PsExec Proc.StartInfo.Arguments = COMPUTERNAME & " -s cmd /C c:\systemInfo.vbs" Proc.StartInfo.RedirectStandardInput = True Proc.StartInfo.RedirectStandardOutput = True Proc.StartInfo.UseShellExecute = False Proc.Start() ' Pause for script to run System.Threading.Thread.Sleep(1500) Proc.Close() System.Threading.Thread.Sleep(2500) 'Allows the system a chance to finish with the process. Dim filePath As String = COMPUTERNAME & "\TTO\somefile.txt" 'Download file created by script on Remote system to local system My.Computer.Network.DownloadFile(filePath, "C:\somefile.txt") System.Threading.Thread.Sleep(1000) ' Pause so file gets downloaded ''Import data from text file into variables textRead("C:\somefile.txt", winVariables) WindowsOSLbl.Text = winVariables(0).ToString() SvcPckLbl.Text = winVariables(1).ToString() System.Threading.Thread.Sleep(1000) ' ''Delete the file on server - we don't need it anymore Dim Proc2 As New System.Diagnostics.Process Proc2.StartInfo = New ProcessStartInfo("C:\Windows\psexec.exe") Proc2.StartInfo.Arguments = COMPUTERNAME & " -s cmd /C del c:\somefile.txt" Proc2.StartInfo.RedirectStandardInput = True Proc2.StartInfo.RedirectStandardOutput = True Proc2.StartInfo.UseShellExecute = False Proc2.Start() System.Threading.Thread.Sleep(500) Proc2.Close() ' Delete file locally File.Delete("C:\somefile.txt") End Sub

    Read the article

  • Python File Search Line And Return Specific Number of Lines after Match

    - by Simos Anderson
    I have a text file that has lines representing some data sets. The file itself is fairly long but it contains certain sections of the following format: Series_Name INFO Number of teams : n1 | Team | # | wins | | TeamName1 | x | y | . . . | TeamNamen1 | numn | numn | Some Irrelevant lines Series_Name2 INFO Number of teams : n1 | Team | # | wins | | TeamName1 | num1 | num2 | . where each section has a header that begins with the Series_Name. Each Series_Name is different. The line with the header also includes the number of teams in that series, n1. Following the header line is a set of lines that represents a table of data. For each series there are n1+1 rows in the table, where each row shows an individual team name and associated stats. I have been trying to implement a function that will allow the user to search for a Team name and then print out the line in the table associated with that team. However, certain team names show up under multiple series. To resolve this, I am currently trying to write my code so that the user can search for the header line with series name first and then print out just the following n1+1 lines that represent the data associated with the series. Here's what I have come up with so far: import re print fname = raw_input("Enter filename: ") seriesname = raw_input("Enter series: ") def findcounter(fname, seriesname): logfile = open(fname, "r") pat = 'INFO Number of teams :' for line in logfile: if seriesname in line: if pat in line: s=line pattern = re.compile(r"""(?P<name>.*?) #starting name \s*INFO #whitespace and success \s*Number\s*of\s*teams #whitespace and strings \s*\:\s*(?P<n1>.*)""",re.VERBOSE) match = pattern.match(s) name = match.group("name") n1 = int(match.group("n1")) print name + " has " + str(n1) + " teams" lcount = 0 for line in logfile: if line.startswith(name): if pat in line: while lcount <= n1: s.append(line) lcount += 1 return result The first part of my code works; it matches the header line that the person searches for, parses the line, and then prints out how many teams are in that series. Since the header line basically tells me how many lines are in the table, I thought that I could use that information to construct a loop that would continue printing each line until a set counter reached n1. But I've tried running it, and I realize that the way I've set it up so far isn't correct. So here's my question: How do you return a number of lines after a matched line when given the number of desired lines that follow the match? I'm new to programming, and I apologize if this question seems silly. I have been working on this quite diligently with no luck and would appreciate any help.

    Read the article

  • Webservice proxy class generation

    - by kaivalya
    I include the below xsd file: <?xml version="1.0" encoding="utf-8"?> <xs:schema xmlns="http://www.xxxx.com/schemas/2005/06/messages" attributeFormDefault="unqualified" elementFormDefault="qualified" targetNamespace="http://www.xxxx.com/schemas/2005/06/messages" xmlns:xs="http://www.w3.org/2001/XMLSchema"> <xs:include schemaLocation="xxxxCommonTypes.xsd" /> <xs:element name="HotelDetailRQ"> <xs:annotation> <xs:documentation>Request data to obtain detailed information for the specified hotel product.</xs:documentation> </xs:annotation> <xs:complexType> <xs:complexContent mixed="false"> <xs:extension base="CoreRequest"> <xs:sequence> <xs:element name="HotelCode"> <xs:annotation> <xs:documentation>Hotel code to obtain detailed inormation.</xs:documentation> </xs:annotation> <xs:simpleType> <xs:restriction base="xs:string"> <xs:minLength value="1" /> <xs:maxLength value="10" /> </xs:restriction> </xs:simpleType> </xs:element> </xs:sequence> </xs:extension> </xs:complexContent> </xs:complexType> </xs:element> </xs:schema> to a wsdl file via; <xsd:schema xmlns="http://www.w3.org/2001/XMLSchema" targetNamespace="http://axis.frontend.hydra.xxxx.com"> <xsd:import schemaLocation="C:\Users\xxxx\HotelDetailRQ.xsd" namespace="http://www.xxxx.com/schemas/2005/06/messages" /> </xsd:schema> The problem is when I add the wsdl file to visual studio as a web reference, it does not generate the HotelDetailRQ proxy class in reference.cs file. So I am unable to use a generated HotelDetailRQ class. I am not experienced in using xsd files or wsdl files. Can you point me to where I might be making mistake here?

    Read the article

  • How to get started with testing(jMock)

    - by London
    Hello, I'm trying to learn how to write tests. I'm also learning Java, I was told I should learn/use/practice jMock, I've found some articles online that help to certain extend like : http://www.theserverside.com/news/1365050/Using-JMock-in-Test-Driven-Development http://jeantessier.com/SoftwareEngineering/Mocking.html#jMock And most articles I found was about test driven development, write tests first then write code to make the test pass. I'm not looking for that at the moment, I'm trying to write tests for already existing code with jMock. The official documentation is vague to say the least and just too hard for me. Does anybody have better way to learn this. Good books/links/tutorials would help me a lot. thank you EDIT - more concrete question : http://jeantessier.com/SoftwareEngineering/Mocking.html#jMock - from this article Tried this to mock this simple class : import java.util.Map; public class Cache { private Map<Integer, String> underlyingStorage; public Cache(Map<Integer, String> underlyingStorage) { this.underlyingStorage = underlyingStorage; } public String get(int key) { return underlyingStorage.get(key); } public void add(int key, String value) { underlyingStorage.put(key, value); } public void remove(int key) { underlyingStorage.remove(key); } public int size() { return underlyingStorage.size(); } public void clear() { underlyingStorage.clear(); } } Here is how I tried to create a test/mock : public class CacheTest extends TestCase { private Mockery context; private Map mockMap; private Cache cache; @Override @Before public void setUp() { context = new Mockery() { { setImposteriser(ClassImposteriser.INSTANCE); } }; mockMap = context.mock(Map.class); cache = new Cache(mockMap); } public void testCache() { context.checking(new Expectations() {{ atLeast(1).of(mockMap).size(); will(returnValue(int.class)); }}); } } It passes the test and basically does nothing, what I wanted is to create a map and check its size, and you know work some variations try to get a grip on this. Understand better trough examples, what else could I test here or any other exercises would help me a lot. tnx

    Read the article

  • POST parameters strangely parsed inside phantomjs

    - by user61629
    I am working with PHP/CURL and would like to send POST data to my phantomjs script, by setting the postfields array below: In my php controller I have: $data=array('first' => 'John', 'last' => 'Smith'); $url='http://localhost:7788/'; $output = $this->my_model->get_data($url,$data); In my php model I have: public function get_data($url,$postFieldArray) { $ch = curl_init(); curl_setopt($ch, CURLOPT_COOKIEJAR, $cookieFile); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, TRUE); curl_setopt($ch, CURLOPT_RETURNTRANSFER, TRUE); curl_setopt($ch, CURLOPT_USERAGENT, "Mozilla/4.0 (compatible; MSIE 7.0; Windows NT 6.0)"); curl_setopt($ch, CURLOPT_POST, TRUE); curl_setopt($ch, CURLOPT_POSTFIELDS, $postFieldArray); curl_setopt($ch, CURLOPT_URL, $url); $output = curl_exec($ch); In my phantomJS script that I am running locally I have: // import the webserver module, and create a server var server = require('webserver').create(); var port = require('system').env.PORT || 7788; console.log("Start Application"); console.log("Listen port " + port); // Create serever and listen port server.listen(port, function(request, response) { // Print some information Just for debbug console.log("We got some requset !!!"); console.log("request method: ", request.method); // request.method POST or GET if(request.method == 'POST' ){ console.log("POST params should be next: "); console.log("POST params: ",request.post); exit; } I first start and run the phantomjs script (myscript.js) from the command line, then I run my php script. The output is: $ phantomjs.exe myscript.js Start Application Listen port 7788 null We got some requset !!! request method: POST POST params should be next: POST params: ------------------------------e70d439800f9 Content-Disposition: form-data; name="first" John ------------------------------e70d439800f9 Content-Disposition: form-data; name="last" Smith ------------------------------e70d439800f9-- I'm confused about the the output. I was expecting something more like: first' => 'John', 'last' => 'Smith Can someone explain why it looks this way? How can I parse the request.post object to assign to variables inside myscript.js

    Read the article

  • Load a 6 MB binary file in a SQL Server 2005 VARBINARY(MAX) column using ADO/VC++?

    - by Feroz Khan
    How to load a binary file(.bin) of size 6 MB in a varbinary(MAX) column of SQL Server 2005 database using ADO in a VC++ application. This is the code I am using to load the file which I used to load a .bmp file: BOOL CSaveView::PutECGInDB(CString strFilePath, FieldPtr pFileData) { //Open File CFile fileImage; CFileStatus fileStatus; fileImage.Open(strFilePath,CFile::modeRead); fileImage.GetStatus(fileStatus); //Alocating memory for data ULONG nBytes = (ULONG)fileStatus.m_size; HGLOBAL hGlobal = GlobalAlloc(GPTR,nBytes); LPVOID lpData = GlobalLock(hGlobal); //Putting data into file fileImage.Read(lpData,nBytes); HRESULT hr; _variant_t varChunk; long lngOffset = 0; UCHAR chData; SAFEARRAY FAR *psa = NULL; SAFEARRAYBOUND rgsabound[1]; try { //Create a safe array to store the BYTES rgsabound[0].lLbound = 0; rgsabound[0].cElements = nBytes; psa = SafeArrayCreate(VT_UI1,1,rgsabound); while(lngOffset<(long)nBytes) { chData = ((UCHAR*)lpData)[lngOffset]; hr = SafeArrayPutElement(psa,&lngOffset,&chData); if(hr != S_OK) { return false; } lngOffset++; } lngOffset = 0; //Assign the safe array to a varient varChunk.vt = VT_ARRAY|VT_UI1; varChunk.parray = psa; hr = pFileData->AppendChunk(varChunk); if(hr != S_OK) { return false; } } catch(_com_error &e) { //get info from _com_error _bstr_t bstrSource(e.Source()); _bstr_t bstrDescription(e.Description()); _bstr_t bstrErrorMessage(e.ErrorMessage()); _bstr_t bstrErrorCode(e.Error()); TRACE("Exception thrown for classes generated by #import"); TRACE("\tCode= %08lx\n",(LPCSTR)bstrErrorCode); TRACE("\tCode Meaning = %s\n",(LPCSTR)bstrErrorMessage); TRACE("\tSource = %s\n",(LPCSTR)bstrSource); TRACE("\tDescription = %s\n",(LPCSTR)bstrDescription); } catch(...) { TRACE("***Unhandle Exception***"); } //Free Memory GlobalUnlock(lpData); return true; } But when I read the same file using Getchunk function it gives me all 0s but the size of the file I get is same as the one uploaded. Your help will be highly appreciated.

    Read the article

  • Best practices regarding equals: to overload or not to overload?

    - by polygenelubricants
    Consider the following snippet: import java.util.*; public class EqualsOverload { public static void main(String[] args) { class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } public boolean equals(Thing other) { return this.x == other.x; } } List<Thing> myThings = Arrays.asList(new Thing(42)); System.out.println(myThings.contains(new Thing(42))); // prints "false" } } Note that contains returns false!!! We seems to have lost our things!! The bug, of course, is the fact that we've accidentally overloaded, instead of overridden, Object.equals(Object). If we had written class Thing as follows instead, then contains returns true as expected. class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } @Override public boolean equals(Object o) { return (o instanceof Thing) && (this.x == ((Thing) o).x); } } Effective Java 2nd Edition, Item 36: Consistently use the Override annotation, uses essentially the same argument to recommend that @Override should be used consistently. This advice is good, of course, for if we had tried to declare @Override equals(Thing other) in the first snippet, our friendly little compiler would immediately point out our silly little mistake, since it's an overload, not an override. What the book doesn't specifically cover, however, is whether overloading equals is a good idea to begin with. Essentially, there are 3 situations: Overload only, no override -- ALMOST CERTAINLY WRONG! This is essentially the first snippet above Override only (no overload) -- one way to fix This is essentially the second snippet above Overload and override combo -- another way to fix The 3rd situation is illustrated by the following snippet: class Thing { final int x; Thing(int x) { this.x = x; } public int hashCode() { return x; } public boolean equals(Thing other) { return this.x == other.x; } @Override public boolean equals(Object o) { return (o instanceof Thing) && (this.equals((Thing) o)); } } Here, even though we now have 2 equals method, there is still one equality logic, and it's located in the overload. The @Override simply delegates to the overload. So the questions are: What are the pros and cons of "override only" vs "overload & override combo"? Is there a justification for overloading equals, or is this almost certainly a bad practice?

    Read the article

  • overwrite existing entity via bulkloader.Loader

    - by Ray Yun
    I was going to CSV based export/import for large data with app engine. My idea was just simple. First column of CSV would be key of entity. If it's not empty, that row means existing entity and should overwrite old one. Else, that row is new entity and should create new one. I could export key of entity by adding key property. class FrontExporter(bulkloader.Exporter): def __init__(self): bulkloader.Exporter.__init__(self, 'Front', [ ('__key__', str, None), ('name', str, None), ]) But when I was trying to upload CSV, it had failed because bulkloader.Loader.generate_key() was just for "key_name" not "key" itself. That means all exported entities in CSV should have unique 'key_name' if I want to modify-and-reupload them. class FrontLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'Front', [ ('_UNUSED', lambda x: None), ('name', lambda x: x.decode('utf-8')), ]) def generate_key(self,i,values): # first column is key keystr = values[0] if len(keystr)==0: return None return keystr I also tried to load key directly without using generate_key(), but both failed. class FrontLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'Front', [ ('Key', db.Key), # not working. just create new one. ('__key__', db.Key), # same... So, how can I overwrite existing entity which has no 'key_name'? It would be horrible if I should give unique name to all entities..... From the first answer, I could handle this problem. :) def create_entity(self, values, key_name=None, parent=None): # if key_name is None: # print 'key_name is None' # else: # print 'key_name=<',key_name,'> : length=',len(key_name) Validate(values, (list, tuple)) assert len(values) == len(self._Loader__properties), ( 'Expected %d columns, found %d.' % (len(self._Loader__properties), len(values))) model_class = GetImplementationClass(self.kind) properties = { 'key_name': key_name, 'parent': parent, } for (name, converter), val in zip(self._Loader__properties, values): if converter is bool and val.lower() in ('0', 'false', 'no'): val = False properties[name] = converter(val) if key_name is None: entity = model_class(**properties) #print 'create new one' else: entity = model_class.get(key_name) for key, value in properties.items(): setattr(entity, key, value) #print 'overwrite old one' entities = self.handle_entity(entity) if entities: if not isinstance(entities, (list, tuple)): entities = [entities] for entity in entities: if not isinstance(entity, db.Model): raise TypeError('Expected a db.Model, received %s (a %s).' % (entity, entity.__class__)) return entities def generate_key(self,i,values): # first column is key if values[0] is None or values[0] in ('',' ','-','.'): return None return values[0]

    Read the article

  • Can sorting Japanese kanji words be done programatically?

    - by Mason
    I've recently discovered, to my astonishment (having never really thought about it before), machine-sorting Japanese proper nouns is apparently not possible. I work on an application that must allow the user to select a hospital from a 3-menu interface. The first menu is Prefecture, the second is City Name, and the third is Hospital. Each menu should be sorted, as you might expect, so the user can find what they want in the menu. Let me outline what I have found, as preamble to my question: The expected sort order for Japanese words is based on their pronunciation. Kanji do not have an inherent order (there are tens of thousands of Kanji in use), but the Japanese phonetic syllabaries do have an order: ???????????????????... and on for the fifty traditional distinct sounds (a few of which are obsolete in modern Japanese). This sort order is called ???? (gojuu on jun , or '50-sound order'). Therefore, Kanji words should be sorted in the same order as they would be if they were written in hiragana. (You can represent any kanji word in phonetic hiragana in Japanese.) The kicker: there is no canonical way to determine the pronunciation of a given word written in kanji. You never know. Some kanji have ten or more different pronunciations, depending on the word. Many common words are in the dictionary, and I could probably hack together a way to look them up from one of the free dictionary databases, but proper nouns (e.g. hospital names) are not in the dictionary. So, in my application, I have a list of every prefecture, city, and hospital in Japan. In order to sort these lists, which is a requirement, I need a matching list of each of these names in phonetic form (kana). I can't come up with anything other than paying somebody fluent in Japanese (I'm only so-so) to manually transcribe them. Before I do so though: Is it possible that I am totally high on fire, and there actually is some way to do this sorting without creating my own mappings of kanji words to phonetic readings, that I have somehow overlooked? Is there a publicly available mapping of prefecture/city names, from the government or something? That would reduce the manual mapping I'd need to do to only hospital names. Does anybody have any other advice on how to approach this problem? Any programming language is fine--I'm working with Ruby on Rails but I would be delighted if I could just write a program that would take the kanji input (say 40,000 proper nouns) and then output the phonetic representations as data that I could import into my Rails app. ??????????

    Read the article

  • Can this be imporved? Scrubing of dangerous html tags.

    - by chobo2
    Hi I been finding that for something that I consider pretty import there is very little information or libraries on how to deal with this problem. I found this while searching. I really don't know all the million ways that a hacker could try to insert the dangerous tags. I have a rich html editor so I need to keep non dangerous tags but strip out bad ones. So is this script missing anything? It uses html agility pack. public string ScrubHTML(string html) { HtmlDocument doc = new HtmlDocument(); doc.LoadHtml(html); //Remove potentially harmful elements HtmlNodeCollection nc = doc.DocumentNode.SelectNodes("//script|//link|//iframe|//frameset|//frame|//applet|//object|//embed"); if (nc != null) { foreach (HtmlNode node in nc) { node.ParentNode.RemoveChild(node, false); } } //remove hrefs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("href", "#"); } } //remove img with refs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("src", "#"); } } //remove on<Event> handlers from all tags nc = doc.DocumentNode.SelectNodes("//*[@onclick or @onmouseover or @onfocus or @onblur or @onmouseout or @ondoubleclick or @onload or @onunload]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("onFocus"); node.Attributes.Remove("onBlur"); node.Attributes.Remove("onClick"); node.Attributes.Remove("onMouseOver"); node.Attributes.Remove("onMouseOut"); node.Attributes.Remove("onDoubleClick"); node.Attributes.Remove("onLoad"); node.Attributes.Remove("onUnload"); } } // remove any style attributes that contain the word expression (IE evaluates this as script) nc = doc.DocumentNode.SelectNodes("//*[contains(translate(@style, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'expression')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("stYle"); } } return doc.DocumentNode.WriteTo(); }

    Read the article

  • Write PEM encoded certificate in file - java

    - by user1349407
    Good day. I recently create X.509 certificate by using bouncy castle API. I need to save the certificate result rather than display the result. I tried to use FileOutputStream, but it does not work. regards the result is like follows -----BEGIN CERTIFICATE----- MIICeTCCAeKgAwIBAgIGATs8OWsXMA0GCSqGSIb3DQEBCwUAMBsxGTAXBgNVBAMT... -----END CERTIFICATE----- The code is belows import java.io.FileOutputStream; //example of a basic CA public class PKCS10CertCreateExample { public static X509Certificate[] buildChain() throws Exception { //create the certification request KeyPair pair = chapter7.Utils.generateRSAKeyPair(); PKCS10CertificationRequest request = PKCS10ExtensionExample.generateRequest(pair); //create a root certificate KeyPair rootPair=chapter7.Utils.generateRSAKeyPair(); X509Certificate rootCert = X509V1CreateExample.generateV1Certificate (rootPair); //validate the certification request if(!request.verify("BC")) { System.out.println("request failed to verify!"); System.exit(1); } //create the certificate using the information in the request X509V3CertificateGenerator certGen = new X509V3CertificateGenerator(); certGen.setSerialNumber(BigInteger.valueOf(System.currentTimeMillis())); certGen.setIssuerDN(rootCert.getSubjectX500Principal()); certGen.setNotBefore(new Date(System.currentTimeMillis())); certGen.setNotAfter(new Date(System.currentTimeMillis()+50000)); certGen.setSubjectDN(request.getCertificationRequestInfo().getSubject()); certGen.setPublicKey(request.getPublicKey("BC")); certGen.setSignatureAlgorithm("SHA256WithRSAEncryption"); certGen.addExtension(X509Extensions.AuthorityKeyIdentifier, false, new AuthorityKeyIdentifierStructure(rootCert)); certGen.addExtension(X509Extensions.SubjectKeyIdentifier, false, new SubjectKeyIdentifierStructure(request.getPublicKey("BC"))); certGen.addExtension(X509Extensions.BasicConstraints, true, new BasicConstraints(false)); //certGen.addExtension(X509Extensions.KeyUsage, true, new BasicConstraints(false)); certGen.addExtension(X509Extensions.KeyUsage, true, new KeyUsage(KeyUsage.digitalSignature | KeyUsage.keyEncipherment)); certGen.addExtension(X509Extensions.ExtendedKeyUsage, true, new ExtendedKeyUsage(KeyPurposeId.id_kp_serverAuth)); //extract the extension request attribute ASN1Set attributes = request.getCertificationRequestInfo().getAttributes(); for(int i=0;i!=attributes.size();i++) { Attribute attr = Attribute.getInstance(attributes.getObjectAt(i)); //process extension request if(attr.getAttrType().equals(PKCSObjectIdentifiers.pkcs_9_at_extensionRequest)) { X509Extensions extensions = X509Extensions.getInstance(attr.getAttrValues().getObjectAt(0)); Enumeration<?> e = extensions.oids(); while(e.hasMoreElements()) { DERObjectIdentifier oid = (DERObjectIdentifier)e.nextElement(); X509Extension ext = extensions.getExtension(oid); certGen.addExtension(oid, ext.isCritical(), ext.getValue().getOctets()); } } } X509Certificate issuedCert = certGen.generateX509Certificate(rootPair.getPrivate()); return new X509Certificate[]{issuedCert, rootCert}; } public static void main(String[] args) throws Exception { X509Certificate[] chain = buildChain(); PEMWriter pemWrt = new PEMWriter(new OutputStreamWriter(System.out)); pemWrt.writeObject(chain[0]); //pemWrt.writeObject(chain[1]); pemWrt.close(); //write it out //FileOutputStream fOut = new FileOutputStream("pkcs10req.req"); //fOut.write(chain[0].toString()); //fOut.write() //System.out.println(chain[0].toString()); //fOut.close(); } }

    Read the article

  • How do I solve "405 Method Not Allowed" for our subversion setup?

    - by macke
    We're serving our source code using VisualSVN running on Windows Server 2003. Recently, we split a portion of a project into a new project in it's own repository, and then linked it back to the original project using svn:externals. Since then, we've been having issues when we try to commit files with Subclipse. The error we're getting is: svn: Commit failed (details follow): svn: PROPFIND of '/svn': 405 Method Not Allowed (https://svn.ourserver.com) Googling for a while didn't really help, our config seems to be correct. It should also be noted that we've been running this server for a while no without these problems and apart from splitting the project into two repositories, no changes have been made to the server (ie, config files are the same). It should also be noted that these errors only appear when we try to check in multiple files at once. If we check in one file at a time there are no errors. Also, it only appears in Subclipse as far as we know right now, Versions.app (OS X) seems to work fine so that is our current workaround. So, the questions is how do I analyze the error to find the cause and subsequently fix it? I'm by no means a svn guru and right now I'm clueless. EDIT: It seems we can check in multiple files in the same package, but not files from multiple packages. Also, when I "split" the project into two repositories, I imported the original repository with a new name. I did not do a dump and then import that dump. Could that be the source of our issues, and if so, how would I solve that? EDIT: After some jerking around it seems as though it is indeed related to when checking in files in different repositories. If I try to do a single commit in both Repo A and Repo B (referenced by svn:externals) at the same time, I get the error. Versions.app handles this correctly, but I guess it might just be doing two commits, not a single one. Subclipse fails miserably. For now, we simply do multiple commits, one for Repo A and one for Repo B, that works just fine. If anyone smarter than me could fill in the details why this is happening, whether or not this kind of setup is stupid etc, please go right ahead.

    Read the article

  • Can this be improved? Scrubing of dangerous html tags.

    - by chobo2
    I been finding that for something that I consider pretty import there is very little information or libraries on how to deal with this problem. I found this while searching. I really don't know all the million ways that a hacker could try to insert the dangerous tags. I have a rich html editor so I need to keep non dangerous tags but strip out bad ones. So is this script missing anything? It uses html agility pack. public string ScrubHTML(string html) { HtmlDocument doc = new HtmlDocument(); doc.LoadHtml(html); //Remove potentially harmful elements HtmlNodeCollection nc = doc.DocumentNode.SelectNodes("//script|//link|//iframe|//frameset|//frame|//applet|//object|//embed"); if (nc != null) { foreach (HtmlNode node in nc) { node.ParentNode.RemoveChild(node, false); } } //remove hrefs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("href", "#"); } } //remove img with refs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("src", "#"); } } //remove on<Event> handlers from all tags nc = doc.DocumentNode.SelectNodes("//*[@onclick or @onmouseover or @onfocus or @onblur or @onmouseout or @ondoubleclick or @onload or @onunload]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("onFocus"); node.Attributes.Remove("onBlur"); node.Attributes.Remove("onClick"); node.Attributes.Remove("onMouseOver"); node.Attributes.Remove("onMouseOut"); node.Attributes.Remove("onDoubleClick"); node.Attributes.Remove("onLoad"); node.Attributes.Remove("onUnload"); } } // remove any style attributes that contain the word expression (IE evaluates this as script) nc = doc.DocumentNode.SelectNodes("//*[contains(translate(@style, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'expression')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("stYle"); } } return doc.DocumentNode.WriteTo(); }

    Read the article

  • How to access a field's value in an object using reflection

    - by kentcdodds
    My Question: How to overcome an IllegalAccessException to access the value of a an object's field using reflection. Expansion: I'm trying to learn about reflection to make some of my projects more generic. I'm running into an IllegalAccessException when trying to call field.getValue(object) to get the value of that field in that object. I can get the name and type just fine. If I change the declaration from private to public then this works fine. But in an effort to follow the "rules" of encapsulation I don't want to do this. Any help would be greatly appreciated! Thanks! My Code: package main; import java.lang.reflect.Field; public class Tester { public static void main(String args[]) throws Exception { new Tester().reflectionTest(); } public void reflectionTest() throws Exception { Person person = new Person("John Doe", "555-123-4567", "Rover"); Field[] fields = person.getClass().getDeclaredFields(); for (Field field : fields) { System.out.println("Field Name: " + field.getName()); System.out.println("Field Type: " + field.getType()); System.out.println("Field Value: " + field.get(person)); //The line above throws: Exception in thread "main" java.lang.IllegalAccessException: Class main.Tester can not access a member of class main.Tester$Person with modifiers "private final" } } public class Person { private final String name; private final String phoneNumber; private final String dogsName; public Person(String name, String phoneNumber, String dogsName) { this.name = name; this.phoneNumber = phoneNumber; this.dogsName = dogsName; } } } The Output: run: Field Name: name Field Type: class java.lang.String Exception in thread "main" java.lang.IllegalAccessException: Class main.Tester can not access a member of class main.Tester$Person with modifiers "private final" at sun.reflect.Reflection.ensureMemberAccess(Reflection.java:95) at java.lang.reflect.AccessibleObject.slowCheckMemberAccess(AccessibleObject.java:261) at java.lang.reflect.AccessibleObject.checkAccess(AccessibleObject.java:253) at java.lang.reflect.Field.doSecurityCheck(Field.java:983) at java.lang.reflect.Field.getFieldAccessor(Field.java:927) at java.lang.reflect.Field.get(Field.java:372) at main.Tester.reflectionTest(Tester.java:17) at main.Tester.main(Tester.java:8) Java Result: 1 BUILD SUCCESSFUL (total time: 0 seconds)

    Read the article

  • Getting instance crashes on IntelliJ IDEA with scala plugin.

    - by egervari
    I am building a scala web project using scala test, lift, jpa, hibernate, mercurial plugin, etc. I am getting instant crashes, where the ide just bombs, the window shuts down, and it gives no error messages whatsoever when I am doing any amount of copy/pasting of code. This started happening once my project got to about 100 unit tests. This problem is incredibly annoying, because when the crash happens, 30-60 seconds of activity is not saved. Even IDEA will forget which files were last opened and will forget where the cursor was, which makes it really hard to continue where you left off after the crash. A lot can happen in 60 seconds! Now, I've given up, because it seems like all sorts of things cause the IntelliJ IDEA to crash over and over. For example, if I were to copy and paste this code, to write a similar test for another collection type, it would crash shortly after: it should "cascade save and delete status messages" in { val statusMessage = new StatusMessage("message") var user = userDao.find(1).get user.addToStatusMessages(statusMessage) userDao.save(user) statusMessage.isPersistent should be (true) userDao.delete(user) statusMessageDao.find(statusMessage.id) should equal (None) } There is nothing special about this piece of code. It's code that is working just fine. However, IDEA bombs shortly after I paste something like this. For example, I might change StatusMessage to the new class I want to test cascading on... and then have to import that class into the test... and BOOM... it crashed. On windows 7, the IDEA window literally just minimizes and crashes with no warning. The next time I startup IDEA, it has no memory of what happened. Now, I've had this problem before. I posted it way back on IDEA's YouTrack. I was told to invalidate my caches. That never fixed it then, and it's not fixing it now. Please help. This error is fairly random, but it's happening constantly now. I could program for hours and not see it before... and the fact that my work just gets destroyed and I can't remember what I did during the last minute causes me to swear at my monitor at a db level higher than my stereo can go.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Python and displaying HTML

    - by Tyler Seymour
    I've gotten pretty comfortable with Python and now I'm looking to make a rudimentary web application. I was somewhat scared of Django and the other Python frameworks so I went caveman on it and decided to generate the HTML myself using another Python script. Maybe this is how you do it anyways - but I'm just figuring this stuff out. I'm really looking for a tip-off on, well, what to do next. My Python script PRINTS the HTML (is this even correct? I need it to be on a webpage!), but now what? Thanks for your continued support during my learning process. One day I will post answers! -Tyler Here's my code: from SearchPhone import SearchPhone phones = ["Iphone 3", "Iphone 4", "Iphone 5","Galaxy s3", "Galaxy s2", "LG Lucid", "LG Esteem", "HTC One S", "Droid 4", "Droid RAZR MAXX", "HTC EVO", "Galaxy Nexus", "LG Optimus 2", "LG Ignite", "Galaxy Note", "HTC Amaze", "HTC Rezound", "HTC Vivid", "HTC Rhyme", "Motorola Photon", "Motorola Milestone", "myTouch slide", "HTC Status", "Droid 3", "HTC Evo 3d", "HTC Wildfire", "LG Optimus 3d", "HTC ThunderBolt", "Incredible 2", "Kyocera Echo", "Galaxy S 4g", "HTC Inspire", "LG Optimus 2x", "Samsung Gem", "HTC Evo Shift", "Nexus S", "LG Axis", "Droid 2", "G2", "Droid x", "Droid Incredible" ] print """<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>table of phones</title> </head> <body> </body> </html> """ #table print '<table width="100%" border="1">' for x in phones: y = SearchPhone(x) print "\t<tr>" print "\t\t<td>" + str(y[0]) + "</td>" print "\t\t<td>" + str(y[1]) + "</td>" print "\t\t<td>" + str(y[2]) + "</td>" print "\t\t<td>" + str(y[3]) + "</td>" print "\t\t<td>" + str(y[4]) + "</td>" print "\t</tr>" print "</table>

    Read the article

  • UIScrollView does not scroll

    - by Preston Cheung
    I got a problem about UIScrollView. I am making a custom view which inherits UIView. The view has a UIScrollView on which there are lots of buttons which should scroll left and right. The UIScrollView and buttons can show normally. But I cannot scroll the buttons. Could someone give me some suggestions? Thanks a lot! MZMPhotoCalenderSwitcher.h #import <UIKit/UIKit.h> @interface MZMPhotoCalenderSwitcher : UIView <UIScrollViewDelegate> @property (strong, nonatomic) UIScrollView *topSwitcher; @end MZMPhotoCalenderSwitcher.m - (void)viewDidLoad { [super viewDidLoad]; // Do any additional setup after loading the view. self.topSwitcher = [[UIScrollView alloc] initWithFrame:CGRectMake(0, LABEL_HEIGHT + VIEW_Y, self.view.bounds.size.width, TOP_SWITCHER_HEIGHT)]; self.topSwitcher.backgroundColor = [UIColor greenColor]; self.topSwitcher.pagingEnabled = YES; self.topSwitcher.showsHorizontalScrollIndicator = NO; self.topSwitcher.showsVerticalScrollIndicator = NO; [self add:3 ButtonsOnView:self.topSwitcher withButtonWidth:44.8f andHeight:20.0f]; } - (void)add:(int)num ButtonsOnView:(UIScrollView *)view withButtonWidth:(CGFloat)width andHeight:(CGFloat)height { CGFloat totalTopSwitcherWidth = num * width; [view setContentSize:CGSizeMake(totalTopSwitcherWidth, view.bounds.size.height)]; CGFloat xOffset = 0.0f; for (int i=1; i<=num; i++) { UIButton *button = [UIButton buttonWithType:UIButtonTypeRoundedRect]; [button setFrame:CGRectMake(xOffset, 0, width, height)]; xOffset += width; [button setTitle:[NSString stringWithFormat:@"%d", i] forState:UIControlStateNormal]; button.titleLabel.font = [UIFont systemFontOfSize:10]; [button setTitleColor:[UIColor blueColor] forState:UIControlStateNormal]; [button setTitleColor:[UIColor blackColor] forState:UIControlStateSelected]; [button setTag:i]; [button addTarget:self action:@selector(buttonEvent) forControlEvents:UIControlEventTouchUpInside]; if (i % 2 == 0) [button setBackgroundColor:[UIColor yellowColor]]; else [button setBackgroundColor:[UIColor redColor]]; [view addSubview:button]; } }

    Read the article

< Previous Page | 344 345 346 347 348 349 350 351 352 353 354 355  | Next Page >