Search Results

Search found 10198 results on 408 pages for 'red and the community'.

Page 376/408 | < Previous Page | 372 373 374 375 376 377 378 379 380 381 382 383  | Next Page >

  • functional dependencies vs type families

    - by mhwombat
    I'm developing a framework for running experiments with artificial life, and I'm trying to use type families instead of functional dependencies. Type families seems to be the preferred approach among Haskellers, but I've run into a situation where functional dependencies seem like a better fit. Am I missing a trick? Here's the design using type families. (This code compiles OK.) {-# LANGUAGE TypeFamilies, FlexibleContexts #-} import Control.Monad.State (StateT) class Agent a where agentId :: a -> String liveALittle :: Universe u => a -> StateT u IO a -- plus other functions class Universe u where type MyAgent u :: * withAgent :: (MyAgent u -> StateT u IO (MyAgent u)) -> String -> StateT u IO () -- plus other functions data SimpleUniverse = SimpleUniverse { mainDir :: FilePath -- plus other fields } defaultWithAgent :: (MyAgent u -> StateT u IO (MyAgent u)) -> String -> StateT u IO () defaultWithAgent = undefined -- stub -- plus default implementations for other functions -- -- In order to use my framework, the user will need to create a typeclass -- that implements the Agent class... -- data Bug = Bug String deriving (Show, Eq) instance Agent Bug where agentId (Bug s) = s liveALittle bug = return bug -- stub -- -- .. and they'll also need to make SimpleUniverse an instance of Universe -- for their agent type. -- instance Universe SimpleUniverse where type MyAgent SimpleUniverse = Bug withAgent = defaultWithAgent -- boilerplate -- plus similar boilerplate for other functions Is there a way to avoid forcing my users to write those last two lines of boilerplate? Compare with the version using fundeps, below, which seems to make things simpler for my users. (The use of UndecideableInstances may be a red flag.) (This code also compiles OK.) {-# LANGUAGE MultiParamTypeClasses, FunctionalDependencies, FlexibleInstances, UndecidableInstances #-} import Control.Monad.State (StateT) class Agent a where agentId :: a -> String liveALittle :: Universe u a => a -> StateT u IO a -- plus other functions class Universe u a | u -> a where withAgent :: Agent a => (a -> StateT u IO a) -> String -> StateT u IO () -- plus other functions data SimpleUniverse = SimpleUniverse { mainDir :: FilePath -- plus other fields } instance Universe SimpleUniverse a where withAgent = undefined -- stub -- plus implementations for other functions -- -- In order to use my framework, the user will need to create a typeclass -- that implements the Agent class... -- data Bug = Bug String deriving (Show, Eq) instance Agent Bug where agentId (Bug s) = s liveALittle bug = return bug -- stub -- -- And now my users only have to write stuff like... -- u :: SimpleUniverse u = SimpleUniverse "mydir"

    Read the article

  • Sitecore E-Commerce Module - Discount/Promotional Codes

    - by Zachary Kniebel
    I am working on a project for which I must use Sitecore's E-Commerce Module (and Sitecore 6.5 rev. 120706 - aka 'Update 5') to create a web-store. One of the features that I am trying to implement is a generic promotional/discount code system - customer enters a code at checkout which grants a discount like 'free shipping', '20% off', etc. At the moment, I am looking for some guidance (a high-level solution, a few pseudo-ideas, some references to review, etc) as to how this can be accomplished. Summary: What I am looking for is a way to detect whether or not the user entered a promo code at a previous stage in the checkout line, and to determine what that promo code is, if they did. Progress Thus Far: I have thoroughly reviewed all of the Sitecore E-Commerce Services (SES) documentation, especially "SES Order Line Extension" documentation (which I believe will have to be modified/extended in order to accomplish this task). Additionally, I have thoroughly reviewed the Sitecore Community article Extending Sitecore E-Commerce - Pricing and believe that it may be a useful guide for applying a discount statically, but does not say much in the way of applying a discount dynamically. After reviewing these documents, I have come up with the following possible high-level solution to start from: I create a template to represent a promotional code, which holds all data relevant to the promotion (percent off, free shipping, code, etc). I then create another template (based on the Product Search Group template) that holds a link to an item within a global "Promotional Code" items folder. Next, I use the Product Search Group features of my new template to choose which products to apply the discount to. In the source code for the checkout I create a class that checks if a code has been entered and, if so, somehow carry it through the rest of the checkout process. This is where I get stuck. More Details: No using cookies No GET requests No changing/creating/deleting items in the Sitecore Database during the checkout process (e.g., no manipulation of fields of a discount item during checkout to signal that the discount has been applied) must stay within the scope of C# Last Notes: I will update this post with any more information that I find/progress that I make. I upgrade all answers that are relevant and detailed, thought-provoking, or otherwise useful to me and potentially useful to others, in addition to any high-level answers that serve as a feasible solution to this problem; even if your idea doesn't help me, if I think it will help someone else I will still upgrade it. Thanks, in advance, for all your help! :)

    Read the article

  • HTML-like GUI Framework in Java

    - by wintermute
    I was recently brought onto a project where we are developing a lot GUI elements for BlackBerry devices. The standard RIM APIs are pretty basic, almost never do what is required and are difficult or impossible to extend, so we end up re-implementing chunks of it. Currently the code we have isn't super organized and factored so there are lots of little tricks that get implemented over and over again. I had a thought about how to aid development efforts on this platform and wanted to see if the community could tell me if I'm still sane or if I've gone totally nuts. By far, the biggest organizational problem I've run into is making sure that each screen is laid out properly with proper padding and such. The current approach is to manually keep track of padding like so: protected void sublayout(int width, int height) { final int padding = 5; int y = padding; int x = padding; layoutChild(_someChild, width - padding * 2, height / 3 - padding * 2); setPositionChild(_someChild, x, y); y += _someChild.getHeight() + padding; // Calculate where to start drawing next. /* ... snipped ... */ } As you can see, positioning elements on a screen is a nightmare due to the tedium. I have investigated other GUI frameworks but, for a variety of reasons, it is difficult to find one that suites our purposes. One potential solution that came to me is to create a GUI framework who's API resembles HTML/CSS. This would allow for things like padding, margins, borders and colours to be handled through a sort of CSS API while the content would be organized using the HTML part of the API. It might look something like this: public class OptionsScreen extends Document { public OptionsScreen() { // You would set the style (like CSS style) through the constructor. Div content = new Div(new Style(new Padding(5), Color.BLACK)); // Then build up a tree of elements which can each have their own style's. // Each element knows how to draw itself, but it doesn't have to worry about // manually handling things like padding. // content.addChild(new P("This is a paragraph", new Style(new Padding(), Color.RED))); Ul list = new Ul(); list.addChild(new Li("item 1")); list.addChild(new Li("item 2")); content.addChild(list); addChild(content); } } I can imagine this making it easier to customize the UI of our app (which is very important) with different fonts, colours and layouts. Does this idea belong on The Daily WTF or do you think there is some promise?

    Read the article

  • jquery show hidden div

    - by Fahad
    Firstly, I'm sort of embarrassed asking about this, so many people have already asked this question but even after having gone through so many posts, I'm unable to achieve what I want. Basically, a div, initially hidden, has to be displayed on a button click. I tried hiding the div using display:none and hide() and then displaying it using show(), toggle(), and css("display","block"). Using all sorts of combinations of the above, I was still unable to get the result. Code: <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> <link href="css/smoothness/jquery-ui-1.9.2.custom.min.css" rel="stylesheet" type="text/css" /> <script src="jQuery/jquery-1.8.3.min.js" type="text/javascript"></script> <script src="jQuery/jquery-ui-1.9.2.custom.min.js" type="text/javascript"></script> <script type="text/javascript"> $(document).ready(function () { $('#one').hide(); $('#Button1').click(function () { $('#one').toggle(500); }); }); </script> </head> <body> <form id="form1" runat="server"> <div id="one" style="height: 20px;width:200px; background-color: Red; "> </div> <asp:Button ID="Button1" runat="server" Text="Show" /> </form> </body> </html> On button click, the div is shown for a brief second before it disappears again. The same thing happens if I use show() instead of toggle() in the above code. Again the same thing if I set style="display:none" to the div instead of using hide() and then use show() or toggle(). I also tried using $('#one').css("display","block"); but again, the same result. Can anyone please tell me where I'm going wrong. Just started learning jQuery and it is really frustrating when something apparently so simple will not work. Thanks in advance. :)

    Read the article

  • OpenGL, how to set a monochrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Swapping two jQuery draggable list items not working properly (with jsFiddle example)

    - by Tony_Henrich
    The minimalist working example below swaps the two boxes when box 'one' is dragged and dropped on box 'two'. The problem is that when box 'one' is dropped, its style has 'top' & 'left' values causing it to be placed away from where it should drop. Its class includes 'ui-draggable-dragging'. It seems the top & left values are related to the amount the elements were dragged before the drop. And the dragging was 'interrupted' hence the residual 'ui-draggable-dragging' class? What am I missing to make the swap work seamlessly? full jsfiddle example here <html> <head> <script type="text/javascript" src="includes/jquery-1.4.2.min.js"></script> <script type="text/javascript" src="includes/jquery-ui-1.8.2.custom.min.js"></script> <script type="text/javascript"> jQuery.fn.swapWith = function(to) { return this.each(function() { var copy_to = $(to).clone(true); var copy_from = $(this).clone(true); $(to).replaceWith(copy_from); $(this).replaceWith(copy_to); }); }; $(document).ready(function() { options = {revert: true}; $("li").draggable(options) $('#wrapper').droppable({ drop: function(event, ui) { $(ui.draggable).swapWith($('#two')); } }); }); </script> </head> <body> <form> <ul id="wrapper"> <li id='one'> <div style="width: 100px; height: 100px; border: 1px solid green"> one<br /></div> </li> <li id='two'> <div style="width: 110px; height: 110px; border: 1px solid red"> two<br /></div> </li> </ul> <br /> </form> </body> </html>

    Read the article

  • What is the wrong of this converted code?

    - by Gum Slashy
    I'm developing shape identification project using javacv and I have found some opencv code to identify U shapes in particular image and I have try to convert it in to javacv but it doesn't provide same out put. Can you please help me to convert this opencv code into javacv? This is Opencv code import cv2 import numpy as np img = cv2.imread('sofud.jpg') gray = cv2.cvtColor(img,cv2.COLOR_BGR2GRAY) ret,thresh = cv2.threshold(gray,127,255,1) contours,hierarchy = cv2.findContours(thresh,cv2.RETR_LIST,cv2.CHAIN_APPROX_SIMPLE) for cnt in contours: x,y,w,h = cv2.boundingRect(cnt) if 10 < w/float(h) or w/float(h) < 0.1: cv2.rectangle(img,(x,y),(x+w,y+h),(0,0,255),2) cv2.imshow('res',img) cv2.waitKey(0) cv2.destroyAllWindows() This is the expected output This is the code that I have converted import com.googlecode.javacpp.Loader; import com.googlecode.javacv.CanvasFrame; import static com.googlecode.javacpp.Loader.*; import static com.googlecode.javacv.cpp.opencv_core.*; import static com.googlecode.javacv.cpp.opencv_imgproc.*; import static com.googlecode.javacv.cpp.opencv_highgui.*; import java.io.File; import javax.swing.JFileChooser; public class TestBeam { public static void main(String[] args) { CvMemStorage storage=CvMemStorage.create(); CvSeq squares = new CvContour(); squares = cvCreateSeq(0, sizeof(CvContour.class), sizeof(CvSeq.class), storage); JFileChooser f=new JFileChooser(); int result=f.showOpenDialog(f);//show dialog box to choose files File myfile=null; String path=""; if(result==0){ myfile=f.getSelectedFile();//selected file taken to myfile path=myfile.getAbsolutePath();//get the path of the file } IplImage src = cvLoadImage(path);//hear path is actual path to image IplImage grayImage = IplImage.create(src.width(), src.height(), IPL_DEPTH_8U, 1); cvCvtColor(src, grayImage, CV_RGB2GRAY); cvThreshold(grayImage, grayImage, 127, 255, CV_THRESH_BINARY); CvSeq cvSeq=new CvSeq(); CvMemStorage memory=CvMemStorage.create(); cvFindContours(grayImage, memory, cvSeq, Loader.sizeof(CvContour.class), CV_RETR_CCOMP, CV_CHAIN_APPROX_SIMPLE); System.out.println(cvSeq.total()); for (int i = 0; i < cvSeq.total(); i++) { CvRect rect=cvBoundingRect(cvSeq, i); int x=rect.x(),y=rect.y(),h=rect.height(),w=rect.width(); if (10 < (w/h) || (w/h) < 0.1){ cvRectangle(src, cvPoint(x, y), cvPoint(x+w, y+h), CvScalar.RED, 1, CV_AA, 0); //cvSeqPush(squares, rect); } } CanvasFrame cnvs=new CanvasFrame("Beam"); cnvs.setDefaultCloseOperation(javax.swing.JFrame.EXIT_ON_CLOSE); cnvs.showImage(src); //cvShowImage("Final ", src); } } This is the out put that I got please can some one help me to solve this problem ?

    Read the article

  • Commitment to Zend Framework - any arguments against?

    - by Pekka
    I am refurbishing a big CMS that I have been working on for quite a number of years now. The product itself is great, but some components, the Database and translation classes for example, need urgent replacing - partly self-made as far back as 2002, grown into a bit of a chaos over time, and might have trouble surviving a security audit. So, I've been looking closely at a number of frameworks (or, more exactly, component Libraries, as I do not intend to change the basic structure of the CMS) and ended up with liking Zend Framework the best. They offer a solid MVC model but don't force you into it, and they offer a lot of professional components that have obviously received a lot of attention (Did you know there are multiple plurals in Russian, and you can't translate them using a simple ($number == 0) or ($number > 1) switch? I didn't, but Zend_Translate can handle it. Just to illustrate the level of thorougness the library seems to have been built with.) I am now literally at the point of no return, starting to replace key components of the system by the Zend-made ones. I'm not really having second thoughts - and I am surely not looking to incite a flame war - but before going onward, I would like to step back for a moment and look whether there is anything speaking against tying a big system closely to Zend Framework. What I like about Zend: As far as I can see, very high quality code Extremely well documented, at least regarding introductions to how things work (Haven't had to use detailed API documentation yet) Backed by a company that has an interest in seeing the framework prosper Well received in the community, has a considerable user base Employs coding standards I like Comes with a full set of unit tests Feels to me like the right choice to make - or at least, one of the right choices - in terms of modern, professional PHP development. I have been thinking about encapsulating and abstracting ZF's functionality into own classes to be able to switch frameworks more easily, but have come to the conclusion that this would not be a good idea because: it would be an unnecessary level of abstraction it could cost performance the big advantage of using a framework - the existence of a developer base that is familiar with its components - would partly be cancelled out therefore, the commitment to ZF would be a deep one. Thus my question: Is there anything substantial speaking against committing to the Zend Framework? Do you have insider knowledge of plans of Zend Inc.'s to go evil in 2011, and make it a closed source library? Is Zend Inc. run by vampires? Are there conceptual flaws in the code base you start to notice when you've transitioned all your projects to it? Is the appearance of quality code an illusion? Does the code look good, but run terribly slow on anything below my quad-core workstation?

    Read the article

  • PHP - JSON Steam API query

    - by Hunter
    First time using "JSON" and I've just been working away at my dissertation and I'm integrating a few features from the steam API.. now I'm a little bit confused as to how to create arrays. function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530'); $test = decode_url($api); var_dump($test['response']['players'][0]['personaname']['steamid']); } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $data = file_get_contents($url); $data_output = json_decode($data, true); return $data_output; } So ea I've wrote a simple method to decode Json as I'll be doing a fair bit.. But just wondering the best way to print out arrays.. I can't for the life of me get it to print more than 1 element without it retunring an error e.g. Warning: Illegal string offset 'steamid' in /opt/lampp/htdocs/lan/lan-includes/scripts/class.steam.php on line 48 string(1) "R" So I can print one element, and if I add another it returns errors. EDIT -- Thanks for help, So this was my solution: function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530,76561197960435530'); $data = decode_url($api); foreach($data ['response']['players'] as $player) { echo "Steam id:" . $player['steamid'] . "\n"; echo "Community visibility :" . $player['communityvisibilitystate'] . "\n"; echo "Player profile" . $player['profileurl'] ."\n"; } } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $json = file_get_contents($decodeURL); $data_output = json_decode($json, true); return $data_output; } Worked this out by taking a look at the data.. and a couple json examples, this returns an array based on the Steam API URL (It works for multiple queries.... just FYI) and you can insert loops inside for items etc.. (if anyone searches for this).

    Read the article

  • Running OpenMPI on Windows XP

    - by iamweird
    Hi there. I'm trying to build a simple cluster based on Windows XP. I compiled OpenMPI-1.4.2 successfully, and tools like mpicc and ompi_info work too, but I can't get my mpirun working properly. The only output I can see is Z:\orterun --hostfile z:\hosts.txt -np 2 hostname [host0:04728] Failed to initialize COM library. Error code = -2147417850 [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\mca\ess\hnp\ess_hnp_module.c at line 218 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_plm_init failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\runtime\orte_init.c at line 132 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_ess_set_name failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\..\..\openmpi -1.4.2\orte\tools\orterun\orterun.c at line 543 Where z:\hosts.txt appears as follows: host0 host1 Z: is a shared network drive available to both host0 and host1. What my problem is and how do I fix it? Upd: Ok, this problem seems to be fixed. It seems to me that WideCap driver and/or software components causes this error to appear. A "clean" machine runs local task successfully. Anyway, I still cannot run a task within at least 2 machines, I'm getting following message: Z:\mpirun --hostfile z:\hosts.txt -np 2 hostname connecting to host1 username:cluster password:******** Save Credential?(Y/N) y [host0:04728] This feature hasn't been implemented yet. [host0:04728] Could not connect to namespace cimv2 on node host1. Error code =-2147024891 -------------------------------------------------------------------------- mpirun was unable to start the specified application as it encountered an error. More information may be available above. -------------------------------------------------------------------------- I googled a little and did all the things as described here: http://www.open-mpi.org/community/lists/users/2010/03/12355.php but I'm still getting the same error. Can anyone help me? Upd2: Error code -2147024891 might be WMI error WBEM_E_INVALID_PARAMETER (0x80041008) which occures when one of the parameters passed to the WMI call is not correct. Does this mean that the problem is in OpenMPI source code itself? Or maybe it's because of wrong/outdated wincred.h and credui.lib I used while building OpenMPI from the source code?

    Read the article

  • Unit Testing - Am I doing it right?

    - by baron
    Hi everyone, Basically I have been programing for a little while and after finishing my last project can fully understand how much easier it would have been if I'd have done TDD. I guess I'm still not doing it strictly as I am still writing code then writing a test for it, I don't quite get how the test becomes before the code if you don't know what structures and how your storing data etc... but anyway... Kind of hard to explain but basically lets say for example I have a Fruit objects with properties like id, color and cost. (All stored in textfile ignore completely any database logic etc) FruitID FruitName FruitColor FruitCost 1 Apple Red 1.2 2 Apple Green 1.4 3 Apple HalfHalf 1.5 This is all just for example. But lets say I have this is a collection of Fruit (it's a List<Fruit>) objects in this structure. And my logic will say to reorder the fruitids in the collection if a fruit is deleted (this is just how the solution needs to be). E.g. if 1 is deleted, object 2 takes fruit id 1, object 3 takes fruit id2. Now I want to test the code ive written which does the reordering, etc. How can I set this up to do the test? Here is where I've got so far. Basically I have fruitManager class with all the methods, like deletefruit, etc. It has the list usually but Ive changed hte method to test it so that it accepts a list, and the info on the fruit to delete, then returns the list. Unit-testing wise: Am I basically doing this the right way, or have I got the wrong idea? and then I test deleting different valued objects / datasets to ensure method is working properly. [Test] public void DeleteFruit() { var fruitList = CreateFruitList(); var fm = new FruitManager(); var resultList = fm.DeleteFruitTest("Apple", 2, fruitList); //Assert that fruitobject with x properties is not in list ? how } private static List<Fruit> CreateFruitList() { //Build test data var f01 = new Fruit {Name = "Apple",Id = 1, etc...}; var f02 = new Fruit {Name = "Apple",Id = 2, etc...}; var f03 = new Fruit {Name = "Apple",Id = 3, etc...}; var fruitList = new List<Fruit> {f01, f02, f03}; return fruitList; }

    Read the article

  • unable to trigger event in IE during clonning

    - by Abhimanyu
    Following is the code which will clone a set of div with their events(onclick) which is working fine for FF but in case of IE it is not firing events associated with each div. <html> <head> <style type='text/css'> .firstdiv{ border:1px solid red; } </style> <script language="JavaScript"> function show_tooltip(idx,condition,ev) { alert(idx +"=="+condition+"=="+ev); } function createCloneNode () { var cloneObj = document.getElementById("firstdiv").cloneNode(true); document.getElementById("maindiv").appendChild(cloneObj); } function init(){ var mainDiv = document.createElement("div"); mainDiv.id = 'maindiv'; var firstDiv = document.createElement("div"); firstDiv.id ='firstdiv'; firstDiv.className ='firstdiv'; for(var j=0;j<4;j++) { var summaryDiv = document.createElement("div"); summaryDiv.id = "sDiv"+j summaryDiv.className ='summaryDiv'; summaryDiv.onmouseover = function() {this.setAttribute("style","text-decoration:underline;cursor:pointer;");} summaryDiv.onmouseout = function() {this.setAttribute("style","text-decoration:none;");} summaryDiv.setAttribute("onclick", "show_tooltip("+j+",'view_month',event)"); summaryDiv.innerHTML = 'Div'+j; firstDiv.appendChild(summaryDiv); } mainDiv.appendChild(firstDiv); var secondDiv = document.createElement("div"); var linkDiv = document.createElement("div"); linkDiv.innerHTML ='create clone of above element'; linkDiv.onclick = function() { createCloneNode(); } secondDiv.appendChild(linkDiv); mainDiv.appendChild(secondDiv); document.body.appendChild(mainDiv); } </script> </head> <body> <script language="JavaScript"> init() </script> </body> </html> can anybody tell me whats the problem in above code please correct me..

    Read the article

  • What are some things you'd like fresh college grads to know?

    - by bradhe
    So I proposed this to the Reddit community and I'd like to get SO's perspective on this. This is pretty much the copypasta of what I put there. I was thinking about this last night and thought it would be neat to compile a list. I'm still a pretty fresh college grad -- been in industry for 2 years -- but I think that I might have a few interesting things to lend. You don't know as much as you think you do. Somehow, college students think they know a lot more than they do (or maybe that was just me). Likewise, they think they can do more than they actually can. You should fairly assess your skills. QA people are not out to get you. Humans introduce bugs to code. It's not (nescessarily) a personal reflection on you and your skills if your code has a bug and it's caught by the QA/testing team. Listen to your senior (developers). They are not actually fuddy duddies who don't know about the new L337 hax in Ruby (okay, sometimes they are, but still...). They have a wealth of knowledge that you can learn from and it's in your best interest to do so. You will most likely not be doing what you want to for a while. This is mostly true in the corporate world -- startups are a different matter. Also, this is due to more than just the economy, man! Junior devs need to earn their keep, so to speak. Everyone wants to be lead dev on the next project and there are a lot of people in line ahead of you! For every elite developer there are 100 average developers. Joel Spolsky, I'm looking at you. Somehow this concept of ninja coders has really ingrained itself in our culture. While I encourage you to be the best you can be don't be disappointed if people aren't writing blog posts about you in the near future. Anyone else have anything they would see added to this list?

    Read the article

  • opacity in ie using absolutely positioned divs not working

    - by camomileCase
    I've been banging my head against the wall for a few hours how trying to sort this out. I'm trying to position one div on top of another for the purpose of fading one in on top of the other. The divs will have an image and some other html in them. I cannot get opacity to work in ie8. I've simplified my html as much as possible: <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> <html> <head> <style> * { margin: 0; padding: 0; } .carousel-container { position: relative; } .carousel-overlay { position: absolute; } #carousel-container-a { opacity: 1; -ms-filter: "progid:DXImageTransform.Microsoft.Alpha(Opacity=100)"; filter: progid:DXImageTransform.Microsoft.Alpha(Opacity=100); } #carousel-container-b { opacity: 0; -ms-filter: "progid:DXImageTransform.Microsoft.Alpha(Opacity=0)"; filter: progid:DXImageTransform.Microsoft.Alpha(Opacity=0); } h1 { font-size: 100px; } </style> </head> <body> <div id="carousel-container-a" class="carousel-container"> <div class="carousel-overlay" style="left: 10px; top: 10px;"> <h1 style="color: black;">Showcase</h1> </div> <!-- other elements removed for simplicity --> </div> <div id="carousel-container-b" class="carousel-container"> <div class="carousel-overlay" style="left: 20px; top: 20px;"> <h1 style="color: red;">Welcome</h1> </div> <!-- other elements removed for simplicity --> </div> </body> </html> Why doesn't the opacity work? How can I make it work?

    Read the article

  • I'm having trouble traversing a newly appended DOM element with jQuery

    - by culov
    I have a form that I want to be used to add entries. Once an entry is added, the original form should be reset to prepare it for the next entry, and the saved form should be duplicated prior to resetting and appended onto a div for 'storedEntries.' This much is working (for the most part), but Im having trouble accessing the newly created form... I need to change the value attribute of the submit button from 'add' to 'edit' so properly communicate what clicking that button should do. heres my form: <div class="newTruck"> <form id="addNewTruck" class='updateschedule' action="javascript:sub(sTime.value, eTime.value, lat.value, lng.value, street.value);"> <b style="color:green;">Opening at: </b> <input id="sTime" name="sTime" title="Opening time" value="Click to set opening time" class="datetimepicker"/> <b style="color:red;">Closing at: </b> <input id="eTime" name= "eTime" title="Closing time" value="Click to set closing time" class="datetimepicker"/> <label for='street'>Address</label> <input type='text' name='street' id='street' class='text' autocomplete='off'/> <input id='submit' class='submit' style="cursor: pointer; cursor: hand;" type="submit" value='Add new stop'/> <div id='suggests' class='auto_complete' style='display:none'></div> <input type='hidden' name='lat' id='lat'/> <input type='hidden' name='lng' id='lng'/> ive tried using a hundred different selectors with jquery to no avail... heres my script as it stands: function cloneAndClear(){ var id = name+now; $j("#addNewTruck").clone(true).attr("id",id).appendTo(".scheduledTrucks"); $j('#'+id).filter('#submit').attr('value', 'Edit'); $j("#addNewTruck")[0].reset(); createPickers(); } the element is properly cloned and inserted into the div, but i cant find a way to access this element... the third line in the script never works. Another problem i am having is that the 'values' in the cloned form revert back to the value in the source of the html rather than what the user inputs. advice on how to solve either of these issues is greatly appreciated!

    Read the article

  • OpenGL, how to set a monocrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :) Thank's

    Read the article

  • Php plugin to replace '->' with '.' as the member access operator ? Or even better: alternative synt

    - by Gigi
    Present day usable solution: Note that if you use an ide or an advanced editor, you could make a code template, or record a macro that inserts '->' when you press Ctrl and '.' or something. Netbeans has macros, and I have recorded a macro for this, and I like it a lot :) (just click the red circle toolbar button (start record macro),then type -> into the editor (thats all the macro will do, insert the arrow into the editor), then click the gray square (stop record macro) and assign the 'Ctrl dot' shortcut to it, or whatever shortcut you like) The php plugin: The php plugin, would also have to have a different string concatenation operator than the dot. Maybe a double dot ? Yea... why not. All it has to do is set an activation tag so that it doesnt replace / interpreter '.' as '->' for old scripts and scripts that dont intent do use this. Something like this: <php+ $obj.i = 5 ?> (notice the modified '<?php' tag to '<?php+' ) This way it wouldnt break old code. (and you can just add the '<?php+' code template to your editor and then type 'php tab' (for netbeans) and it would insert '<?php+' ) With the alternative syntax method you could even have old and new syntax cohabitating on the same page like this (I am illustrating this to show the great compatibility of this method, not because you would want to do this): <?php+ $obj.i = 5; ?> <?php $obj->str = 'a' . 'b'; ?> You could change the tag to something more explanatory, in case somebody who doesnt know about the plugin reads the script and thinks its a syntax error <?php-dot.com $obj.i = 5; ?> This is easy because most editors have code templates, so its easy to assign a shortcut to it. And whoever doesnt want the dot replacement, doesnt have to use it. These are NOT ultimate solutions, they are ONLY examples to show that solutions exist, and that arguments against replacing '->' with '.' are only excuses. (Just admit you like the arrow, its ok : ) With this potential method, nobody who doesnt want to use it would have to use it, and it wouldnt break old code. And if other problems (ahem... excuses) arise, they could be fixed too. So who can, and who will do such a thing ?

    Read the article

  • Which is the "best" data access framework/approach for C# and .NET?

    - by Frans
    (EDIT: I made it a community wiki as it is more suited to a collaborative format.) There are a plethora of ways to access SQL Server and other databases from .NET. All have their pros and cons and it will never be a simple question of which is "best" - the answer will always be "it depends". However, I am looking for a comparison at a high level of the different approaches and frameworks in the context of different levels of systems. For example, I would imagine that for a quick-and-dirty Web 2.0 application the answer would be very different from an in-house Enterprise-level CRUD application. I am aware that there are numerous questions on Stack Overflow dealing with subsets of this question, but I think it would be useful to try to build a summary comparison. I will endeavour to update the question with corrections and clarifications as we go. So far, this is my understanding at a high level - but I am sure it is wrong... I am primarily focusing on the Microsoft approaches to keep this focused. ADO.NET Entity Framework Database agnostic Good because it allows swapping backends in and out Bad because it can hit performance and database vendors are not too happy about it Seems to be MS's preferred route for the future Complicated to learn (though, see 267357) It is accessed through LINQ to Entities so provides ORM, thus allowing abstraction in your code LINQ to SQL Uncertain future (see Is LINQ to SQL truly dead?) Easy to learn (?) Only works with MS SQL Server See also Pros and cons of LINQ "Standard" ADO.NET No ORM No abstraction so you are back to "roll your own" and play with dynamically generated SQL Direct access, allows potentially better performance This ties in to the age-old debate of whether to focus on objects or relational data, to which the answer of course is "it depends on where the bulk of the work is" and since that is an unanswerable question hopefully we don't have to go in to that too much. IMHO, if your application is primarily manipulating large amounts of data, it does not make sense to abstract it too much into objects in the front-end code, you are better off using stored procedures and dynamic SQL to do as much of the work as possible on the back-end. Whereas, if you primarily have user interaction which causes database interaction at the level of tens or hundreds of rows then ORM makes complete sense. So, I guess my argument for good old-fashioned ADO.NET would be in the case where you manipulate and modify large datasets, in which case you will benefit from the direct access to the backend. Another case, of course, is where you have to access a legacy database that is already guarded by stored procedures. ASP.NET Data Source Controls Are these something altogether different or just a layer over standard ADO.NET? - Would you really use these if you had a DAL or if you implemented LINQ or Entities? NHibernate Seems to be a very powerful and powerful ORM? Open source Some other relevant links; NHibernate or LINQ to SQL Entity Framework vs LINQ to SQL

    Read the article

  • Define Javascript slider hit/rollover area

    - by Rob
    Hey, Im having an issue defining the hit area for a javascript sliding element. See example: http://www.warface.co.uk/clients/warface.co.uk/ Please slide over the grey box on the right side to reveal the button, although this works I would only like for the slider to only be triggered by rolling over the red block. CSS .slidingtwitter { /* -- This is the hit area -- */ background: #ccc; width:255px; height:55px; overflow: hidden; top:50%; right: 0px; /* -- This is the sliding start point -- */ position: fixed; font-family: Gotham, Sans-Serif; z-index: 50; } .slidingtwitter.right { right:0px; } .slidingtwitter .caption { /* -- This is the sliding area -- */ background: #fff; position: absolute; width:260px; height:55px; right: -205px; /* -- This is the sliding start point -- */ } .slidingtwitter a { color: #484848; font-size: 20px; text-transform: uppercase; } .slidingtwitter a:hover { color: black; } .slidingtwitter .smaller { font-size: 12px; font-family: Gotham Medium; } .twitterblock { background: #f35555 url("styles/images/button_twitter.png") no-repeat 14px 15px ; width:35px; height:35px; padding:10px; float:left; display:block; } .slidingtwitter .followme { background: url("styles/images/button_arrowheadthin.jpg")no-repeat right 0; height:35px; display:block; float:left; line-height:14px; width:140px; margin:10px 0px 0px 14px; padding-top:6px; padding-right: 40px; } JS $('.slidingtwitter').hover(function(){ $(".slide", this).stop().animate({right:'0px'},{queue:false,duration:400}); //Position on rollover },function() { $(".slide", this).stop().animate({right:'-205px'},{queue:false,duration:400}); //Position on rollout }); Any suggestions would be much appreciated.

    Read the article

  • jquery ui is not scaling text properly!

    - by Stephen Belanger
    I'm trying use jquery ui to scale a div that I'm dragging around to make it easier to see what's behind it, but any text inside it is scaling strangely. The text itself becomes smaller, but it seems to have a bunch of padding around it and is floating now. The text extends past the bottom of the div even though it should be contained properly by the div. I put a red border around the lines of text and the borders are the same size as the original text. I'm not really sure what to do to get this to work... HTML: <div class="item draggable" id="item-1'"> <div class="image-block"> <a class="delete-button" title="delete me!" href="/remove/1" onclick="return $(this).confirm(\'Really remove this image?\');">X</a> <a class="image" href="/edit/1"><img src="/someimage.jpg" /></a> <div class="clear-block"></div> </div> <h3>Some title</h3> </div> CSS: div.image-list div.item { float:left; background:#fff; width:150px; padding:5px; margin:4px; border:1px solid #d3d5d6; } div.image-list div.item h3 { margin:0; padding:0; border:solid 1px #F00; } div.image-list div.item div.image-block a.delete-button { float:right; position:relative; background:#fff; display:none; top:0.8em; margin-bottom:-20.0em; width:3em; height:1.8em; padding:0.2em 1em; } div.image-list div.item div.image-block a.image { float:left; display:block; } .clear-block { clear:both; } jquery: $(".draggable").draggable({ helper: 'clone', start: function(ev, ui) { $(ui.helper).effect( "scale", { percent: 50 }, 200 ); } });

    Read the article

  • php database image show problem

    - by Termedi
    here is the code <?php session_start(); if(!isset($_SESSION['user_name'])) { header('Location: login.php'); } $conn = mysql_connect("localhost", "root", "") or die("Can no connect to Database Server"); ?> <html> <head> </head> <body> <center> <div id="ser"> <form action="" method="post"> <label for="file">Card No:</label> <input type="text" name="card_no" id="card_no" class="fil" onKeyUp="CardNoLength()" onKeyDown="CardNoLength()" onKeyPress="CardNoLength()"/> <input type="submit" name="search" value="Search" class="btn" onClick="return CardNoLengthMIN()"/> </form> </div> </center> <br/><hr style="border: 1px solid #606060 ;" /> <center><a href="index.php">Home</a></center> <br/> <center> <?php if(isset($_POST['card_no'])) { if($conn) { if(mysql_select_db("img_mgmt", $conn)) { $sql = "select * from temp_images where card_no='".trim($_POST['card_no'])."'"; $result = mysql_query($sql); $image = mysql_fetch_array($result); if(isset($image['card_no'])) { //echo "<img src=\"".$image['file_path']."\" alt=\"".$image['card_no']."\" width=\"250\" height=\"280\"/>"; header("Content-type: image/jpeg"); echo $image['img_content']; } else { echo "<p style=\"color:red;\">Sorry, Your search came with no results ! <br/> Try with different card number"; } } else { echo "Database selection error: ".mysql_error(); } } else { echo "Could not connect: ".mysql_error(); } } ?> </center> </body> </html> But it after executing the script it shows: Cannot modify header information - headers already sent by (output started at C:\xampp\htdocs\img\search.php:61) in C:\xampp\htdocs\img\search.php on line 77

    Read the article

  • Visual studio 2010 colourizers, intellisense and the rest. Where to start!!

    - by Owen
    Ok, before I begin I realize that there is a lot of documentation on this subject but I have thus far failed to get even basic colourization working for VS2010. My goal is to simply get to a point where I can open a document and everything is coloured red, from here I can implement the relevant parsing logic. Here's what I have tried/found: 1) Downloaded all the relevent SDK's and such- Found the ook sample (http://code.msdn.microsoft.com/ookLanguage) - didn't build, didn't work. 2) Knowing almost nothing about MEF read through "Implementing a Language Service By Using the Managed Package Framework" - http://msdn.microsoft.com/en-us/library/bb166533(v=VS.100).aspx This was pretty much a copy and paste of all the basic stuff here, and also updating some references which were out of date with the sample see: http://social.msdn.microsoft.com/Forums/en-US/vsx/thread/a310fe67-afd2-4592-b295-3fc86fec7996 Now, I have got to a point where when running the package MEF appears to have hooked up correctly (I know this because with the debugger open I can see that the packages initialize and FDoIdle methods are being hit). When I open a file of the extension I have registered with the ProvideLanguageExtensionAttribute everything dies as if in an endless loop, yet no debug symbols hit (though they are loaded). Looking at the ook sample and the MEF examples they seem to be totally different approaches to the same problem. In the ook sample there are notions of Clasifications and Completion controllers which aren't mentioned in the MEF example. Also, they don't seem to create a Package or Language service, so I have no idea how it should work? With the MEF example, my assumption is that I need to hook into the "IScanner.ScanTokenAndProvideInfoAboutIt" to provide syntax highlighting? Which would be fine if I could ever hit this method. So my first question I guess is which approach should I be taking here? Or do they both somehow tie together? My second questions is, where can I find a basic fully working project that implements bog standard basic syntax highlighting and intellisense or VS2010? Thirdly, in the MEF example when I created a Package there were a bunch of test projects created for me. I appears that the integration tests launch the VS2010 test rig somehow, but the test fails. It would be good to write my service with tests but I have no idea what/how I can test each interaction so any references to testing Language services would be helpful. Finally, please throw any resource/book links my way that I may find useful. Cheers, Chris. N.B. Sorry I realize this is part question part rant, but I have never been so confused.

    Read the article

  • How to Integrate C++ compiler in Visual Studio 2008

    - by Kasun
    Hi Can someone help me with this issue? I currently working on my project for final year of my honors degree. And we are developing a application to evaluate programming assignments of student ( for 1st year student level) I just want to know how to integrate C++ compiler using C# code to compile C++ code. In our case we are loading a student C++ code into text area, then with a click on button we want to compile the code. And if there any compilation errors it will be displayed on text area nearby. (Interface is attached herewith.) And finally it able to execute the code if there aren't any compilation errors. And results will be displayed in console. We were able to do this with a C#(C# code will be loaded to text area intead of C++ code) code using inbuilt compiler. But still not able to do for C# code. Can anyone suggest a method to do this? It is possible to integrate external compiler to VS C# code? If possible how to achieve it? Very grateful if anyone will contributing to solve this matter? This is code for Build button which we proceed with C# code compiling CodeDomProvider codeProvider = CodeDomProvider.CreateProvider("csharp"); string Output = "Out.exe"; Button ButtonObject = (Button)sender; rtbresult.Text = ""; System.CodeDom.Compiler.CompilerParameters parameters = new CompilerParameters(); //Make sure we generate an EXE, not a DLL parameters.GenerateExecutable = true; parameters.OutputAssembly = Output; CompilerResults results = codeProvider.CompileAssemblyFromSource(parameters, rtbcode.Text); if (results.Errors.Count > 0) { rtbresult.ForeColor = Color.Red; foreach (CompilerError CompErr in results.Errors) { rtbresult.Text = rtbresult.Text + "Line number " + CompErr.Line + ", Error Number: " + CompErr.ErrorNumber + ", '" + CompErr.ErrorText + ";" + Environment.NewLine + Environment.NewLine; } } else { //Successful Compile rtbresult.ForeColor = Color.Blue; rtbresult.Text = "Success!"; //If we clicked run then launch our EXE if (ButtonObject.Text == "Run") Process.Start(Output); // Run button }

    Read the article

  • Header Guard Issues - Getting Swallowed Alive

    - by gjnave
    I'm totally at wit's end: I can't figure out how my dependency issues. I've read countless posts and blogs and reworked my code so many times that I can't even remember what almost worked and what didnt. I continually get not only redefinition errors, but class not defined errors. I rework the header guards and remove some errors simply to find others. I somehow got everything down to one error but then even that got broke while trying to fix it. Would you please help me figure out the problem? card.cpp #include <iostream> #include <cctype> #include "card.h" using namespace std; // ====DECL====== Card::Card() { abilities = 0; flavorText = 0; keywords = 0; artifact = 0; classType = new char[strlen("Card") + 1]; classType = "Card"; } Card::~Card (){ delete name; delete abilities; delete flavorText; artifact = NULL; } // ------------ Card::Card(const Card & to_copy) { name = new char[strlen(to_copy.name) +1]; // creating dynamic array strcpy(to_copy.name, name); type = to_copy.type; color = to_copy.color; manaCost = to_copy.manaCost; abilities = new char[strlen(to_copy.abilities) +1]; strcpy(abilities, to_copy.abilities); flavorText = new char[strlen(to_copy.flavorText) +1]; strcpy(flavorText, to_copy.flavorText); keywords = new char[strlen(to_copy.keywords) +1]; strcpy(keywords, to_copy.keywords); inPlay = to_copy.inPlay; tapped = to_copy.tapped; enchanted = to_copy.enchanted; cursed = to_copy.cursed; if (to_copy.type != ARTIFACT) artifact = to_copy.artifact; } // ====DECL===== int Card::equipArtifact(Artifact* to_equip){ artifact = to_equip; } Artifact * Card::unequipArtifact(Card * unequip_from){ Artifact * to_remove = artifact; artifact = NULL; return to_remove; // put card in hand or in graveyard } int Card::enchant( Card * to_enchant){ to_enchant->enchanted = true; cout << "enchanted" << endl; } int Card::disenchant( Card * to_disenchant){ to_disenchant->enchanted = false; cout << "Enchantment Removed" << endl; } // ========DECL===== Spell::Spell() { currPower = basePower; currToughness = baseToughness; classType = new char[strlen("Spell") + 1]; classType = "Spell"; } Spell::~Spell(){} // --------------- Spell::Spell(const Spell & to_copy){ currPower = to_copy.currPower; basePower = to_copy.basePower; currToughness = to_copy.currToughness; baseToughness = to_copy.baseToughness; } // ========= int Spell::attack( Spell *& blocker ){ blocker->currToughness -= currPower; currToughness -= blocker->currToughness; } //========== int Spell::counter (Spell *& to_counter){ cout << to_counter->name << " was countered by " << name << endl; } // ============ int Spell::heal (Spell *& to_heal, int amountOfHealth){ to_heal->currToughness += amountOfHealth; } // ------- Creature::Creature(){ summoningSick = true; } // =====DECL====== Land::Land(){ color = NON; classType = new char[strlen("Land") + 1]; classType = "Land"; } // ------ int Land::generateMana(int mana){ // ... // } card.h #ifndef CARD_H #define CARD_H #include <cctype> #include <iostream> #include "conception.h" class Artifact; class Spell; class Card : public Conception { public: Card(); Card(const Card &); ~Card(); protected: char* name; enum CardType { INSTANT, CREATURE, LAND, ENCHANTMENT, ARTIFACT, PLANESWALKER}; enum CardColor { WHITE, BLUE, BLACK, RED, GREEN, NON }; CardType type; CardColor color; int manaCost; char* abilities; char* flavorText; char* keywords; bool inPlay; bool tapped; bool cursed; bool enchanted; Artifact* artifact; virtual int enchant( Card * ); virtual int disenchant (Card * ); virtual int equipArtifact( Artifact* ); virtual Artifact* unequipArtifact(Card * ); }; // ------------ class Spell: public Card { public: Spell(); ~Spell(); Spell(const Spell &); protected: virtual int heal( Spell *&, int ); virtual int attack( Spell *& ); virtual int counter( Spell*& ); int currToughness; int baseToughness; int currPower; int basePower; }; class Land: public Card { public: Land(); ~Land(); protected: virtual int generateMana(int); }; class Forest: public Land { public: Forest(); ~Forest(); protected: int generateMana(); }; class Creature: public Spell { public: Creature(); ~Creature(); protected: bool summoningSick; }; class Sorcery: public Spell { public: Sorcery(); ~Sorcery(); protected: }; #endif conception.h -- this is an "uber class" from which everything derives class Conception{ public: Conception(); ~Conception(); protected: char* classType; }; conception.cpp Conception::Conception{ Conception(){ classType = new char[11]; char = "Conception"; } game.cpp -- this is an incomplete class as of this code #include <iostream> #include <cctype> #include "game.h" #include "player.h" Battlefield::Battlefield(){ card = 0; } Battlefield::~Battlefield(){ delete card; } Battlefield::Battlefield(const Battlefield & to_copy){ } // =========== /* class Game(){ public: Game(); ~Game(); protected: Player** player; // for multiple players Battlefield* root; // for battlefield getPlayerMove(); // ask player what to do addToBattlefield(); removeFromBattlefield(); sendAttack(); } */ #endif game.h #ifndef GAME_H #define GAME_H #include "list.h" class CardList(); class Battlefield : CardList{ public: Battlefield(); ~Battlefield(); protected: Card* card; // make an array }; class Game : Conception{ public: Game(); ~Game(); protected: Player** player; // for multiple players Battlefield* root; // for battlefield getPlayerMove(); // ask player what to do addToBattlefield(); removeFromBattlefield(); sendAttack(); Battlefield* field; }; list.cpp #include <iostream> #include <cctype> #include "list.h" // ========== LinkedList::LinkedList(){ root = new Node; classType = new char[strlen("LinkedList") + 1]; classType = "LinkedList"; }; LinkedList::~LinkedList(){ delete root; } LinkedList::LinkedList(const LinkedList & obj) { // code to copy } // --------- // ========= int LinkedList::delete_all(Node* root){ if (root = 0) return 0; delete_all(root->next); root = 0; } int LinkedList::add( Conception*& is){ if (root == 0){ root = new Node; root->next = 0; } else { Node * curr = root; root = new Node; root->next=curr; root->it = is; } } int LinkedList::remove(Node * root, Node * prev, Conception* is){ if (root = 0) return -1; if (root->it == is){ root->next = root->next; return 0; } remove(root->next, root, is); return 0; } Conception* LinkedList::find(Node*& root, const Conception* is, Conception* holder = NULL) { if (root==0) return NULL; if (root->it == is){ return root-> it; } holder = find(root->next, is); return holder; } Node* LinkedList::goForward(Node * root){ if (root==0) return root; if (root->next == 0) return root; else return root->next; } // ============ Node* LinkedList::goBackward(Node * root){ root = root->prev; } list.h #ifndef LIST_H #define LIST_H #include <iostream> #include "conception.h" class Node : public Conception { public: Node() : next(0), prev(0), it(0) { it = 0; classType = new char[strlen("Node") + 1]; classType = "Node"; }; ~Node(){ delete it; delete next; delete prev; } Node* next; Node* prev; Conception* it; // generic object }; // ---------------------- class LinkedList : public Conception { public: LinkedList(); ~LinkedList(); LinkedList(const LinkedList&); friend bool operator== (Conception& thing_1, Conception& thing_2 ); protected: virtual int delete_all(Node*); virtual int add( Conception*& ); // virtual Conception* find(Node *&, const Conception*, Conception* ); // virtual int remove( Node *, Node *, Conception* ); // removes question with keyword int display_all(node*& ); virtual Node* goForward(Node *); virtual Node* goBackward(Node *); Node* root; // write copy constrcutor }; // ============= class CircularLinkedList : public LinkedList { public: // CircularLinkedList(); // ~CircularLinkedList(); // CircularLinkedList(const CircularLinkedList &); }; class DoubleLinkedList : public LinkedList { public: // DoubleLinkedList(); // ~DoubleLinkedList(); // DoubleLinkedList(const DoubleLinkedList &); protected: }; // END OF LIST Hierarchy #endif player.cpp #include <iostream> #include "player.h" #include "list.h" using namespace std; Library::Library(){ root = 0; } Library::~Library(){ delete card; } // ====DECL========= Player::~Player(){ delete fname; delete lname; delete deck; } Wizard::~Wizard(){ delete mana; delete rootL; delete rootH; } // =====Player====== void Player::changeName(const char[] first, const char[] last){ char* backup1 = new char[strlen(fname) + 1]; strcpy(backup1, fname); char* backup2 = new char[strlen(lname) + 1]; strcpy(backup1, lname); if (first != NULL){ fname = new char[strlen(first) +1]; strcpy(fname, first); } if (last != NULL){ lname = new char[strlen(last) +1]; strcpy(lname, last); } return 0; } // ========== void Player::seeStats(Stats*& to_put){ to_put->wins = stats->wins; to_put->losses = stats->losses; to_put->winRatio = stats->winRatio; } // ---------- void Player::displayDeck(const LinkedList* deck){ } // ================ void CardList::findCard(Node* root, int id, NodeCard*& is){ if (root == NULL) return; if (root->it.id == id){ copyCard(root->it, is); return; } else findCard(root->next, id, is); } // -------- void CardList::deleteAll(Node* root){ if (root == NULL) return; deleteAll(root->next); root->next = NULL; } // --------- void CardList::removeCard(Node* root, int id){ if (root == NULL) return; if (root->id = id){ root->prev->next = root->next; // the prev link of root, looks back to next of prev node, and sets to where root next is pointing } return; } // --------- void CardList::addCard(Card* to_add){ if (!root){ root = new Node; root->next = NULL; root->prev = NULL; root->it = &to_add; return; } else { Node* original = root; root = new Node; root->next = original; root->prev = NULL; original->prev = root; } } // ----------- void CardList::displayAll(Node*& root){ if (root == NULL) return; cout << "Card Name: " << root->it.cardName; cout << " || Type: " << root->it.type << endl; cout << " --------------- " << endl; if (root->classType == "Spell"){ cout << "Base Power: " << root->it.basePower; cout << " || Current Power: " << root->it.currPower << endl; cout << "Base Toughness: " << root->it.baseToughness; cout << " || Current Toughness: " << root->it.currToughness << endl; } cout << "Card Type: " << root->it.currPower; cout << " || Card Color: " << root->it.color << endl; cout << "Mana Cost" << root->it.manaCost << endl; cout << "Keywords: " << root->it.keywords << endl; cout << "Flavor Text: " << root->it.flavorText << endl; cout << " ----- Class Type: " << root->it.classType << " || ID: " << root->it.id << " ----- " << endl; cout << " ******************************************" << endl; cout << endl; // ------- void CardList::copyCard(const Card& to_get, Card& put_to){ put_to.type = to_get.type; put_to.color = to_get.color; put_to.manaCost = to_get.manaCost; put_to.inPlay = to_get.inPlay; put_to.tapped = to_get.tapped; put_to.class = to_get.class; put_to.id = to_get.id; put_to.enchanted = to_get.enchanted; put_to.artifact = to_get.artifact; put_to.class = to_get.class; put.to.abilities = new char[strlen(to_get.abilities) +1]; strcpy(put_to.abilities, to_get.abilities); put.to.keywords = new char[strlen(to_get.keywords) +1]; strcpy(put_to.keywords, to_get.keywords); put.to.flavorText = new char[strlen(to_get.flavorText) +1]; strcpy(put_to.flavorText, to_get.flavorText); if (to_get.class = "Spell"){ put_to.baseToughness = to_get.baseToughness; put_to.basePower = to_get.basePower; put_to.currToughness = to_get.currToughness; put_to.currPower = to_get.currPower; } } // ---------- player.h #ifndef player.h #define player.h #include "list.h" // ============ class CardList() : public LinkedList(){ public: CardList(); ~CardList(); protected: virtual void findCard(Card&); virtual void addCard(Card* ); virtual void removeCard(Node* root, int id); virtual void deleteAll(); virtual void displayAll(); virtual void copyCard(const Conception*, Node*&); Node* root; } // --------- class Library() : public CardList(){ public: Library(); ~Library(); protected: Card* card; int numCards; findCard(Card&); // get Card and fill empty template } // ----------- class Deck() : public CardList(){ public: Deck(); ~Deck(); protected: enum deckColor { WHITE, BLUE, BLACK, RED, GREEN, MIXED }; char* deckName; } // =============== class Mana(int amount) : public Conception { public: Mana() : displayTotal(0), classType(0) { displayTotal = 0; classType = new char[strlen("Mana") + 1]; classType = "Mana"; }; protected: int accrued; void add(); void remove(); int displayTotal(); } inline Mana::add(){ accrued += 1; } inline Mana::remove(){ accrued -= 1; } inline Mana::displayTotal(){ return accrued; } // ================ class Stats() : public Conception { public: friend class Player; friend class Game; Stats() : wins(0), losses(0), winRatio(0) { wins = 0; losses = 0; if ( (wins + losses != 0) winRatio = wins / (wins + losses); else winRatio = 0; classType = new char[strlen("Stats") + 1]; classType = "Stats"; } protected: int wins; int losses; float winRatio; void int getStats(Stats*& ); } // ================== class Player() : public Conception{ public: Player() : wins(0), losses(0), winRatio(0) { fname = NULL; lname = NULL; stats = NULL; CardList = NULL; classType = new char[strlen("Player") + 1]; classType = "Player"; }; ~Player(); Player(const Player & obj); protected: // member variables char* fname; char* lname; Stats stats; // holds previous game statistics CardList* deck[]; // hold multiple decks that player might use - put ll in this private: // member functions void changeName(const char[], const char[]); void shuffleDeck(int); void seeStats(Stats*& ); void displayDeck(int); chooseDeck(); } // -------------------- class Wizard(Card) : public Player(){ public: Wizard() : { mana = NULL; rootL = NULL; rootH = NULL}; ~Wizard(); protected: playCard(const Card &); removeCard(Card &); attackWithCard(Card &); enchantWithCard(Card &); disenchantWithCard(Card &); healWithCard(Card &); equipWithCard(Card &); Mana* mana[]; Library* rootL; // Library Library* rootH; // Hand } #endif

    Read the article

< Previous Page | 372 373 374 375 376 377 378 379 380 381 382 383  | Next Page >