Search Results

Search found 11010 results on 441 pages for 'txt record'.

Page 365/441 | < Previous Page | 361 362 363 364 365 366 367 368 369 370 371 372  | Next Page >

  • WPF - expander Collapsed event being triggered by child controls with validation

    - by Shaboboo
    I have an expander that contains an ItemsControl. The items in the itemsControl are templated, some have textboxes in them, others have checkboxes. Both have bindings that cause validation. The styling and validation is working as expected. The problem is when I first expand the expander and cause a change to either control, the expander collapses again, this is not what I want. If I repeat this a second time this does not happen. I'm not sure what is triggering this strange behaviour. I've tried setting the focus to the itemsControl when the expander expands with no luck. What is differnt the second time it's expanded? Could it be the validation? Any Ideas? XAML: <Expander Header="{Binding SubSectionName}" Padding="0" > <ItemsControl ItemsSource="{Binding ConfigSubSectionSettings}" ItemTemplateSelector="{StaticResource Settings_Selector}" /> </Expander> <!-- Templates selected by the ItemTemplateSelector --> <DataTemplate x:Key="subSection_Bool"> <StackPanel Orientation="Horizontal"> <TextBlock x:Name="lbl" Text="{Binding SubSectionName}" > <CheckBox x:Name="chk" IsChecked="{Binding BoolValue, ValidatesOnDataErrors=True}" VerticalAlignment="Center" Margin="2" > </StackPanel > </DataTemplate> <DataTemplate x:Key="subSection_Text"> <StackPanel Orientation="Horizontal"> <TextBlock x:Name="lbl" Text="{Binding SubSectionName}" /> <TextBox x:Name="txt" VerticalAlignment="Center" Text="{Binding StringValue, ValidatesOnDataErrors=True}" /> </StackPanel> </DataTemplate>

    Read the article

  • Castle ActiveRecord / NHibernate Linq Querys with ValueTypes

    - by Thomas Schreiner
    Given the following code for our Active Record Entites and ValueTypes Linq is not working for us. [ActiveRecord("Person")] public class PersonEntity : ActiveRecordLinqBase<PersonEntity> { string _name; [Property("Name", Length = 20, ColumnType = "string", Access = PropertyAccess.FieldCamelcaseUnderscore)] public Name Name { get { return NameValue.Create(_name);} set { _name = value.DataBaseValue; } } ... } public abstract class Name : IValueType { string DataBaseValue {get;set;} ... } public class Namevalue : Name { string _name; private NameValue(string name) { _name = name; } public static NameValue Create(string name) { return new NameValue(name); } ... } We tried to use linq in the following way so far with no success: var result = from PersonEntity p in PersonEntity.Queryable where p.Name == "Thomas" select p; return result.First(); // throws exception Cannot convert string into Name We tried and implemented a TypeConverter for Name, but the converter never got called. Is there a way to have linq working with this ValueTypes? Update: Using NHibernate.UserTypes.IUserType it sortof works. I Implemented the Interface as described here: http://stackoverflow.com/questions/1565056/how-to-implement-correctly-iusertype I still had to add a ConversionOperator from string to Name and had to call it Explicitly in the linq Statement, even though it was defined as implicit. var result = from PersonEntity p in PersonEntity.Queryable where p.Name == (Name)"Thomas" select p; return result.First(); //Now works

    Read the article

  • Free solution for automatic updates with a .NET/C# app?

    - by a2h
    Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past I have looked into: WinSparkle - No in-app updates, and the DLL is 500 KB. My current solution is a few KBs in the executable and has no in-app updates. http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use wyUpdate - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto the last sentence. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle... EDIT: I came across SparkleDotNET just then. Looks good, though the DLL is 200 KB. Don't know if that's really that big of an issue, though.

    Read the article

  • PHP/MySQL Printing Duplicate Labels

    - by Michael
    Using an addon of FPDF, I am printing labels using PHP/MySQL (http://www.fpdf.de/downloads/addons/29/). I'd like to be able to have the user select how many labels to print. For example, if the query puts out 10 records and the user wants to print 3 labels for each record, it prints them all in one set. 1,1,1,2,2,2,3,3,3...etc. Any ideas? <?php require_once('auth.php'); require_once('../config.php'); require_once('../connect.php'); require('pdf/PDF_Label.php'); $sql="SELECT $tbl_members.lastname, $tbl_members.firstname, $tbl_members.username, $tbl_items.username, $tbl_items.itemname FROM $tbl_members, $tbl_items WHERE $tbl_members.username = $tbl_items.username"; $result=mysql_query($sql); if(mysql_num_rows($result) == 0){ echo "Your search criteria does not return any results, please try again."; exit(); } $pdf = new PDF_Label("5160"); $pdf->AddPage(); // Print labels while($rows=mysql_fetch_array($result)){ $name = $rows['lastname'].', '.$rows['firstname'; $item= $rows['itemname']; $text = sprintf(" * %s *\n %s\n", $name, $item); $pdf->Add_Label($text); } $pdf->Output('labels.pdf', 'D'); ?>

    Read the article

  • MS-Access: What could cause one form with a join query to load right and another not?

    - by Daniel Straight
    Form1 Form1 is bound to Table1. Table1 has an ID field. Form2 Form2 is bound to Table2 joined to Table1 on Table2.Table1_ID=Table1.ID Here is the SQL (generated by Access): SELECT Table2.*, Table1.[FirstFieldINeed], Table1.[SecondFieldINeed], Table1.[ThirdFieldINeed] FROM Table1 INNER JOIN Table2 ON Table1.ID = Table2.[Table1_ID]; Form2 is opened with this code in Form1: DoCmd.RunCommand acCmdSaveRecord DoCmd.OpenForm "Form2", , , , acFormAdd, , Me.[ID] DoCmd.Close acForm, "Form1", acSaveYes And when loaded runs: Me.[Table1_ID] = Me.OpenArgs When Form2 is loaded, fields bound to columns from Table1 show up correctly. Form3 Form3 is bound to Table3 joined to Table2 on Table3.Table2_ID=Table2.ID Here is the SQL (generated by Access): SELECT Table3.*, Table2.[FirstFieldINeed], Table2.[SecondFieldINeed] FROM Table2 INNER JOIN Table3 ON Table2.ID = Table3.[Table2_ID]; Form3 is opened with this code in Form2: DoCmd.RunCommand acCmdSaveRecord DoCmd.OpenForm "Form3", , , , acFormAdd, , Me.[ID] DoCmd.Close acForm, "Form2", acSaveYes And when loaded runs: Me.[Table2_ID] = Me.OpenArgs When Form3 is loaded, fields bound to columns from Table2 do not show up correctly. WHY? UPDATES I tried making the join query into a separate query and using that as my record source, but it made no difference at all. If I go to the query for Form3 and view it in datasheet view, I can see that the information that should be pulled into the form is there. It just isn't showing up on the form.

    Read the article

  • How to import data to SAP

    - by Mehmet AVSAR
    Hi, As a complete stranger in town of SAP, I want to transfer my own application's (mobile salesforce automation) data to SAP. My application has records of customers, stocks, inventory, invoices (and waybills), cheques, payments, collections, stock transfer data etc. I have an additional database which holds matchings of records. ie. A customer with ID 345 in my application has key 120-035-0223 in SAP. Every record, for sure, has to know it's counterpart, including parameters. After searching Google and SAP help site for a day, I covered that it's going to be a bit more pain than I expected. Especially SAP site does not give even a clue on it. Say I couldn't find. We transferred our data to some other ERP systems, some of which wanted XML files, some other exposed their APIs. My point is, is Sql Server's SSIS an option for me? I hope it is, so I can fight on my own territory. Since client requests would vary a lot, I count flexibility as most important criteria. Also, I want to transfer as much data as I could. Any help is appreciated. Regards,

    Read the article

  • Passing a LINQ DataRow Reference in a GridView's ItemTemplate

    - by Bob Kaufman
    Given the following GridView: <asp:GridView runat="server" ID="GridView1" AutoGenerateColumns="false" DataKeyNames="UniqueID" OnSelectedIndexChanging="GridView1_SelectedIndexChanging" > <Columns> <asp:BoundField HeaderText="Remarks" DataField="Remarks" /> <asp:TemplateField HeaderText="Listing"> <ItemTemplate> <%# ShowListingTitle( ( ( System.Data.DataRowView ) ( Container.DataItem ) ).Row ) %> </ItemTemplate> </asp:TemplateField> <asp:BoundField HeaderText="Amount" DataField="Amount" DataFormatString="{0:C}" /> </Columns> </asp:GridView> which refers to the following code-behind method: protected String ShowListingTitle( DataRow row ) { Listing listing = ( Listing ) row; return NicelyFormattedString( listing.field1, listing.field2, ... ); } The cast from DataRow to Listing is failing (cannot convert from DataRow to Listing) I'm certain the problem lies in what I'm passing from within the ItemTemplate, which is simply not the right reference to the current record from the LINQ to SQL data set that I've created, which looks like this: private void PopulateGrid() { using ( MyDataContext context = new MyDataContext() ) { IQueryable < Listing > listings = from l in context.Listings where l.AccountID == myAccountID select l; GridView1.DataSource = listings; GridView1.DataBind(); } }

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Selenium onChange not working

    - by tohop
    Hi, I have tried a number of things to try and get Selenium to pick up an 'onchange' event from a drop down menu, none of which has worked. The offending HTML is: <select onchange="doOpperation(this.options[this.selectedIndex]); this.selectedIndex = 0;" name="opps_ondemand" id="opps_ondemand"> <option value="none" id="ondemand">Mark as...</option> <option cmd="blah1" value="add">Something</option> <option cmd="blah2" value="remove">None</option> </select> I have read that Selenium IDE doesn't record some on* events, and so it would be wise to use fireEvent(): $this->click("opps_ondemand"); $this->select("opps_ondemand", "label=Mark as..."); $this->click("//option[@value='add']"); sleep(3); $this->fireEvent("//select[@id='opps_ondemand']", "change"); However, this does not work (with or without the fireEvent). I have also tried using $this->fireEvent("locator", "click"); instead of $this->click("locator"); but this did nothing. Selenium does not complain about these locators not existing so I am assuming it can see the select/option elements fine. The problem seems to be the onChange event. Does anyone know how to resolve this? Thanks.

    Read the article

  • Changing FileNames using RegEx and Recursion

    - by yeahumok
    Hello I'm trying to rename files that my program lists as having "illegal characters" for a SharePoint file importation. The illegal characters I am referring to are: ~ # % & * {} / \ | : < ? - "" What i'm trying to do is recurse through the drive, gather up a list of filenames and then through Regular Expressions, pick out file names from a List and try to replace the invalid characters in the actual filenames themselves. Anybody have any idea how to do this? So far i have this: (please remember, i'm a complete n00b to this stuff) class Program { static void Main(string[] args) { string[] files = Directory.GetFiles(@"C:\Documents and Settings\bob.smith\Desktop\~Test Folder for [SharePoint] %testing", "*.*", SearchOption.AllDirectories); foreach (string file in files) { Console.Write(file + "\r\n"); } Console.WriteLine("Press any key to continue..."); Console.ReadKey(true); string pattern = " *[\\~#%&*{}/:<>?|\"-]+ *"; string replacement = " "; Regex regEx = new Regex(pattern); string[] fileDrive = Directory.GetFiles(@"C:\Documents and Settings\bob.smith\Desktop\~Test Folder for [SharePoint] %testing", "*.*", SearchOption.AllDirectories); StreamWriter sw = new StreamWriter(@"C:\Documents and Settings\bob.smith\Desktop\~Test Folder for [SharePoint] %testing\File_Renames.txt"); foreach(string fileNames in fileDrive) { string sanitized = regEx.Replace(fileNames, replacement); sw.Write(sanitized + "\r\n"); } sw.Close(); } } So what i need to figure out is how to recursively search for these invalid chars, replace them in the actual filename itself. Anybody have any ideas?

    Read the article

  • Lotus Notes - Export emails to plain text file

    - by mbeckish
    I am setting up a Lotus Notes account to accept emails from a client, and automatically save each email as a plain text file to be processed by another application. So, I'm trying to create my very first Agent in Lotus to automatically export the emails to text. Is there a standard, best practices way to do this? I've created a LotusScript Agent that pretty much works. However, there is a bug - once the Body of the memo exceeds 32K characters, it starts inserting extra CR/LF pairs. I am using Lotus Notes 7.0.3. Here is my script: Sub Initialize On Error Goto ErrorCleanup Dim session As New NotesSession Dim db As NotesDatabase Dim doc As NotesDocument Dim uniqueID As Variant Dim curView As NotesView Dim docCount As Integer Dim notesInputFolder As String Dim notesValidOutputFolder As String Dim notesErrorOutputFolder As String Dim outputFolder As String Dim fileNum As Integer Dim bodyRichText As NotesRichTextItem Dim bodyUnformattedText As String Dim subjectText As NotesItem ''''''''''''''''''''''''''''''''''''''''''''''''''''''' 'INPUT OUTPUT LOCATIONS outputFolder = "\\PASCRIA\CignaDFS\CUser1\Home\mikebec\MyDocuments\" notesInputFolder = "IBEmails" notesValidOutputFolder = "IBEmailsDone" notesErrorOutputFolder="IBEmailsError" ''''''''''''''''''''''''''''''''''''''''''''''''''''''' Set db = session.CurrentDatabase Set curview = db.GetView(notesInputFolder ) docCount = curview.EntryCount Print "NUMBER OF DOCS " & docCount fileNum = 1 While (docCount > 0) 'set current doc to Set doc = curview.GetNthDocument(docCount) Set bodyRichText = doc.GetFirstItem( "Body" ) bodyUnformattedText = bodyRichText.GetUnformattedText() Set subjectText = doc.GetFirstItem("Subject") If subjectText.Text = "LotusAgentTest" Then uniqueID = Evaluate("@Unique") Open "\\PASCRIA\CignaDFS\CUser1\Home\mikebec\MyDocuments\email_" & uniqueID(0) & ".txt" For Output As fileNum Print #fileNum, "Subject:" & subjectText.Text Print #fileNum, "Date:" & Now Print #fileNum, bodyUnformattedText Close fileNum fileNum = fileNum + 1 Call doc.PutInFolder(notesValidOutputFolder) Call doc.RemoveFromFolder(notesInputFolder) End If doccount = doccount-1 Wend Exit Sub ErrorCleanup: Call sendErrorEmail(db,doc.GetItemValue("From")(0)) Call doc.PutInFolder(notesErrorOutputFolder) Call doc.RemoveFromFolder(notesInputFolder) End Sub Update Apparently the 32KB issue isn't consistent - so far, it's just one document that starts getting extra carriage returns after 32K.

    Read the article

  • symfony get data from array

    - by iggnition
    Hi, I'm trying to use an SQL query to get data from my database into the template of a symfony project. my query: SQL: SELECT l.loc_id AS l__loc_id, l.naam AS l__naam, l.straat AS l__straat, l.huisnummer AS l__huisnummer, l.plaats AS l__plaats, l.postcode AS l__postcode, l.telefoon AS l__telefoon, l.opmerking AS l__opmerking, o.org_id AS o__org_id, o.naam AS o__naam FROM locatie l LEFT JOIN organisatie o ON l.org_id = o.org_id This is generated by this DQL: DQL: $this->q = Doctrine_Query::create() ->select('l.naam, o.naam, l.straat, l.huisnummer, l.plaats, l.postcode, l.telefoon, l.opmerking') ->from('Locatie l') ->leftJoin('l.Organisatie o') ->execute(); But now when i try to acces this data in the template by either doing: <?php foreach ($q as $locatie): ?> <?php echo $locatie['o.naam'] ?> or <?php foreach ($q as $locatie): ?> <?php echo $locatie['o__naam'] ?> i get the error from symfony: 500 | Internal Server Error | Doctrine_Record_UnknownPropertyException Unknown record property / related component "o__naam" on "Locatie" Does anyone know what is going wrong here? i dont know how to call the value from the array if the names in both query's dont work.

    Read the article

  • Zend file upload error

    - by jgnasser
    I am attempting to upload a file using Zend Framework 1.8 and I get some errors. Here is the code snippet: The form element: $element = new Zend_Form_Element_File('doc'); $element->setLabel('Upload an image:') ->setDestination('/path/to/my/upload/folder'); $element->addValidator('Count', false, 1); $element->addValidator('Size', false, 102400); $element->addValidator('Extension', false, 'jpg,png,gif,doc,docx,xls,xlsx,txt'); $this->addElement($element); The code for handling the upload: $adapter = new Zend_File_Transfer_Adapter_Http(); if (!$adapter->receive()) { $messages = $adapter->getMessages(); echo implode("\n", $messages); } This works fine and the file is uploaded but I get the error "The file 'doc' was illegal uploaded, possible attack". I managed to get past this problem by not creating a new Zend_File_Transfer_Adapter_Http() but instead using: $adapter = $form->doc->getTransferAdapter(); With this modification, the first error disappears but now I have an error saying I have provided 2 files instead of one (probably its reading the temp) and when I adjust the validator to accept two files I then get the arror saying "The file 'doc' was not found" and the upload now fails completely. Please help

    Read the article

  • SharePoint 2007 and SiteMinder

    - by pborovik
    Here is a question regarding some details how SiteMinder secures access to the SharePoint 2007. I've read a bunch of materials regarding this and have some picture for SharePoint 2010 FBA claims-based + SiteMinder security (can be wrong here, of course): SiteMinder is registered as a trusted identity provider for the SharePoint; It means (to my mind) that SharePoint has no need to go into all those user directories like AD, RDBMS or whatever to create a record for user being granted access to SharePoint - instead it consumes a claims-based id supplied by SiteMinder SiteMinder checks all requests to SharePoint resources and starts login sequence via SiteMinder if does not find required headers in the request (SMSESSION, etc.) SiteMinder creates a GenericIdentity with the user login name if headers are OK, so SharePoint recognizes the user as authenticated But in the case of SharePoint 2007 with FBA + SiteMinder, I cannot find an answer for questions like: Does SharePoint need to go to all those user directories like AD to know something about users (as SiteMinder is not in charge of providing user info like claims-based ids)? So, SharePoint admin should configure SharePoint FBA to talk to these sources? Let's say I'm talking to a Web Service of SharePoint protected by SiteMinder. Shall I make a Authentication.asmx-Login call to create a authentication ticket or this schema is somehow changed by the SiteMinder? If such call is needed, do I also need a SiteMinder authentication sequence? What prevents me from rewriting request headers (say, manually in Fiddler) before posting request to the SharePoint protected by SiteMinder to override its defence? Pity, but I do not have access to deployed SiteMinder + SharePoint, so need to investigate some question blindly. Thanks.

    Read the article

  • How do I pass arguments to pages in a WPF application?

    - by Rod
    I'm working on upgrading a really old VB6 app to a WPF application. This will be a page-based app, but not a XBAP. The old VB6 app had a start form where a user would enter search criteria. Then they would get results in a grid, select a row in the grid and then click on one of 3 buttons. I am thinking that what I'll do is use hyperlink controls on the WPF app. No matter what button the user clicked on the old VB6 app, it would go to a second form. What it did on the second form was dependent upon which button the user clicked on the first form. So, I want the first page in my WPF app to do the same thing, but depending upon which hyperlink they click on will dictate what happens on the second page. They will either (a) go to the second page to edit the details as well as a lot more information, related to what they selected on the first page, or (b) enter a new record and all associated data (a new client, in this case), or (c) create a new case for the same client, selected on the first page. For me the hard thing is I don't know how to pass that information along to the second page. Is there something in WPF like in HTML where there's a query string? Or how do you get information from the first page to the second page, in WPF? I'm working in VS 2008.

    Read the article

  • SQL (mySQL) update some value in all records processed by a select

    - by jdmuys
    I am using mySQL from their C API, but that shouldn't be relevant. My code must process records from a table that match some criteria, and then update the said records to flag them as processed. The lines in the table are modified/inserted/deleted by another process I don't control. I am afraid in the following, the UPDATE might flag some records erroneously since the set of records matching might have changed between step 1 and step 3. SELECT * FROM myTable WHERE <CONDITION>; # step 1 <iterate over the selected set of lines. This may take some time.> # step 2 UPDATE myTable SET processed=1 WHERE <CONDITION> # step 3 What's the smart way to ensure that the UPDATE updates all the lines processed, and only them? A transaction doesn't seem to fit the bill as it doesn't provide isolation of that sort: a recently modified record not in the originally selected set might still be targeted by the UPDATE statement. For the same reason, SELECT ... FOR UPDATE doesn't seem to help, though it sounds promising :-) The only way I can see is to use a temporary table to memorize the set of rows to be processed, doing something like: CREATE TEMPORARY TABLE workOrder (jobId INT(11)); INSERT INTO workOrder SELECT myID as jobId FROM myTable WHERE <CONDITION>; SELECT * FROM myTable WHERE myID IN (SELECT * FROM workOrder); <iterate over the selected set of lines. This may take some time.> UPDATE myTable SET processed=1 WHERE myID IN (SELECT * FROM workOrder); DROP TABLE workOrder; But this seems wasteful and not very efficient. Is there anything smarter? Many thanks from a SQL newbie.

    Read the article

  • Authlogic Current User Question - hiding admin links...

    - by bgadoci
    I think I am missing something while using the Authlogic gem w/ Rails. To set the stage I have multiple users and each user can create posts and comments. Upon the display of a post or comment I would like to give the user who created them the option to edit or destroy. I am successfully using the following code to hide and show elements based on if a user is logged in or not but can't seem to find out how to only show these links to the actual user who created them...not any user that is logged in. <% if current_user %> <%= link_to 'Edit', edit_question_path(question) %> | <%= link_to 'Destroy', question, :confirm => 'Are you sure?', :method => :delete %> <% else %> <p>nothing to see here</p> <% end %> Here is the def of current_user located in the application controller in case I need to change something here. class ApplicationController < ActionController::Base helper :all # include all helpers, all the time protect_from_forgery # See ActionController::RequestForgeryProtection for details# helper_method :current_user private def current_user_session return @current_user_session if defined?(@current_user_session) @current_user_session = UserSession.find end def current_user return @current_user if defined?(@current_user) @current_user = current_user_session && current_user_session.record end end

    Read the article

  • Data from 6 ArrayLists into a single JTable - Java Swing

    - by Splunk
    I have created a JTable which is populated by various arraylists which get their data from a text list using a "~" to split. The issue I am having is that the table is displaying all data from the list on a single row. For example: Column1 Column2 Column2 Column2 Column3 Column4 1,2,3,4,5 1,2,3,4,5 1,2,3,4,5 1,2,3,4,5 1,2,3,4,5 1,2,3,4,5 When I want it to display Column1 Column2 Column2 Column2 Column3 Column4 1 1 1 1 1 1 2 2 2 2 2 2 3 3 3 3 3 3 You get the idea. From previous advice, I think the issue may be looping, but I am not sure. Any advice would be great. The code is below: private void table(){ String[] colName = { "Course", "Examiner", "Moderator", "Semester Available ", "Associated Programs", "Associated Majors"}; DefaultTableModel model = new DefaultTableModel(colName,0); for(Object item : courseList){ Object[] row = new Object[6]; // String[] row = new String[6]; row[0] = fileManage.getCourseList(); row[1] = fileManage.getNameList(); row[2] = fileManage.getModeratorList(); row[3] = fileManage.getSemesterList(); row[4] = fileManage.getProgramList(); row[5] = fileManage.getMajorList(); model.addRow(row); textArea = new JTable(model); } This is the class that has the arraylists: import java.io.File; import java.io.FileNotFoundException; import java.util.ArrayList; import java.util.Collections; import java.util.HashSet; import java.util.Scanner; public class FileIOManagement { private ArrayList<String> nameList = new ArrayList<String>(); private ArrayList<String> courseList = new ArrayList<String>(); private ArrayList<String> semesterList = new ArrayList<String>(); private ArrayList<String> moderatorList = new ArrayList<String>(); private ArrayList<String> programList = new ArrayList<String>(); private ArrayList<String> majorList = new ArrayList<String>(); public ArrayList<String> getNameList(){ return this.nameList; } public ArrayList<String> getCourseList(){ return this.courseList; } public ArrayList<String> getSemesterList(){ return this.semesterList; } public ArrayList<String> getModeratorList(){ return this.moderatorList; } public ArrayList<String> getProgramList(){ return this.programList; } public ArrayList<String> getMajorList(){ return this.majorList; } public void setNameList(ArrayList<String> nameList){ this.nameList = nameList; } public void setCourseList(ArrayList<String> courseList){ this.courseList = courseList; } public void setSemesterList(ArrayList<String> semesterList){ this.semesterList = semesterList; } public void setModeratorList(ArrayList<String> moderatorList){ this.moderatorList = moderatorList; } public void setProgramList(ArrayList<String> programList){ this.programList = programList; } public void setMajorList(ArrayList<String> majorList){ this.majorList = majorList; } public FileIOManagement(){ setNameList(new ArrayList<String>()); setCourseList(new ArrayList<String>()); setSemesterList(new ArrayList<String>()); setModeratorList(new ArrayList<String>()); setProgramList(new ArrayList<String>()); setMajorList(new ArrayList<String>()); readTextFile(); getNameList(); getCourseList(); } private void readTextFile(){ try{ Scanner scan = new Scanner(new File("Course.txt")); while(scan.hasNextLine()){ String line = scan.nextLine(); String[] tokens = line.split("~"); String course = tokens[0].trim(); String examiner = tokens[1].trim(); String moderator = tokens[2].trim(); String semester = tokens[3].trim(); String program = tokens[4].trim(); String major = tokens[5].trim(); courseList.add(course); semesterList.add(semester); nameList.add(examiner); moderatorList.add(moderator); programList.add(program); majorList.add(major); HashSet hs = new HashSet(); hs.addAll(nameList); nameList.clear(); nameList.addAll(hs); Collections.sort(nameList); } scan.close(); } catch (FileNotFoundException e){ e.printStackTrace(); } } } This is the class where I need to have the JTable: import java.awt.*; import javax.swing.*; import java.io.*; import javax.swing.border.EmptyBorder; import java.awt.event.ActionEvent; import java.awt.event.ActionListener; import java.util.ArrayList; import javax.swing.table.DefaultTableModel; public class AllDataGUI extends JFrame{ private JButton saveCloseBtn = new JButton("Save Changes and Close"); private JButton closeButton = new JButton("Exit Without Saving"); private JFrame frame=new JFrame("Viewing All Program Details"); private final FileIOManagement fileManage = new FileIOManagement(); private ArrayList<String> nameList = new ArrayList(); private ArrayList<String> courseList = new ArrayList(); private ArrayList<String> semesterList = new ArrayList(); private ArrayList<String> moderatorList = new ArrayList(); private ArrayList<String> majorList = new ArrayList(); private ArrayList<String> programList = new ArrayList(); private JTable textArea; public ArrayList<String> getNameList(){ return this.nameList; } public ArrayList<String> getCourseList(){ return this.courseList; } public ArrayList<String> getSemesterList(){ return this.semesterList; } public ArrayList<String> getModeratorList(){ return this.moderatorList; } public ArrayList<String> getProgramList(){ return this.programList; } public ArrayList<String> getMajorList(){ return this.majorList; } public void setNameList(ArrayList<String> nameList){ this.nameList = nameList; } public void setCourseList(ArrayList<String> courseList){ this.courseList = courseList; } public void setSemesterList(ArrayList<String> semesterList){ this.semesterList = semesterList; } public void setModeratorList(ArrayList<String> moderatorList){ this.moderatorList = moderatorList; } public void setProgramList(ArrayList<String> programList){ this.programList = programList; } public void setMajorList(ArrayList<String> majorList){ this.majorList = majorList; } public AllDataGUI(){ getData(); table(); panels(); } public Object getValueAt(int rowIndex, int columnIndex) { String[] token = nameList.get(rowIndex).split(","); return token[columnIndex]; } private void table(){ String[] colName = { "Course", "Examiner", "Moderator", "Semester Available ", "Associated Programs", "Associated Majors"}; DefaultTableModel model = new DefaultTableModel(colName,0); for(Object item : courseList){ Object[] row = new Object[6]; // String[] row = new String[6]; row[0] = fileManage.getCourseList(); row[1] = fileManage.getNameList(); row[2] = fileManage.getModeratorList(); row[3] = fileManage.getSemesterList(); row[4] = fileManage.getProgramList(); row[5] = fileManage.getMajorList(); model.addRow(row); textArea = new JTable(model); // String END_OF_LINE = ","; // // String[] colName = { "Course", "Examiner", "Moderator", "Semester Available ", "Associated Programs", "Associated Majors"}; //// textArea.getTableHeader().setBackground(Color.WHITE); //// textArea.getTableHeader().setForeground(Color.BLUE); // // Font Tablefont = new Font("Details", Font.BOLD, 12); // // textArea.getTableHeader().setFont(Tablefont); // Object[][] object = new Object[100][100]; // int i = 0; // if (fileManage.size() != 0) { // for (fileManage book : fileManage) { // object[i][0] = fileManage.getCourseList(); // object[i][1] = fileManage.getNameList(); // object[i][2] = fileManage.getModeratorList(); // object[i][3] = fileManage.getSemesterList(); // object[i][4] = fileManage.getProgramList(); // object[i][5] = fileManage.getMajorList(); // // textArea = new JTable(object, colName); // } // } } } public void getData(){ nameList = fileManage.getNameList(); courseList = fileManage.getCourseList(); semesterList = fileManage.getSemesterList(); moderatorList = fileManage.getModeratorList(); majorList = fileManage.getMajorList(); programList = fileManage.getProgramList(); // textArea.(write()); } private JButton getCloseButton(){ return closeButton; } private void panels(){ JPanel panel = new JPanel(new GridLayout(1,1)); panel.setBorder(new EmptyBorder(5, 5, 5, 5)); JPanel rightPanel = new JPanel(new GridLayout(15,0,10,10)); rightPanel.setBorder(new EmptyBorder(15, 5, 5, 10)); JScrollPane scrollBarForTextArea=new JScrollPane(textArea,JScrollPane.VERTICAL_SCROLLBAR_AS_NEEDED,JScrollPane.HORIZONTAL_SCROLLBAR_AS_NEEDED); panel.add(scrollBarForTextArea); frame.add(panel); frame.getContentPane().add(rightPanel,BorderLayout.EAST); rightPanel.add(saveCloseBtn); rightPanel.add(closeButton); closeButton.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent e) { frame.dispose(); } }); saveCloseBtn.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent e) { //saveBtn(); frame.dispose(); } }); frame.setSize(1000, 700); frame.setVisible(true); frame.setLocationRelativeTo(null); } // private void saveBtn(){ // File file = null; // FileWriter out=null; // try { // file = new File("Course.txt"); // out = new FileWriter(file); // out.write(textArea.getText()); // out.close(); // } catch (FileNotFoundException e) { // e.printStackTrace(); // } catch (IOException e) { // e.printStackTrace(); // } // JOptionPane.showMessageDialog(this, "File Successfully Updated"); // // } }

    Read the article

  • CodeDom : compile partial class

    - by James
    I'm attempting to compile code in a text file to change a value in a TextBox on the main form of a WinForms application. Ie. add another partial class with method to the calling form. The form has one button (button1) and one TextBox (textBox1). The code in the text file is: this.textBox1.Text = "Hello World!!"; And the code: namespace WinFormCodeCompile { public partial class Form1 : Form { public Form1() { InitializeComponent(); } private void button1_Click(object sender, EventArgs e) { // Load code from file StreamReader sReader = new StreamReader(@"Code.txt"); string input = sReader.ReadToEnd(); sReader.Close(); // Code literal string code = @"using System; using System.Windows.Forms; namespace WinFormCodeCompile { public partial class Form1 : Form { public void UpdateText() {" + input + @" } } }"; // Compile code CSharpCodeProvider cProv = new CSharpCodeProvider(); CompilerParameters cParams = new CompilerParameters(); cParams.ReferencedAssemblies.Add("mscorlib.dll"); cParams.ReferencedAssemblies.Add("System.dll"); cParams.ReferencedAssemblies.Add("System.Windows.Forms.dll"); cParams.GenerateExecutable = false; cParams.GenerateInMemory = true; CompilerResults cResults = cProv.CompileAssemblyFromSource(cParams, code); // Check for errors if (cResults.Errors.Count != 0) { foreach (var er in cResults.Errors) { MessageBox.Show(er.ToString()); } } else { // Attempt to execute method. object obj = cResults.CompiledAssembly.CreateInstance("WinFormCodeCompile.Form1"); Type t = obj.GetType(); t.InvokeMember("UpdateText", BindingFlags.InvokeMethod, null, obj, null); } } } } When I compile the code, the CompilerResults returns an error that says WinFormCodeCompile.Form1 does not contain a definition for textBox1. Is there a way to dynamically create another partial class file to the calling assembly and execute that code? I assume I'm missing something really simple here.

    Read the article

  • Cross domain login - what to store in the database?

    - by Jenkz
    I'm working on a system which will allow me to login to the same system via various domains. (www.example.com, www.mydomain.com, sub.domain.com etc) The following threads form the basis of my research so far: Single Sign On across multiple domains Cross web domain login with .net membership What I want to happen is that If I am logged in on the master domain and I visit a page on a client domain to be automatically logged in on the client. Obviously If I am not logged in on the master, I will need to enter my username and password. Walkthrough: 1. User logs in on master site 2. User navigates to client site 3. Client site re-directs to master site to see if User is logged in. 4. If User is logged in on master, record a RFC 4122 token ID and send this back to the client site. 5. Client site then looks up the token ID in the central database and logs this user in. This might eventually end up running on more than once instance of PHP and Apache, so I can't just store: token_id, php_session_id, created Is there any problem with me storing and using this: token_id, username, hashed_password, created Which is deleted on use, or automatically after x seconds.

    Read the article

  • when does factory girl create objects in db?

    - by Pavel K.
    i am trying to simulate a session using factory girl/shoulda (it worked with fixtures but i am having problems with using factories). i have following factories (user login and email both have 'unique' validations): Factory.define :user do |u| u.login 'quentin' u.email '[email protected]' end Factory.define :session_user, :class => Session do |u| u.association :user, :factory => :user u.session_id 'session_user' end and here's the test class MessagesControllerTest < ActionController::TestCase context "normal user" do setup do @request.session[:user_id]=Factory(:user).id @request.session[:session_id]=Factory(:session_user).session_id end should "be able to access new message creation" do get :new assert_response :success end end end but when i run "rake test:functionals", i get this test result 1) Error: test: normal user should be able to access new message creation. (MessagesControllerTest): ActiveRecord::RecordInvalid: Validation failed: Account name already exists!, Email already exists! which means that record already exists in db when i am referring to it in test setup. is there something i don't understand here? does factory girl create all factories in db on startup? rails 2.3.5/shoulda/factory girl

    Read the article

  • LPX-00607 for ora:contains in java but not sqlplus

    - by Windle
    Hey all, I am trying to doing some sql querys out of Oracle 11g and am having issues using ora:contains. I am using spring's jdbc impl and my code generates the sql statement: select * from view_name where column_a = ? and column_b = ? and existsNode(xmltype(clob_column), 'record/name [ora:contains(text(), "name1") 0]', 'xmlns:ora="http://xmlns.oralce.com/xdb"') = 1 I have removed the actual view / column names obviously, but when I copy that into sqlplus and substitute in random values, the select executes properly. When I try to run it in my DAO code I get this stack trace: org.springframework.jdbc.UncatergorizedSQLException: PreparedStatementCallback; uncatergorizedSQLException for SQL [the big select above]; SQL state [99999]; error code [31011]; ORA-31011: XML parsing failed. ORA-19202: Error occured in XML processing LPX-00607: Invalid reference: 'contains' ;nested exception is java.sql.SQLException: ORA-31011: XML parsing failed ORA-19202: Error occured in XML processing LPX-00607: Invalid reference: 'contains' (continues on like this for awhile....) I think it is worth mentioning that I am using maven and it is possible I am missing some dependency that is required for this. Sorry the post is so long, but I wanted to err on the side of too much info. Thanks for taking the time to read this at least =) -Windle

    Read the article

  • delayed evaluation of code in subroutines - 5.8 vs. 5.10 and 5.12

    - by Brock
    This bit of code behaves differently under perl 5.8 than it does under perl 5.12: my $badcode = sub { 1 / 0 }; print "Made it past the bad code.\n"; [brock@chase tmp]$ /usr/bin/perl -v This is perl, v5.8.8 built for i486-linux-gnu-thread-multi [brock@chase tmp]$ /usr/bin/perl badcode.pl Illegal division by zero at badcode.pl line 1. [brock@chase tmp]$ /usr/local/bin/perl -v This is perl 5, version 12, subversion 0 (v5.12.0) built for i686-linux [brock@chase tmp]$ /usr/local/bin/perl badcode.pl Made it past the bad code. Under perl 5.10.1, it behaves as it does under 5.12: brock@laptop:/var/tmp$ perl -v This is perl, v5.10.1 (*) built for i486-linux-gnu-thread-multi brock@laptop:/var/tmp$ perl badcode.pl Made it past the bad code. I get the same results with a named subroutine, e.g. sub badcode { 1 / 0 } I don't see anything about this in the perl5100delta pod. Is this an undocumented change? A unintended side effect of some other change? (For the record, I think 5.10 and 5.12 are doing the Right Thing.)

    Read the article

  • multiple keys and values with google-collections

    - by flash3000
    Hello, I would like use google-collection in order to save the following file in a Hash with multiple keys and values Key1_1, Key2_1, Key3_1, data1_1, 0, 0 Key1_2, Key2_2, Key3_2, data1_2, 0, 0 Key1_3, Key2_3, Key3_3, data1_3, 0, 0 Key1_4, Key2_4, Key3_4, data1_4, 0, 0 The first three columns are the different keys and the last two integer are the two different values. I have already prepare a code which spilt the lines in chunks. import java.io.BufferedReader; import java.io.FileNotFoundException; import java.io.FileReader; import java.io.IOException; public class HashMapKey { public static void main(String[] args) throws FileNotFoundException, IOException { String inputFile = "inputData.txt"; BufferedReader br = new BufferedReader(new FileReader(inputFile)); String strLine; while ((strLine = br.readLine()) != null) { String[] line = strLine.replaceAll(" ", "").trim().split(","); for (int i = 0; i < line.length; i++) { System.out.print("[" + line[i] + "]"); } System.out.println(); } } } Unfortunately, I do not know how to save these information in google-collection? Thank you in advance. Best regards,

    Read the article

  • Program Structure Design Tools? (Top Down Design)

    - by Lee Olayvar
    I have been looking to expand my methodologies to better involve Unit testing, and i stumbled upon Behavioral Driven Design (Namely Cucumber, and a few others). I am quite intrigued by the concept as i have never been able to properly design top down, only because keeping track of the design gets lost without a decent way to record it. So on that note, in a mostly language agnostic way, are there any useful tools out there i am (probably) unaware of? Eg, i have often been tempted to try building flow charts for my programs, but i am not sure how much that will help, and it seems a bit confusing to me how i could make a complex enough flow chart to handle the logic of a full program, and all its features.. ie, it just seems like flow charts would be limiting in the design scheme.. or possibly grow to an unmaintainable scale. BDD methods are nice, but with a system that is so tied to structure, tying into the language and unit testing seems like a must (for it to be worth it) and it seems to be hard to find something to work well with both Python and Java (my two main languages). So anyway.. on that note, any comments are much appreciated. I have searched around on here and it seems like top down design is a well discussed topic, but i haven't seen too much reference to tools themselves, eg, flow chart programs, etc. I am on Linux, if it matters (in the case of programs).

    Read the article

< Previous Page | 361 362 363 364 365 366 367 368 369 370 371 372  | Next Page >