Search Results

Search found 13683 results on 548 pages for 'python sphinx'.

Page 371/548 | < Previous Page | 367 368 369 370 371 372 373 374 375 376 377 378  | Next Page >

  • Simple pygtk and threads example please.

    - by wtzolt
    Hello, Can someone give me a simple example involving threads in this manner, please. Problem with my code is that when I click button One, GUI freezes until its finished. I want buttons to stay responsive when def is being executed. How can i fix that? class fun: wTree = None def __init__( self ): self.wTree = gtk.glade.XML( "ui.glade" ) dic = { "on_buttonOne" : self.one, "on_buttonTwo" : self.two, } self.wTree.signal_autoconnect( dic ) gtk.main() def sone(self, widget): time.sleep(1) print "1" time.sleep(1) print "2" time.sleep(1) print "3" def stwo(self, widget): time.sleep(1) print "4" time.sleep(1) print "5" time.sleep(1) print "6" do=fun() Pretty please, help me.

    Read the article

  • Returning Database Blobs in TurboGears 2.x / FCGI / Lighttpd extremely slow

    - by Tom
    Hey everyone, I am running a TG2 App on lighttpd via flup/fastcgi. We are reading images (~30kb each) from BlobFields in a MySQL database and return those images with a custom mime type via a controller method. Caching these images on the hard disk makes no sense because they change with every request, the only reason we cache these in the DB is that creating these images is quite expensive and the data used to create the images is also present in plain text on the website. Now to the problem itself: When returning such an image, things get extremely slow. The code runs totally fine on paster itself with no visible delay, but as soon as its running via fcgi/lighttpd the described phenomenon happens. I profiled the method of my controller that returns my blob, and the entire method runs in a few miliseconds, but when "return" executes, the entire app hangs for roughly 10 seconds. We could not reproduce the same error with PHP on FCGI. This only seems to happen with Turbogears or Pylons. Here for your consideration the concerned piece of source code: @expose(content_type=CUSTOM_CONTENT_TYPE) def return_img(self, img_id): """ Return a DB persisted image when requested """ img = model.Images.by_id(img_id) #get image from DB response.headers['content-type'] = 'image/png' return img.data # this causes the app to hang for 10 seconds

    Read the article

  • How can I lookup an attribute in any scope by name?

    - by Wai Yip Tung
    How can I lookup an attribute in any scope by name? My first trial is to use globals() and locals(). e.g. >>> def foo(name): ... a=1 ... print globals().get(name), locals().get(name) ... >>> foo('a') None 1 >>> b=1 >>> foo('b') 1 None >>> foo('foo') <function foo at 0x014744B0> None So far so good. However it fails to lookup any built-in names. >>> range <built-in function range> >>> foo('range') None None >>> int <type 'int'> >>> foo('int') None None Any idea on how to lookup built-in attributes?

    Read the article

  • twisted reactor stops too early

    - by pygabriel
    I'm doing a batch script to connect to a tcp server and then exiting. My problem is that I can't stop the reactor, for example: cmd = raw_input("Command: ") # custom factory, the protocol just send a line reactor.connectTCP(HOST,PORT, CommandClientFactory(cmd) d = defer.Deferred() d.addCallback(lambda x: reactor.stop()) reactor.callWhenRunning(d.callback,None) reactor.run() In this code the reactor stops before that the tcp connection is done and the cmd is passed. How can I stop the reactor after that all the operation are finished?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • How to build a Django form which requires a delay to be re-submitted ?

    - by pierre-guillaume-degans
    Hey, In order to avoid spamming, I would like to add a waiting time to re-submit a form (i.e. the user should wait a few seconds to submit the form, except the first time that this form is submitted). To do that, I added a timestamp to my form (and a security_hash field containing the timestamp plus the settings.SECRET_KEY which ensures that the timestamp is not fiddled with). This look like: class MyForm(forms.Form): timestamp = forms.IntegerField(widget=forms.HiddenInput) security_hash = forms.CharField(min_length=40, max_length=40, widget=forms.HiddenInput) # + some other fields.. # + methods to build the hash and to clean the timestamp... # (it is based on django.contrib.comments.forms.CommentSecurityForm) def clean_timestamp(self): """Make sure the delay is over (5 seconds).""" ts = self.cleaned_data["timestamp"] if not time.time() - ts > 5: raise forms.ValidationError("Timestamp check failed") return ts # etc... This works fine. However there is still an issue: the timestamp is checked the first time the form is submitted by the user, and I need to avoid this. Any idea to fix it ? Thank you ! :-)

    Read the article

  • Django: Applying Calculations To A Query Set

    - by TheLizardKing
    I have a QuerySet that I wish to pass to a generic view for pagination: links = Link.objects.annotate(votes=Count('vote')).order_by('-created')[:300] This is my "hot" page which lists my 300 latest submissions (10 pages of 30 links each). I want to now sort this QuerySet by an algorithm that HackerNews uses: (p - 1) / (t + 2)^1.5 p = votes minus submitter's initial vote t = age of submission in hours Now because applying this algorithm over the entire database would be pretty costly I am content with just the last 300 submissions. My site is unlikely to be the next digg/reddit so while scalability is a plus it is required. My question is now how do I iterate over my QuerySet and sort it by the above algorithm? For more information, here are my applicable models: class Link(models.Model): category = models.ForeignKey(Category, blank=False, default=1) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) modified = models.DateTimeField(auto_now=True) url = models.URLField(max_length=1024, unique=True, verify_exists=True) name = models.CharField(max_length=512) def __unicode__(self): return u'%s (%s)' % (self.name, self.url) class Vote(models.Model): link = models.ForeignKey(Link) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) def __unicode__(self): return u'%s vote for %s' % (self.user, self.link) Notes: I don't have "downvotes" so just the presence of a Vote row is an indicator of a vote or a particular link by a particular user.

    Read the article

  • In Django, why is user.is_authenticated a method and not a member variable like is_staff

    - by luc
    Hello all, I've lost some time with a bug in my app due to user authentication. I think that it's a bit confusing but maybe someone can explain the reason and it will appear to me very logical. The user.is_staff is a member variable while user.is_authenticated is a method. However is_authenticated only returns True or False depending if the class is User or AnonymousUser (see http://docs.djangoproject.com/en/dev/topics/auth/) Is there a reason for that? Why user.is_authenticated is a method? Thanks in advance

    Read the article

  • Fabric methods exceptions

    - by baobee
    I try to make Fabric func, which checks if Apache installed: from fabric.api import * def check_apache(): try: result = local('httpd -v', capture=True) except: print "check_apache exception" But if httpd not installed I get: [root@server-local ~]$ fab check_apache Fatal error: local() encountered an error (return code 127) while executing 'ahttpd -v' Aborting. check_apache exception Done. How can I get correct exception for Fabric local() method ? So I need to get exception and continue executing without any Fabric error messages: [root@server-local ~]$ fab check_apache check_apache exception Done.

    Read the article

  • Filter zipcodes by proximity in Django with the Spherical Law of Cosines

    - by spiffytech
    I'm trying to handle proximity search for a basic store locater in Django. Rather than haul PostGIS around with my app just so I can use GeoDjango's distance filter, I'd like to use the Spherical Law of Cosines distance formula in a model query. I'd like all of the calculations to be done in the database in one query, for efficiency. An example MySQL query from The Internet implementing the Spherical Law of Cosines like this: SELECT id, ( 3959 * acos( cos( radians(37) ) * cos( radians( lat ) ) * cos( radians( lng ) - radians(-122) ) + sin( radians(37) ) * sin( radians( lat ) ) ) ) AS distance FROM stores HAVING distance < 25 ORDER BY distance LIMIT 0 , 20; The query needs to reference the Zipcode ForeignKey for each store's lat/lng values. How can I make all of this work in a Django model query?

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • Web2py controllers with parameters?

    - by nickfranceschina
    I am building an app using Web2py framework... I don't want to have to use the request object to get all of the querystring parameters, instead I'd like to build my controller with named parameters and have the router unpack the querystring (or form data) dictionary into the named parameters and call my controller. so instead of a controller method of create_user(): where I would use the global request() object and look through the vars list... I would prefer instead to have create_user(first_name, last_name, email): like I see in other MVC platforms. is this possible in Web2py already? or is there a plugin for it? or do I need to add that myself?

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • How small is *too small* for an opensource project?

    - by Adam Lewis
    I have a fair number of smaller projects / libraries that I have been using over the past 2 years. I am thinking about moving them to Google Code to make it easier to share with co-workers and easier to import them into new projects on my own environments. The are things like a simple FSMs, CAN (Controller Area Network) drivers, and GPIB drivers. Most of them are small (less than 500 lines), so it makes me wonder are these types of things too small for a stand alone open-source project? Note that I would like to make it opensource because it does not give me, or my company, any real advantage.

    Read the article

  • basic unique ModelForm field for Google App Engine

    - by Alexander Vasiljev
    I do not care about concurrency issues. It is relatively easy to build unique form field: from django import forms class UniqueUserEmailField(forms.CharField): def clean(self, value): self.check_uniqueness(super(UniqueUserEmailField, self).clean(value)) def check_uniqueness(self, value): same_user = users.User.all().filter('email', value).get() if same_user: raise forms.ValidationError('%s already_registered' % value) so one could add users on-the-fly. Editing existing user is tricky. This field would not allow to save user having other user email. At the same time it would not allow to save a user with the same email. What code do you use to put a field with uniqueness check into ModelForm?

    Read the article

  • PyParsing: Not all tokens passed to setParseAction()

    - by Rosarch
    I'm parsing sentences like "CS 2110 or INFO 3300". I would like to output a format like: [[("CS" 2110)], [("INFO", 3300)]] To do this, I thought I could use setParseAction(). However, the print statements in statementParse() suggest that only the last tokens are actually passed: >>> statement.parseString("CS 2110 or INFO 3300") Match [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] at loc 7(1,8) string CS 2110 or INFO 3300 loc: 7 tokens: ['INFO', 3300] Matched [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] -> ['INFO', 3300] (['CS', 2110, 'INFO', 3300], {'Course': [(2110, 1), (3300, 3)], 'DeptCode': [('CS', 0), ('INFO', 2)]}) I expected all the tokens to be passed, but it's only ['INFO', 3300]. Am I doing something wrong? Or is there another way that I can produce the desired output? Here is the pyparsing code: from pyparsing import * def statementParse(str, location, tokens): print "string %s" % str print "loc: %s " % location print "tokens: %s" % tokens DEPT_CODE = Regex(r'[A-Z]{2,}').setResultsName("DeptCode") COURSE_NUMBER = Regex(r'[0-9]{4}').setResultsName("CourseNumber") OR_CONJ = Suppress("or") COURSE_NUMBER.setParseAction(lambda s, l, toks : int(toks[0])) course = DEPT_CODE + COURSE_NUMBER.setResultsName("Course") statement = course + Optional(OR_CONJ + course).setParseAction(statementParse).setDebug()

    Read the article

  • how to make my method running on the template of google-app-engine..

    - by zjm1126
    the model is : class someModel(db.Model): name = db.StringProperty() def name_is_sss(self): return self.name=='sss' the view is : a=someModel() a.name='sss' path = os.path.join(os.path.dirname(__file__), os.path.join('templates', 'blog/a.html')) self.response.out.write(template.render(path, {'a':a})) and the html is : {{ a.name_is_sss }} the page shows : True so i want to make it more useful, and like this: the model: class someModel(db.Model): name = db.StringProperty() def name_is_x(self,x): return self.name==x the html is : {% a.name_is_x 'www'%} or {{ a.name_is_x 'www'}} but the error is : TemplateSyntaxError: Invalid block tag: 'a.name_is_x' or TemplateSyntaxError: Could not parse the remainder: 'www' so how to make my method running thanks

    Read the article

  • Url open encoding

    - by badc0re
    I have the following code for urllib and BeautifulSoup: getSite = urllib.urlopen(pageName) # open current site getSitesoup = BeautifulSoup(getSite.read()) # reading the site content print getSitesoup.originalEncoding for value in getSitesoup.find_all('link'): # extract all <a> tags defLinks.append(value.get('href')) The result of it: /usr/lib/python2.6/site-packages/bs4/dammit.py:231: UnicodeWarning: Some characters could not be decoded, and were replaced with REPLACEMENT CHARACTER. "Some characters could not be decoded, and were " And when i try to read the site i get: ?7?e????0*"I??G?H????F??????9-??????;??E?YÞBs????????????4i???)?????^W?????`w?Ke??%??*9?.'OQB???V??@?????]???(P??^??q?$?S5???tT*?Z

    Read the article

< Previous Page | 367 368 369 370 371 372 373 374 375 376 377 378  | Next Page >