Search Results

Search found 19664 results on 787 pages for 'python for ever'.

Page 377/787 | < Previous Page | 373 374 375 376 377 378 379 380 381 382 383 384  | Next Page >

  • How to set the size of a wx.aui.AuiManager Pane that is centered?

    - by aF
    Hello, I have three panes with the InfoPane center option. I want to know how to set their size. Using this code: import wx import wx.aui class MyFrame(wx.Frame): def __init__(self, parent, id=-1, title='wx.aui Test', pos=wx.DefaultPosition, size=(800, 600), style=wx.DEFAULT_FRAME_STYLE): wx.Frame.__init__(self, parent, id, title, pos, size, style) self._mgr = wx.aui.AuiManager(self) # create several text controls text1 = wx.TextCtrl(self, -1, 'Pane 1 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text2 = wx.TextCtrl(self, -1, 'Pane 2 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text3 = wx.TextCtrl(self, -1, 'Main content window', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) # add the panes to the manager self._mgr.AddPane(text1, wx.CENTER) self._mgr.AddPane(text2, wx.CENTER) self._mgr.AddPane(text3, wx.CENTER) # tell the manager to 'commit' all the changes just made self._mgr.Update() self.Bind(wx.EVT_CLOSE, self.OnClose) def OnClose(self, event): # deinitialize the frame manager self._mgr.UnInit() # delete the frame self.Destroy() app = wx.App() frame = MyFrame(None) frame.Show() app.MainLoop() I want to know what is called when we change the size of the panes. If you tell me that, I can do the rest by myself :)

    Read the article

  • SUDS rendering a duplicate node and wrapping everything in it

    - by PylonsN00b
    Here is my code: #Make the SOAP connection url = "https://api.channeladvisor.com/ChannelAdvisorAPI/v1/InventoryService.asmx?WSDL" headers = {'Content-Type': 'text/xml; charset=utf-8'} ca_client_inventory = Client(url, location="https://api.channeladvisor.com/ChannelAdvisorAPI/v1/InventoryService.asmx", headers=headers) #Make the SOAP headers login = ca_client_inventory.factory.create('APICredentials') login.DeveloperKey = 'REMOVED' login.Password = 'REMOVED' #Attach the headers ca_client_inventory.set_options(soapheaders=login) synch_inventory_item_list = ca_client_inventory.factory.create('SynchInventoryItemList') synch_inventory_item_list.accountID = "REMOVED" array_of_inventory_item_submit = ca_client_inventory.factory.create('ArrayOfInventoryItemSubmit') for product in products: inventory_item_submit = ca_client_inventory.factory.create('InventoryItemSubmit') inventory_item_list = get_item_list(product) inventory_item_submit = [inventory_item_list] array_of_inventory_item_submit.InventoryItemSubmit.append(inventory_item_submit) synch_inventory_item_list.itemList = array_of_inventory_item_submit #Call that service baby! ca_client_inventory.service.SynchInventoryItemList(synch_inventory_item_list) Here is what it outputs: <?xml version="1.0" encoding="UTF-8"?> <SOAP-ENV:Envelope xmlns:ns0="http://api.channeladvisor.com/webservices/" xmlns:ns1="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:tns="http://api.channeladvisor.com/webservices/" xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/"> <SOAP-ENV:Header> <tns:APICredentials> <tns:DeveloperKey>REMOVED</tns:DeveloperKey> <tns:Password>REMOVED</tns:Password> </tns:APICredentials> </SOAP-ENV:Header> <ns1:Body> <ns0:SynchInventoryItemList> <ns0:accountID> <ns0:accountID>REMOVED</ns0:accountID> <ns0:itemList> <ns0:InventoryItemSubmit> <ns0:Sku>1872</ns0:Sku> <ns0:Title>The Big Book Of Crazy Quilt Stitches</ns0:Title> <ns0:Subtitle></ns0:Subtitle> <ns0:Description>Embellish the seams and patches of crazy quilt projects with over 75 embroidery stitches and floral motifs. You&apos;ll use this handy reference book again and again to dress up wall hangings, pillows, sachets, clothing, and other nostalgic creations.</ns0:Description> <ns0:Weight>4</ns0:Weight> <ns0:FlagStyle/> <ns0:IsBlocked xsi:nil="true"/> <ns0:ISBN></ns0:ISBN> <ns0:UPC>028906018721</ns0:UPC> <ns0:EAN></ns0:EAN> <ns0:QuantityInfo> <ns0:UpdateType>UnShipped</ns0:UpdateType> <ns0:Total>0</ns0:Total> </ns0:QuantityInfo> <ns0:PriceInfo> <ns0:Cost>0.575</ns0:Cost> <ns0:RetailPrice xsi:nil="true"/> <ns0:StartingPrice xsi:nil="true"/> <ns0:ReservePrice xsi:nil="true"/> <ns0:TakeItPrice>6.95</ns0:TakeItPrice> <ns0:SecondChanceOfferPrice xsi:nil="true"/> <ns0:StorePrice>6.95</ns0:StorePrice> </ns0:PriceInfo> <ns0:ClassificationInfo> <ns0:Name>Books</ns0:Name> <ns0:AttributeList> <ns0:ClassificationAttributeInfo> <ns0:Name>Designer/Author</ns0:Name> <ns0:Value>Patricia Eaton</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Trim Size</ns0:Name> <ns0:Value></ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Binding</ns0:Name> <ns0:Value>Leaflet</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Release Date</ns0:Name> <ns0:Value>11/1/1999 0:00:00</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Skill Level</ns0:Name> <ns0:Value></ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Pages</ns0:Name> <ns0:Value>20</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Projects</ns0:Name> <ns0:Value></ns0:Value> </ns0:ClassificationAttributeInfo> </ns0:AttributeList> </ns0:ClassificationInfo> <ns0:ImageList> <ns0:ImageInfoSubmit> <ns0:PlacementName>ITEMIMAGEURL1</ns0:PlacementName> <ns0:FilenameOrUrl>1872.jpg</ns0:FilenameOrUrl> </ns0:ImageInfoSubmit> </ns0:ImageList> </ns0:InventoryItemSubmit> </ns0:itemList> </ns0:accountID> </ns0:SynchInventoryItemList> </ns1:Body> </SOAP-ENV:Envelope> See how it creates the accountID node twice and wraps the whole thing in it? WHY? How do I make it stop that?!

    Read the article

  • The truth value of an array with more than one element is ambigous when trying to index an array

    - by user1440194
    I am trying to put all elements of rbs into a new array if the elements in var(another numpy array) is =0 and <=.1 . However when I try the following code I get this error: ValueError: The truth value of an array with more than one element is ambiguous. Use a.any() or a.all() rbs = [ish[4] for ish in realbooks] for book in realbooks: var -= float(str(book[0]).replace(":", "")) bidsred = rbs[(var <= .1) and (var >=0)] any ideas on what I'm doing wrong?

    Read the article

  • Most efficient way to update attribute of one instance

    - by Begbie00
    Hi all - I'm creating an arbitrary number of instances (using for loops and ranges). At some event in the future, I need to change an attribute for only one of the instances. What's the best way to do this? Right now, I'm doing the following: 1) Manage the instances in a list. 2) Iterate through the list to find a key value. 3) Once I find the right object within the list (i.e. key value = value I'm looking for), change whatever attribute I need to change. for Instance within ListofInstances: if Instance.KeyValue == SearchValue: Instance.AttributeToChange = 10 This feels really inefficient: I'm basically iterating over the entire list of instances, even through I only need to change an attribute in one of them. Should I be storing the Instance references in a structure more suitable for random access (e.g. dictionary with KeyValue as the dictionary key?) Is a dictionary any more efficient in this case? Should I be using something else? Thanks, Mike

    Read the article

  • Installing twisted.mail.smtp

    - by user3506985
    I am using Ubuntu 14.04 and trying to install twisted.mail.smtp using the following commnands -sudo add-apt-repository ppa:jesstess/twisted-12.1-testing -sudo apt-get update There are no errors in the installation,but when I specify the command that is from twisted.mail.smtp import ESMTPSenderFactory I am getting the following error Error: ImportError: No module named mail.smtp Please help me out

    Read the article

  • Encoding with url and api

    - by user2950824
    So I have this web app set up and running and it works fine for any username that you request, but when i try http://mrcastelo.pythonanywhere.com/lol/euw/Nazaré, it simply doesnt work - the error that I get on the server is the following: iddata= getJSON(urllolbase+region+urlid+username) #SummonerID UnicodeDecodeError: 'ascii' codec can't decode byte 0xc3 in position 5: ordinal not in range(128) It is annoying me greatly, I've tried some other threads but none of them came to a fix. The api that I am using (www.legendaryapi.com) does accept this because this works. Any idea on how to fix this?

    Read the article

  • Prepopulate drop-box according to another drop-box choice in Django Admin

    - by onorua
    I have models like this: class User(models.Model): Switch = models.ForeignKey(Switch, related_name='SwitchUsers') Port = models.ForeignKey(Port) class Switch(models.Model): Name = models.CharField(max_length=50) class Port(models.Model): PortNum = models.PositiveIntegerField() Switch = models.ForeignKey(Switch, related_name = "Ports") When I'm in Admin interface and choose Switch from Switches available, I would like to have Port prepopulated accordingly with Ports from the related Switch. As far as I understand I need to create some JS script to prepopulate it. Unfortunately I don't have this experience, and I would like to keep things simple as it possible and don't rewrite all Django admin interface. Just add this functionality for one Field. Could you please help me with my problem? Thank you.

    Read the article

  • Django says the "id may not be NULL" but why is it?

    - by Oli
    I'm going crazy today. I just tried to insert a new record and it threw back a "post_blogpost.id may not be NULL" error. Here's my model: class BlogPost(models.Model): title = models.CharField(max_length=100) slug = models.SlugField(max_length=100) who = models.ForeignKey(User, default=1) when = models.DateTimeField() intro = models.TextField(blank=True, null=True) content = models.TextField(blank=True, null=True) counter = models.PositiveIntegerField(default=0) published = models.BooleanField(default=False) css = models.TextField(blank=True, null=True) class Meta: ordering = ('-when', 'id') There are a number of functions beneath the model too but I won't include them in full here. Their names are: content_cache_key, clear_cache, __unicode__, reads, read, processed_content. I'm adding through the admin... And I'm running out of hair.

    Read the article

  • Testing InlineFormset clean methods

    - by Rory
    I have a Django project, with 2 models, a Structure and Bracket, the Bracket has a ForeignKey to a Structure (i.e. one-to-many, one Structure has many Brackets). I created a TabularInline for the admin site, so that there would be a table of Brackets on the Structure. I added a custom formset with some a custom clean method to do some extra validation, you can't have a Bracket that conflicts with another Bracket on the same Structure etc. The admin looks like this: class BracketInline(admin.TabularInline): model = Bracket formset = BracketInlineFormset class StructureAdmin(admin.ModelAdmin): inlines = [ BracketInline ] admin.site.register(Structure, StructureAdmin) That all works, and the validation works. However now I want to write some unittest to test my complex formset validation logic. My first attempt to validate known-good values is: data = {'form-TOTAL_FORMS': '1', 'form-INITIAL_FORMS': '0', 'form-MAX_NUM_FORMS': '', 'form-0-field1':'good-value', … } formset = BracketInlineFormset(data) self.assertTrue(formset.is_valid()) However that doesn't work and raises the exception: ====================================================================== ERROR: testValid (appname.tests.StructureTestCase) ---------------------------------------------------------------------- Traceback (most recent call last): File "/paht/to/project/tests.py", line 494, in testValid formset = BracketInlineFormset(data) File "/path/to/django/forms/models.py", line 672, in __init__ self.instance = self.fk.rel.to() AttributeError: 'BracketInlineFormset' object has no attribute 'fk' ---------------------------------------------------------------------- The Django documentation (for formset validation) implies one can do this. How come this isn't working? How do I test the custom clean()/validation for my inline formset?

    Read the article

  • Increasing figure size in Matplotlib

    - by Anirudh
    I am trying to plot a graph from a distance matrix. The code words fine and gives me a image in 800 * 600 pixels. The image being too small, All the nodes are packed together. I want increase the size of the image. so I added the following line to my code - figure(num=None, figsize=(10, 10), dpi=80, facecolor='w', edgecolor='k') After this all I get is a blank 1000 * 1000 image file. My overall code - import networkx as nx import pickle import matplotlib.pyplot as plt print "Reading from pickle." p_file = open('pickles/names') Names = pickle.load(p_file) p_file.close() p_file = open('pickles/distance') Dist = pickle.load(p_file) p_file.close() G = nx.Graph() print "Inserting Nodes." for n in Names: G.add_node(n) print "Inserting Edges." for i in range(601): for j in range(601): G.add_edge(Names[i],Names[j],weight=Dist[i][j]) print "Drawing Graph." nx.draw(G) print "Saving Figure." #plt.figure(num=None, figsize=(10, 10)) plt.savefig('new.png') print "Success!"

    Read the article

  • How do you automatically remove the preview window after autocompletion in Vim?

    - by Ben Davini
    I'm using omnifunc=pythoncomplete. When autocompleting a word (e.g., os.), I get the list of eligible class members and functions, as expected, as well as a scratch buffer preview window with documentation about the selected member or function. This is great, but after selecting the function I want, the preview window remains. I can get rid of it with ":pc", but I'd like it just to automatically disappear after I've selected my function, a la Eclipse. I've played around with "completeopt" but to no avail.

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Django and mod_python intermittent error?

    - by Peter
    I have a Django site at http://sm.rutgers.edu/relive/af_api/index/. It is supposed to display "Home of the relive APIs". If you refresh this page many times, you can see different renderings. 1) The expected page. 2) Django "It worked!" page. 3) "ImportError at /index/" page. If you scroll down enough to ROOT_URLCONF part, you will see it says 'relive.urls'. But apparently, it should be 'af_api.urls', which is in my settings.py file. Since these results happen randomly, is it possible that either Django or mod_python is working unstably?

    Read the article

  • How to write data by dynamic parameter name

    - by Maxim Welikobratov
    I need to be able to write data to datastore of google-app-engine for some known entity. But I don't want write assignment code for each parameter of the entity. I meen, I don't want do like this val_1 = self.request.get('prop_1') val_2 = self.request.get('prop_2') ... val_N = self.request.get('prop_N') item.prop_1 = val_1 item.prop_2 = val_2 ... item.prop_N = val_N item.put() instead, I want to do something like this args = self.request.arguments() for prop_name in args: item.set(prop_name, self.request.get(prop_name)) item.put() dose anybody know how to do this trick?

    Read the article

  • How to reload Django models without losing my locals in an interactive session?

    - by Gj
    I'm doing some research with an interactive shell and using a Django app (shell_plus) for storing data and browsing it using the convenient admin. Occasionally I add or change some of the app models, and run a syncdb (or South migration when changing a model). The changes to the models don't take effect in my interactive session even if I re-import the app models. Thus I'm forced to restart the shell_plus and lose my precious locals() in the process. Is there any way to reload the models during a session? Thanks!!

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • Is multi-level polymorphism possible in SQLAlchemy?

    - by Jace
    Is it possible to have multi-level polymorphism in SQLAlchemy? Here's an example: class Entity(Base): __tablename__ = 'entities' id = Column(Integer, primary_key=True) created_at = Column(DateTime, default=datetime.utcnow, nullable=False) entity_type = Column(Unicode(20), nullable=False) __mapper_args__ = {'polymorphic_on': entity_type} class File(Entity): __tablename__ = 'files' id = Column(None, ForeignKey('entities.id'), primary_key=True) filepath = Column(Unicode(255), nullable=False) file_type = Column(Unicode(20), nullable=False) __mapper_args__ = {'polymorphic_identity': u'file', 'polymorphic_on': file_type) class Image(File): __mapper_args__ = {'polymorphic_identity': u'image'} __tablename__ = 'images' id = Column(None, ForeignKey('files.id'), primary_key=True) width = Column(Integer) height = Column(Integer) When I call Base.metadata.create_all(), SQLAlchemy raises the following error: NotImplementedError: Can't generate DDL for the null type IntegrityError: (IntegrityError) entities.entity_type may not be NULL. This error goes away if I remove the Image model and the polymorphic_on key in File. What gives? (Edited: the exception raised was wrong.)

    Read the article

  • django on appengine

    - by aks
    I am impressed with django.Am am currenty a java developer.I want to make some cool websites for myself but i want to host it in some third pary environmet. Now the question is can i host the django application on appengine?If yes , how?? Are there any site built using django which are already hosted on appengine?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

< Previous Page | 373 374 375 376 377 378 379 380 381 382 383 384  | Next Page >