Search Results

Search found 11194 results on 448 pages for 'big friendly giant'.

Page 359/448 | < Previous Page | 355 356 357 358 359 360 361 362 363 364 365 366  | Next Page >

  • What are the limitations of the .NET Assembly format?

    - by McKAMEY
    We just ran into an interesting issue that I've not experienced before. We have a large scale production ASP.NET 3.5 SP1 Web App Project in Visual Studio 2008 SP1 which gets compiled and deployed using a Website Deployment Project. Everything has worked fine for the last year, until after a check-in yesterday the app started critically failing with BadImageFormatException. The check-in in question doesn't change anything particularly special and the errors are coming from areas of the app not even changed. Using Reflector we inspected the offending methods to find that there were garbage strings in the code (which Reflector humorously interpreted as Chinese characters). We have consistently reproduced this on several machines so it does not appear to be hardware related. Further inspection showed that those garbage strings did not exist in the Assemblies used as inputs to aspnet_merge.exe during deployment. Web Deployment Project Output Assemblies Properties: Merge all outputs to a single assembly Merge each individual folder output to its own assembly Merge all pages and control outputs to a single assembly Create a separate assembly for each page and control output In the web deployment project properties if we set the merge options to the first option ("Merge all outputs to a single assembly") we experience the issue, yet all of the other options work perfectly! So my question: does anyone know why this is happening? Is there a size-limit to aspnet_merge.exe's capabilities (the resulting merged DLL is around 19.3 MB)? Are there any other known issues with merging the output of WAPs? I would love it if any Assembly format / aspnet_merge gurus know about any such limitations like this. Seems to me like a 25MB Assembly, while big, isn't outrageous. Less disk to hit if it is all pregen'd stuff.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Alternative to array_shift function

    - by SoLoGHoST
    Ok, I need keys to be preserved within this array and I just want to shift the 1st element from this array. Actually I know that the first key of this array will always be 1 when I do this: // Sort it by 1st group and 1st layout. ksort($disabled_sections); foreach($disabled_sections as &$grouplayout) ksort($grouplayout); Basically I'd rather not have to ksort it in order to grab this array where the key = 1. And, honestly, I'm not a big fan of array_shift, it just takes to long IMO. Is there another way. Perhaps a way to extract the entire array where $disabled_sections[1] is found without having to do a foreach and sorting it, and array_shift. I just wanna add $disabled[1] to a different array and remove it from this array altogether. While keeping both arrays keys structured the way they are. Technically, it would even be fine to do this: $array = array(); $array = $disabled_sections[1]; But it needs to remove it from $disabled_sections. Can I use something like this approach... $array = array(); $array = $disabled_sections[1]; $disabled_sections -= $disabled_sections[1]; Is something like the above even possible?? Thanks.

    Read the article

  • Read a buffer of unknown size (Console input)

    - by Sanarothe
    Hi. I'm a little behind in my X86 Asm class, and the book is making me want to shoot myself in the face. The examples in the book are insufficient and, honestly, very frustrating because of their massive dependencies upon the author's link library, which I hate. I wanted to learn ASM, not how to call his freaking library, which calls more of his library. Anyway, I'm stuck on a lab that requires console input and output. So far, I've got this for my input: input PROC INVOKE ReadConsole, inputHandle, ADDR buffer, Buf - 2, ADDR bytesRead, 0 mov eax,OFFSET buffer Ret input EndP I need to use the input and output procedures multiple times, so I'm trying to make it abstract. I'm just not sure how to use the data that is set to eax here. My initial idea was to take that string array and manually crawl through it by adding 8 to the offset for each possible digit (Input is integer, and there's a little bit of processing) but this doesn't work out because I don't know how big the input actually is. So, how would you swap the string array into an integer that could be used? Full code: (Haven't done the integer logic or the instruction string output because I'm stuck here.) include c:/irvine/irvine32.inc .data inputHandle HANDLE ? outputHandle HANDLE ? buffer BYTE BufSize DUP(?),0,0 bytesRead DWORD ? str1 BYTE "Enter an integer:",0Dh, 0Ah str2 BYTE "Enter another integer:",0Dh, 0Ah str3 BYTE "The higher of the two integers is: " int1 WORD ? int2 WORD ? int3 WORD ? Buf = 80 .code main PROC call handle push str1 call output call input push str2 call output call input push str3 call output call input main EndP larger PROC Ret larger EndP output PROC INVOKE WriteConsole Ret output EndP handle PROC USES eax INVOKE GetStdHandle, STD_INPUT_HANDLE mov inputHandle,eax INVOKE GetStdHandle, STD_INPUT_HANDLE mov outputHandle,eax Ret handle EndP input PROC INVOKE ReadConsole, inputHandle, ADDR buffer, Buf - 2, ADDR bytesRead, 0 mov eax,OFFSET buffer Ret input EndP END main

    Read the article

  • detecting pauses in a spoken word audio file using pymad, pcm, vad, etc

    - by james
    First I am going to broadly state what I'm trying to do and ask for advice. Then I will explain my current approach and ask for answers to my current problems. Problem I have an MP3 file of a person speaking. I'd like to split it up into segments roughly corresponding to a sentence or phrase. (I'd do it manually, but we are talking hours of data.) If you have advice on how to do this programatically or for some existing utilities, I'd love to hear it. (I'm aware of voice activity detection and I've looked into it a bit, but I didn't see any freely available utilities.) Current Approach I thought the simplest thing would be to scan the MP3 at certain intervals and identify places where the average volume was below some threshold. Then I would use some existing utility to cut up the mp3 at those locations. I've been playing around with pymad and I believe that I've successfully extracted the PCM (pulse code modulation) data for each frame of the mp3. Now I am stuck because I can't really seem to wrap my head around how the PCM data translates to relative volume. I'm also aware of other complicating factors like multiple channels, big endian vs little, etc. Advice on how to map a group of pcm samples to relative volume would be key. Thanks!

    Read the article

  • Perl XML SAX parser emulating XML::Simple record for record

    - by DVK
    Short Q summary: I am looking a fast XML parser (most likely a wrapper around some standard SAX parser) which will produce per-record data structure 100% identical to those produced by XML::Simple. Details: We have a large code infrastructure which depends on processing records one-by-one and expects the record to be a data structure in a format produced by XML::Simple since it always used XML::Simple since early Jurassic era. An example simple XML is: <root> <rec><f1>v1</f1><f2>v2</f2></rec> <rec><f1>v1b</f1><f2>v2b</f2></rec> <rec><f1>v1c</f1><f2>v2c</f2></rec> </root> And example rough code is: sub process_record { my ($obj, $record_hash) = @_; # do_stuff } my $records = XML::Simple->XMLin(@args)->{root}; foreach my $record (@$records) { $obj->process_record($record) }; As everyone knows XML::Simple is, well, simple. And more importantly, it is very slow and a memory hog - due to being a DOM parser and needing to build/store 100% of data in memory. So, it's not the best tool for parsing an XML file consisting of large amount of small records record-by-record. However, re-writing the entire code (which consist of large amount of "process_record"-like methods) to work with standard SAX parser seems like an big task not worth the resources, even at the cost of living with XML::Simple. What I'm looking for is an existing module which will probably be based on a SAX parser (or anything fast with small memory footprint) which can be used to produce $record hashrefs one by one based on the XML pictured above that can be passed to $obj->process_record($record) and be 100% identical to what XML::Simple's hashrefs would have been.

    Read the article

  • java.net.SocketException: Software caused connection abort: recv failed; Causes and cures?

    - by IVR Avenger
    Hi, all. I've got an application running on Apache Tomcat 5.5 on a Win2k3 VM. The application serves up XML to be consumed by some telephony appliances as part of our IVR infrastructure. The application, in turn, receives its information from a handful of SOAP services. This morning, the SOAP services were timing out intermittently, causing all sorts of Exceptions. Once these stopped, I noticed that our application was still performing very slowly, in that it took it a long time to render and deliver pages. This sluggishness was noticed both on the appliances that consume the Tomcat output, and from a simple test of requesting some static documents from my web browser. Restarting Tomcat immediately resolved the issue. Cracking open the localhost log, I see a ton of these errors, right up until I restarted Tomcat: WARNING: Exception thrown whilst processing POSTed parameters java.net.SocketException: Software caused connection abort: recv failed After a big of Googling, my working theory is that the SOAP issue caused my users to get errors, which caused them to make more requests, which put an increased load on the application. This caused it to run out of available sockets to handle incoming requests. So, here's my quandary: 1. Is this a valid hypothesis, or am I just in over my head with HTTP and Tomcat? 2. If this is a valid hypothesis, is there a way to increase the size of the "socket queue", so that this doesn't happen in the future? Thanks! IVR Avenger

    Read the article

  • Creative ways to punish (or just curb) laziness in coworkers

    - by FerretallicA
    Like the subject suggests, what are some creative ways to curb laziness in co-workers? By laziness I'm talking about things like using variable names like "inttheemplrcd" instead of "intEmployerCode" or not keeping their projects synced with SVN, not just people who use the last of the sugar in the coffee room and don't refill the jar. So far the two most effective things I've done both involve the core library my company uses. Since most of our programs are in VB.net the lack of case sensitivity is abused a lot. I've got certain features of the library using Reflection to access data in the client apps, which has a negligible performance hit and introduces case sensitivity in a lot places where it is used. In instances where we have an agreed standard which is compromised by blatant laziness I take it a step further, like the DatabaseController class which will blatantly reject any DataTable passed to it which isn't named dtSomething (ie- must begin with dt and third letter must be capitalised). It's frustrating to have to resort to things like this but it has also gradually helped drill more attention to detail into their heads. Another is adding some code to the library's initialisation function to display a big and potentially embarrassing (only if seen by a client) message advising that the program is running in debug mode. We have had many instances where projects are sent to clients built in debug mode which has a lot of implications for us (especially with regard to error recovery) and doing that has made sure they always build to release before distributing. Any other creative (ie- not StyleCop etc) approaches like this?

    Read the article

  • Frame Showing Problem

    - by Nitz
    Hey Guys I have made one project which is showing the inventory of the stock of one store. In that inventory the software should store data of the products with their images. There is one problem... Bcz of the lots of stock, the screen on which is image is loading taking a lot of time. So, i thought i should give the frame in which there will be on label which will show the "Loading Software". But now when i am setting visible = true for that frame, but bcz of that images screen class loading problem my frame is not showing correctly. I have put screen shot, now my code. JFrame f; try{ f = new JFrame("This is a test"); f.setSize(300, 300); Container content = f.getContentPane(); content.setBackground(Color.white); content.setLayout(new FlowLayout()); JLabel jl = new JLabel(); jl.setText("Loading Please Wait...."); content.add(jl); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.setVisible(true); }catch(Exception e){ e.printStackTrace(); } initComponents(); try { addInverntory = new AddInventoryScreen(); showstock = new showStock(); // this class will take big time. mf = new mainForm(); f.setVisible(false); }catch (Exception ex) { ex.printStackTrace(); } How Can show some message that, other class is loading or "Loading Software" kind of thing in this situation. Just For the know....this class is not screen on which the image will load.

    Read the article

  • Where's the Win32 resource for the mouse cursor for dragging splitters?

    - by Luther Baker
    I am building a custom win32 control/widget and would like to change the cursor to a horizontal "splitter" symbol when hovering over a particular vertical line in the control. IE: I want to drag this vertical line (splitter bar) left and right (WEST and EAST). Of the the system cursors (OCR_*), the only cursor that makes sense is the OCR_SIZEWE. Unfortunately, that is the big, awkward cursor the system uses when resizing a window. Instead, I am looking for the cursor that is about 20 pixels tall and around 3 or 4 pixel wide with two small arrows pointing left and right. I can easily draw this and include it as a resource in my application but the cursor itself is so prevalent that I wanted to be sure it wasn't missing something. For example: when you use the COM drag and drop mechanism (CLSID_DragDropHelper, IDropTarget, etc) you implicitly have access to the "drag" icon (little box under the pointer). I didn't see an explicit OCR_* constant for this guy ... so likewise, if I can't find this splitter cursor outright, I am wondering if it is part of a COM object or something else in the win32 lib.

    Read the article

  • PHP/SQL/Wordpress: Group a user list by alphabet

    - by rayne
    I want to create a (fairly big) Wordpress user index with the users categorized alphabetically, like this: A Amy Adam B Bernard Bianca and so on. I've created a custom Wordpress query which works fine for this, except for one problem: It also displays "empty" letters, letters where there aren't any users whose name begins with that letter. I'd be glad if you could help me fix this code so that it only displays the letter if there's actually a user with a name of that letter :) I've tried my luck by checking how many results there are for that letter, but somehow that's not working. (FYI, I use the user photo plugin and only want to show users in the list who have an approved picture, hence the stuff in the SQL query). <?php $alphabet = range('A', 'Z'); foreach ($alphabet as $letter) { $user_count = $wpdb->get_results("SELECT COUNT(*) FROM wp_users WHERE display_name LIKE '".$letter."%' ORDER BY display_name ASC"); if ($user_count > 0) { $user_row = $wpdb->get_results("SELECT wp_users.user_login, wp_users.display_name FROM wp_users, wp_usermeta WHERE wp_users.display_name LIKE '".$letter."%' AND wp_usermeta.meta_key = 'userphoto_approvalstatus' AND wp_usermeta.meta_value = '2' AND wp_usermeta.user_id = wp_users.ID ORDER BY wp_users.display_name ASC"); echo '<li class="letter">'.$letter.''; echo '<ul>'; foreach ($user_row as $user) { echo '<li><a href="/author/'.$user->user_login.'">'.$user->display_name.'</a></li>'; } echo '</ul></li>'; } } ?> Thanks in advance!

    Read the article

  • django shopping cart as a beginner

    - by Jacques Knie
    Hi, i'm quite new to django and trying to add a shopping cart to a simple webshop. What I need is a simple cart that can be filled and presents its content, which is then sent to the vendor via email. So Satchmo might be too big for this task. Therefore i chose django-cart (http://code.google.com/p/django-cart/) which causes some problems now. 1. Is django-cart the right thing? Or are there any better approaches to this task? 2. As I am a beginner even django-cart makes me struggle. I used the view and the template of the django-cart-website, but writing a form that can be used to add products to the cart took me hours. I probably need help in understanding the general layout of a shopping cart and its integration into a website. 3. Two more specific questions: Is it possible to dynamically populate a formfield in a template (e.g. with {{ object.id }})? Is django-cart able to change (update) the contents of a cart? I hope it's not too many questions at once. Thanks in advance Jacques

    Read the article

  • SIMPLE PHP MVC Framework!

    - by Allen
    I need a simple and basic MVC example to get me started. I dont want to use any of the available packaged frameworks. I am in need of a simple example of a simple PHP MVC framework that would allow, at most, the basic creation of a simple multi-page site. I am asking for a simple example because I learn best from simple real world examples. Big popular frameworks (such as code ignighter) are to much for me to even try to understand and any other "simple" example I have found are not well explained or seem a little sketchy in general. I should add that most examples of simple MVC frameworks I see use mod_rewrite (for URL routing) or some other Apache-only method. I run PHP on IIS. I need to be able to understand a basic MVC framework, so that I could develop my own that would allow me to easily extend functionality with classes. I am at the point where I understand basic design patterns and MVC pretty well. I understand them in theory, but when it comes down to actually building a real world, simple, well designed MVC framework in PHP, i'm stuck. I would really appreciate some help! Edit: I just want to note that I am looking for a simple example that an experienced programmer could whip up in under an hour. I mean simple as in bare bones simple. I dont want to use any huge frameworks, I am trying to roll my own. I need a decent SIMPLE example to get me going.

    Read the article

  • structured vs. unstructured data in db

    - by Igor
    the question is one of design. i'm gathering a big chunk of performance data with lots of key-value pairs. pretty much everything in /proc/cpuinfo, /proc/meminfo/, /proc/loadavg, plus a bunch of other stuff, from several hundred hosts. right now, i just need to display the latest chunk of data in my UI. i will probably end up doing some analysis of the data gathered to figure out performance problems down the road, but this is a new application so i'm not sure what exactly i'm looking for performance-wise just yet. i could structure the data in the db -- have a column for each key i'm gathering. the table would end up being O(100) columns wide, it would be a pain to put into the db, i would have to add new columns if i start gathering a new stat. but it would be easy to sort/analyze the data just using SQL. or i could just dump my unstructured data blob into the table. maybe three columns -- host id, timestamp, and a serialized version of my array, probably using JSON in a TEXT field. which should I do? am i going to be sorry if i go with the unstructured approach? when doing analysis, should i just convert the fields i'm interested in and create a new, more structured table? what are the trade-offs i'm missing here?

    Read the article

  • Force creation of query execution plan

    - by Marc
    I have the following situation: .net 3.5 WinForm client app accessing SQL Server 2008 Some queries returning relatively big amount of data are used quite often by a form Users are using local SQL Express and restarting their machines at least daily Other users are working remotely over slow network connections The problem is that after a restart, the first time users open this form the queries are extremely slow and take more or less 15s on a fast machine to execute. Afterwards the same queries take only 3s. Of course this comes from the fact that no data is cached and must be loaded from disk first. My question: Would it be possible to force the loading of the required data in advance into SQL Server cache? Note My first idea was to execute the queries in a background worker when the application starts, so that when the user starts the form the queries will already be cached and execute fast directly. I however don't want to load the result of the queries over to the client as some users are working remotely or have otherwise slow networks. So I thought just executing the queries from a stored procedure and putting the results into temporary tables so that nothing would be returned. Turned out that some of the result sets are using dynamic columns so I couldn't create the corresponding temp tables and thus this isn't a solution. Do you happen to have any other idea?

    Read the article

  • WPF/SL EventAggregator implementation with durable subscribers behavior?

    - by sha1dy
    Hi. Currently I'm building an application using latest Prism for Silverlight 4. I've a module and in that module I've two views with view models. Also I've a module view with two regions for each view. In module initialization I'm registering my views and view models in Unity container and also register views with corresponding regions. The problem is that views should display something similar to table-detail information - first view shows available entities ans the second view shows detail of selected entity. I need a way how to pass them initial selected entity. Newly created first view doesn't have any selected entity and newly created second view doesn't show any details. Currently I'm doing that this way: In module I create two view models and register them as instances in Unity container and then I register views as types for corresponding regions. Each view subscribes to EntitySelectedEvent from EventAggregator. Module initializer publish this event after initialization and this way two views are selecting the same entity. I know this looks ugly - I tried publishing this event from one of view models but the problems is that EventAggregator in Prism doesn't support durable subscribers - this means that if the second view model didn't subscribe to event before the first view model fired it, it won't receive and event. I know this is a normal behavior of EventAggregator, but I'm looking for a solution when view models can fire events without depending on initialization order of them - that is the first model can fire event before the second model was created and the second model will receive this 'queued' event after subscribing to it. Are there any other messaging implementations for WPF/SL which do support such behavior or using a mediator (in my example it's a module itself) isn't such a bad idea after all? One big problem with mediator is that models must be created right away in initialize and they can't be registered as types in container because this leads again to missing subscribers.

    Read the article

  • LPX-00607 for ora:contains in java but not sqlplus

    - by Windle
    Hey all, I am trying to doing some sql querys out of Oracle 11g and am having issues using ora:contains. I am using spring's jdbc impl and my code generates the sql statement: select * from view_name where column_a = ? and column_b = ? and existsNode(xmltype(clob_column), 'record/name [ora:contains(text(), "name1") 0]', 'xmlns:ora="http://xmlns.oralce.com/xdb"') = 1 I have removed the actual view / column names obviously, but when I copy that into sqlplus and substitute in random values, the select executes properly. When I try to run it in my DAO code I get this stack trace: org.springframework.jdbc.UncatergorizedSQLException: PreparedStatementCallback; uncatergorizedSQLException for SQL [the big select above]; SQL state [99999]; error code [31011]; ORA-31011: XML parsing failed. ORA-19202: Error occured in XML processing LPX-00607: Invalid reference: 'contains' ;nested exception is java.sql.SQLException: ORA-31011: XML parsing failed ORA-19202: Error occured in XML processing LPX-00607: Invalid reference: 'contains' (continues on like this for awhile....) I think it is worth mentioning that I am using maven and it is possible I am missing some dependency that is required for this. Sorry the post is so long, but I wanted to err on the side of too much info. Thanks for taking the time to read this at least =) -Windle

    Read the article

  • Find TableLeyout in a thread (Because of the ProgressDialog)

    - by Shaulian
    Hi all, On my activity, im getting some big data from web, and while getting this data i want to show the user a ProgressDialog with spinning wheel. That i can do only with putting this code into a thread, right ? the problem is that after im getting this data i need to insert it into my tableLayout as TableRows and it seems impossible to access the TableLayout from the thread. What can i do to show this progress dialog and to be able access the table layout from the thread ?? Is there any event that happens on the end of the thread ? My code fails for : _tableLayout.addView(_tableRowVar, new TableLayout.LayoutParams( LayoutParams.FILL_PARENT, LayoutParams.FILL_PARENT)); My full code is : final ProgressDialog dialog = ProgressDialog.show(MyActivity.this, "", "Getting data.\nPlease wait...",true); new Thread() { public void run() { try { TableLayout _tableLayout; _tableLayout = (TableLayout)MyActivity.this.findViewById(R.id.tableLayoutID); List<String> data = getDataFromWeb(); // Get the data and bind it into the table publishTableLayoutWithTableRows(_tableLayout, data ); } catch (Exception e) { new AlertDialog.Builder(MyActivity.this) .setMessage(e.getMessage()) .show(); } dialog.dismiss(); } }.start();

    Read the article

  • rails best practices where to place unobtrusive javascript

    - by nathanvda
    Hi there, my rails applications (all 2.3.5) use a total mix of inline javascript, rjs, prototype and jquery. Let's call it learning or growing pains. Lately i have been more and more infatuated with unobtrusive javascript. It makes your html clean, in the same way css cleaned it up. But most examples i have seen are small examples, and they put all javascript(jquery) inside application.js Now i have a pretty big application, and i am thinking up ways to structure my js. I like somehow that my script is still close to the view, so i am thinking something like orders.html.erb orders.js where orders.js contains the unobtrusive javascript specific to that view. But maybe that's just me being too conservative :) I have read some posts by Yehuda Katz about this very problem here and here, where he tackles this problem. It will go through your js-files and only load those relevant to your view. But alas i can't find a current implementation. So my questions: how do you best structure your unobtrusive javascript; manage your code, how do you make sure that it is obvious from the html what something is supposed to do. I guess good class names go a long way :) how do you arrange your files, load them all in? just a few? do you use content_for :script or javascript_include_tag in your view to load the relevant scripts. Or ... ? do you write very generic functions (like a delete), with parameters (add extra attributes?), or do you write very specific functions (DRY?). I know in Rails 3 there is a standard set, and everything is unobtrusive there. But how to start in Rails 2.3.5? In short: what are the best practices for doing unobtrusive javascript in rails? :)

    Read the article

  • CQRS - The query side

    - by mattcodes
    A lot of the blogsphere articles related to CQRS (command query repsonsibility) seperation seem to imply that all screens/viewmodels are flat. e.g. Name, Age, Location Of Birth etc.. and thus the suggestion that implementation wise we stick them into fast read source etc.. single table per view mySQL etc.. and pull them out with something like primitive SqlDataReader, kick that nasty nhibernate ORM etc.. However, whilst I agree that domain models dont mapped well to most screens, many of the screens that I work with are more dimensional, and Im sure this is pretty common in LOB apps. So my question is how are people handling screen where by for example it displays a summary of customer details and then a list of their orders with a [more detail] link etc.... I thought about keeping with the straight forward SQL query to the Query Database breaking off the outer join so can build a suitable ViewModel to View but it seems like overkill? Alternatively (this is starting to feel yuck) in CustomerSummaryView table have a text/big (whatever the type is in your DB) column called Orders, and the columns for the Order summary screen grid are seperated by , and rows by |. Even with XML datatype it still feeel dirty. Any thoughts on an optimal practice?

    Read the article

  • Android Scaled Drawing to ImageView

    - by user329999
    Newbie question, so there's probably a simple answer to this problem. I'm drawing some simple shapes using canvas.drawCircle(), canvas.drawLine() etc. I originally copied the code from: http://developer.android.com/resources/samples/ApiDemos/src/com/example/android/apis/graphics/DrawPoints.html Which extends a View and draws directly to a canvas. It doesn't load a pre-drawn bitmap because I need my application to turn data into a drawing and the user will enter the data. My changes work, but the drawing is too small (or big) and doesn't fill the screen using all the available screen. Ideally I'd rather use something like an ImageView in .XML like so: If that's possible. The documentation seems to imply that I want to set the scaleType as shown in the above .XML which seems like the simple way to do this. If using an ImageView in .XML is a good idea, then I'm lost on how to draw to the ImageView and could use some guidance on doing that task. If that won't work, then I'll need to do some more thinking about how to get my drawing scaled on the screen and basically I'm lazy and would rather have Android do the work for me. Feel free to suggest some other way that's completely different is this is the wrong solution path. :) Thanks.

    Read the article

  • Hibernate: Dirty Checking and Only Update of Dirty Attributes?

    - by jens
    Hello Experts, in "good old JDBC days" I wrote a lot of SQL Queries that did very targeted updates of only the "attributes/members" that were actually changed: For Example having an object with the following members: public String name; public String address; public Date date; If only date was changed in some Business Method I would only issue an SQL UPDATE for the date member. ==It seems however (thats my "impression" of hibernate) that when working with a standard Hibernate mapping (mapping the full class), even updates of only one single member lead to a full update of the object in SQL Statements generated by Hibernate. My Questions are: 1.) Is this observation correct, that hibernate DOES NOT intelligently check (in a fully mapped class), what member(s) where changed and then only issue updates for the specific changed members, but rather always will update (in the generated SQL Update Statement) all mapped members (of a class), even if they were not changed (in case the object is dirty due to one member being dirty...) 2.) What can I do to make Hibernate only update those members, that have been changed? I am searching for a solution to have hibernate only update the member that actually changed. (I know hibernate does some big work on doing dirty-checking, but as far as I know this dirtychecking is only relevant to identify if the object as whole is dirty, not what single member is dirty.) Thank you very much! Jens

    Read the article

  • Seeking reporting or templating tool to generate large formatted PDF reports from dataset

    - by Mr. Tacos
    Say I have some data in MySQL or a big ole CSV file. I also have a report. It's a PDF, call it 100 pages long. I need to generate variations on this PDF for slices of the data. More specific example: I have a CSV file with each StackOverflow user in a row and each column contains various statistics about that user. I have a report called "Your StackOverflow Performance". Its got lots of text, always the same, but each section contains something like: "You Vs. The Average StackOverflow Poster on this metric". I want a table that appears there that has the average data, which is the same in every run of the PDF, in one column. In the second column, I want your data, which is different for each PDF/row in the CSV file/user of StackOverflow. I'm pretty sure people use things like Crystal for this? Is there something in MS SQL Server that's good for this? An open source template language? I'm not even really sure if what I need is called a 'reporting' tool (since I don't really need to do any crunching, the data in this case is being crunched by a series of scripts and SPSS, I don't need bands and subbands and so on) or 'templating'. Is there even such a thing as templating PDFs? Natch, I'd be fine with something that generates output easily scriptable to PDF, like eps, but not something like HTML. The report formatting is fussy and done and externally determined and handed down from on high. It's print-oriented, not webby. Thanks in advance.

    Read the article

  • Chrome troubles...

    - by GaVrA
    Take this site for example: http://pms.rs/contact Everything is just fine just by using this css for textarea: #kontakt input, #kontakt textarea{ width:250px; } #kontakt textarea{ height:150px; } But ofc chrome is always smarter and in it user can drag that bottom right corner of textarea and resize it to the size he likes. Call me control freak, but that is very dumb thing to have if no other browser is using that. On sites like this it is not a big deal, but somewhere it can cover the entire content and for me personaly, i like to limit as much as possible what user can do so he does not break my site(like for example adding too large images in posts on forums...). So i have to do something like this: #kontakt input, #kontakt textarea{ width:250px; } #kontakt textarea{ height:150px; max-height:150px; max-width:250px; } Just so i get chrome to play as all other browsers do... While i was typing this i realised that i really dont have any question per se, but i just thought to share this with SO public, so i will mark this as community wiki. Also some other things i noticed are inputs, i always have to put width for input or textarea just because chrome is always not rendering them as he should.

    Read the article

  • Suggest joomla html editor extension/software

    - by DMin
    I've started using Joomla 1.5 recently and am using the TinyMCE online WYSIWYG editor that comes with the package to edit articles. I tend to write direct html and javascript rather than use the WYSIWYG functions, I find that after the first time the changes are applied(page updated) most of your html becomes 4-5 separate big paragraphs. Its very hard to find stuff in there cause the content has no formatting -- eg: <p><span id="psy_ass_span" class="pink_heading">Psychometric Assessment</span></p> <div id="psy_ass_div" class="pink_box"><img class="img_right" src="templates/teamwork.jpg" border="0" /> <p><strong>Emporkommen</strong> uses <strong>Psychometric assessment</strong> as a tool in order to gain insight into a person’s personality and psychological thinking. It can help develop team spirit in t <script src="plugins/editors/tinymce/jscripts/tiny_mce/themes/advanced/langs/en.js" type="text/javascript"></script> he workplace and assess an individual’s priorities.</p> Plus obviously there is no code highlighting in the editor so you can't figure out what is what. My question is, do you guys know of good(preferably non-commercial) extensions or other softwares or techniques that can make editing html code in Joomla 1.5 articles easier even after applying changes several times.

    Read the article

< Previous Page | 355 356 357 358 359 360 361 362 363 364 365 366  | Next Page >