Search Results

Search found 17448 results on 698 pages for 'regular expressions info'.

Page 383/698 | < Previous Page | 379 380 381 382 383 384 385 386 387 388 389 390  | Next Page >

  • How do I link (dependency) properties in my ViewModel?

    - by mos
    Simplified example: I have an object that models a user. Users have a first name and a last name. The UserViewModel has a dependency property for my Models.User object. In the declaration of the UserView's xaml, I want to bind a couple of TextBlocks to the first and last name properties. What is the correct way to do this? Should I have readonly DependencyProperties for the name fields, and when the dependency property User is set, update them? Can the name fields be regular C# properties instead? Or, should I bind like this: <TextBlock Text="{Binding User.FirstName}" />

    Read the article

  • Scala puts precedence on implicit conversion over "natural" operations... Why? Is this a bug? Or am

    - by Alex R
    This simple test, of course, works as expected: scala var b = 2 b: Int = 2 scala b += 1 scala b res3: Int = 3 Now I bring this into scope: class A(var x: Int) { def +=(y:Int) { this.x += y } } implicit def int2A(i:Int) : A = new A(i) I'm defining a new class and a += operation on it. I never expected this would affect the way my regular Ints behave. But it does: scala var b:Int = 0 b: Int = 0 scala b += 1 scala b res29: Int = 0 scala b += 2 scala b res31: Int = 0 Scala seems to prefer the implicit conversion over the natural += that is already defined to Ints. That leads to several questions... Why? Is this a bug? Is it by design? Is there a work-around (other than not using "+=")? Thanks

    Read the article

  • C# Type comparison

    - by Sean.C
    This has me pooped, is there any reason the following: public abstract class aExtension { public abstract bool LoadExtension(Constants c); // method required in inherit public abstract string AppliesToModule // property required in inherit { get; } public abstract string ExtensionName // property required in inherit { get; } public abstract string ExtensionDescription // property required in inherit { get; } } public class UK : aExtension { public override bool LoadExtension(Constants c) { return true; } public override string AppliesToModule { get { return "string"; } } public override string ExtensionName { get { return "string"; } } public override string ExtensionDescription { get { return "string"; } } } would return false for the following expressions: bool a = t.IsAssignableFrom(aExtension)); bool b = t.BaseType.IsAssignableFrom(aExtension)); bool c = typeof(aExtension).IsAssignableFrom(t); bool d = typeof(aExtension).IsAssignableFrom(t.BaseType); bool e = typeof(aExtension).IsSubclassOf(t); bool f = typeof(aExtension).IsSubclassOf(t.BaseType); bool g = t.IsSubclassOf(typeof(aExtension)); bool h = t.BaseType.IsSubclassOf(typeof(LBT.AdMeter.aExtension)); bool i = t.BaseType.Equals(typeof(aExtension)); bool j = typeof(aExtension).Equals(t.BaseType); T is the reflected Type from the calss UK. Stange thing is i do the exact same thing just on an external assembly in the same application and it works as expected...

    Read the article

  • How to structure data... Sequential or Hierarchical?

    - by Ryan
    I'm going through the exercise of building a CMS that will organize a lot of the common documents that my employer generates each time we get a new sales order. Each new sales order gets a 5 digit number (12222,12223,122224, etc...) but internally we have applied a hierarchy to these numbers: + 121XX |--01 |--02 + 122XX |--22 |--23 |--24 In my table for sales orders, is it better to use the 5 digital number as an ID and populate up or would it be better to use the hierarchical structure that we use when referring to jobs in regular conversation? The only benefit to not populating sequentially seems to be formatting the data later on in my view, but that doesn't sound like a good enough reason to go through the extra work. Thanks

    Read the article

  • How can I test if an input field contains foreign characters?

    - by zeckdude
    I have an input field in a form. Upon pushing submit, I want to validate to make sure the user entered non-latin characters only, so any foreign language characters, like Chinese among many others. Or at the very least test to make sure it does not contain any latin characters. Could I use a regular expression for this? What would be the best approach for this? I am validating in both javaScript and in PHP. What solutions can I use to check for foreign characters in the input field in both programming languages?

    Read the article

  • Using a database/index sequential file independently of the Unix distribution

    - by Helper Method
    What I'm planning to do is a) parse a file for some lines matching a regular expression b) store the match in some sort of database / file so I don't have to do the parsing again and again c) call another program passing the matches as arguments While I can imagine how to do a) and c), I'm a little bit unsure about b). The matches are of the form key:attribute1:attribute2:attribute3 where attribute 2 may be optional. I'm thinking of storing the results in a simple database but the problem is the database needs to available on a number of Unix platform for the program to work. Are there any (simple) databases which can be found on any Unix platforms? Or should I use some sort of index-sequential file?

    Read the article

  • Question in Flex (parser)

    - by shkk
    Hello... I want to ask you a question about Flex, the program for parsing code. Supposing I have an instruction like this one, in the rules part: "=" BEGIN(attribution); <attribution>{var_name} { fprintf(yyout, "="); ECHO; } <attribution>";" BEGIN(INITIAL); {var_name} is a regular expression that matches a variable's name, and all I want to do is to copy at the output all the attribution instructions, such as a = 3; or b = a; My rule though cannot write with fprintf the left member of the attribution, but only = 3; or =a; One solution for that might be that, after I make the match "=" and I am in the attribution state, to go 2 positions back as to get the left operand as well. How can I do that in Flex?

    Read the article

  • XAMPP on windows 7 not working properly

    - by 404Error
    Hey there, I just installed XAMPP lite on Windows 7. I have two drives - C: for the OS and regular files, and an external drive E:. I installed XAMPP lite on E: (on the root), and its been giving me problems. Apache works well enough, but MySQL doesn't work. When I go to http://localhost/phpmyadmin/, it gives me the following error: Error MySQL said: #2003 - Can't connect to MySQL server on 'localhost' (10061) Connection for controluser as defined in your configuration failed. Any ideas as to what could be the problem? I used the zip file for XAMPP lite, the 32 bit version. This is on Windows 7 Home premium. Thanks!

    Read the article

  • open window with dynamic content

    - by julio
    Is it possible to open a window from PHP that has predefined content? It's obvious how you can open a window from a javascript link that frames an existing page, or just do a target=_blank from a regular a tag that references an existing page. But I am generating a bit of content, and want that content to be opened in a new link (or streamed to the viewer)-- something like (clearly psuedo code!): $content = "Hello World. <br />Nice to meet you!"; <a href="#" target="_blank" content=$content>Open up!</a> Is this possible? Thanks!

    Read the article

  • preg_replace or regex string translation

    - by ccolon
    I found some partial help but cannot seem to fully accomplish what I need. I need to be able to do the following: I need an regular expression to replace any 1 to 3 character words between two words that are longer than 3 characters with a match any expression: For example: walk to the beach == walk(.*)beach If the 1 to 3 character word is not preceded by a word that's longer than 3 characters then I want to translate that 1 to 3 letter word to ' ?' For example: on the beach == on ?the ?beach The simpler the rule the better (of course, if there's an alternative more complicated version that's more performant then I'll take that as well as I eventually anticipate heavy usage eventually). This will be used in a PHP context most likely with preg_replace. Thus, if you can put it in that context then even better!

    Read the article

  • boost::function & boost::lambda - call site invocation & accessing _1 and _2 as the type

    - by John Dibling
    Sorry for the confusing title. Let me explain via code: #include <string> #include <boost\function.hpp> #include <boost\lambda\lambda.hpp> #include <iostream> int main() { using namespace boost::lambda; boost::function<std::string(std::string, std::string)> f = _1.append(_2); std::string s = f("Hello", "There"); std::cout << s; return 0; } I'm trying to use function to create a function that uses the labda expressions to create a new return value, and invoke that function at the call site, s = f("Hello", "There"); When I compile this, I get: 1>------ Build started: Project: hacks, Configuration: Debug x64 ------ 1>Compiling... 1>main.cpp 1>.\main.cpp(11) : error C2039: 'append' : is not a member of 'boost::lambda::lambda_functor<T>' 1> with 1> [ 1> T=boost::lambda::placeholder<1> 1> ] Using MSVC 9. My fundamental understanding of function and lambdas may be lacking. The tutorials and docs did not help so far this morning. How do I do what I'm trying to do?

    Read the article

  • JQuery create new select option

    - by nav
    Hi I have the below functions in regular javascript creating select options. Is there a way I can do this with JQuery without having to use the form object? function populate(form) { form.options.length = 0; form.options[0] = new Option("Select a city / town in Sweden",""); form.options[1] = new Option("Melbourne","Melbourne"); } Below is how I call the function above: populate(document.form.county); //county is the id of the dropdownlist to populate. Many Thanks,

    Read the article

  • Just how much do I want to make virtual?

    - by Alex
    I am writing an abstract superclass where literally every method is going to be overridden. There is some default functionality I could implement, but most of the time it's enough to leave the implementation to the subclass writer. Since just about every method is going to be overwritten, how much should I make virtual and how much should I just leave as regular methods? In the current incarnation, everything is virtual, but I still haven't let this loose to anyone to use, so the design is flexible. What advantages/disadvantages are there to virtual functions? Links to good reading material about this would be appreciated.

    Read the article

  • syntax for MySQL INSERT with an array of columns

    - by Mike_Laird
    I'm new to PHP and MySQL query construction. I have a processor for a large form. A few fields are required, most fields are user optional. In my case, the HTML ids and the MySQL column names are identical. I've found tutorials about using arrays to convert $_POST into the fields and values for INSERT INTO, but I can't get them working - after many hours. I've stepped back to make a very simple INSERT using arrays and variables, but I'm still stumped. The following line works and INSERTs 5 items into a database with over 100 columns. The first 4 items are strings, the 5th item, monthlyRental is an integer. $query = "INSERT INTO `$table` (country, stateProvince, city3, city3Geocode, monthlyRental) VALUES ( '$country', '$stateProvince', '$city3', '$city3Geocode', '$monthlyRental')"; When I make an array for the fields and use it, as follows: $colsx = array('country,', 'stateProvince,', 'city3,', 'city3Geocode,', 'monthlyRental'); $query = "INSERT INTO `$table` ('$colsx') VALUES ( '$country', '$stateProvince', '$city3', '$city3Geocode', '$monthlyRental')"; I get a MySQL error - check the manual that corresponds to your MySQL server version for the right syntax to use near ''Array') VALUES ( 'US', 'New York', 'Fairport, Monroe County, New York', '(43.09)' at line 1. I get this error whether the array items have commas inside the single quotes or not. I've done a lot of reading and tried many combinations and I can't get it. I want to see the proper syntax on a small scale before I go back to foreach expressions to process $_POST and both the fields and values are arrays. And yes, I know I should use mysql_real_escape_string, but that is an easy later step in the foreach. Lastly, some clues about the syntax for an array of values would be helpful, particularly if it is different from the fields array. I know I need to add a null as the first array item to trigger the MySQL autoincrement id. What else? I'm pretty new, so please be specific.

    Read the article

  • byte and short data types in Java can accept the value outside the range by explicit cast. The higher data types however can not. Why?

    - by Lion
    Let's consider the following expressions in Java. byte a = 32; byte b = (byte) 250; int i = a + b; This is valid in Java even though the expression byte b = (byte) 250; is forced to assign the value 250 to b which is outside the range of the type byte. Therefore, b is assigned -6 and consequently i is assigned the value 26 through the statement int i = a + b;. The same thing is possible with short as follows. short s1=(short) 567889999; Although the specified value is outside the range of short, this statement is legal. The same thing is however wrong with higher data types such int, double, folat etc and hence, the following case is invalid and causes a compile-time error. int z=2147483648; This is illegal, since the range of int in Java is from -2,147,483,648 to 2147483647 which the above statement exceeds and issues a compile-time error. Why is such not wrong with byte and short data types in Java?

    Read the article

  • boost test case for function taking user input

    - by oadams
    I have a function that takes in user input via std::cin: std::getline(std::cin, in); and creates a corresponding data structure by matching it with a regular expression. The function then returns this data structure. I'm using boost.test and I want to create a unit test to check that the output data type is correct given some inputs. However I don't know how to go about it since the input isn't passed as an argument to the function. EDIT: Is there a simple way to create a boost test case that feeds the function a string via standard input?

    Read the article

  • Change selected value of drop down list with jQuery

    - by Phairoh
    I have a drop down list with known values. What I'm trying to do is set the drop down list to a particular value that I know exists using jQuery. Using regular JavaScript, I would do something like: ddl = document.getElementById("ID of element goes here"); ddl.value = 2; // 2 being the value I want to set it to. However, I need to do this with jQuery because I'm using a CSS class for my selector (stupid ASP.NET client ids...). Here are a few things I've tried: $("._statusDDL").val(2); // doesn't find 2 as a value $("._statusDDL").children("option").val(2) // also failed. How can I do it with jQuery?

    Read the article

  • why does InnoDB keep on growing without for every update?

    - by Akash Kava
    I have a table which consists of heavy blobs, and I wanted to conduct some tests on it. I know deleted space is not reclaimed by innodb, so I decided to reuse existing records by updating its own values instead of createing new records. But I noticed, whether I delete and insert a new entry, or I do UPDATE on existing ROW, InnoDB keeps on growing. Assuming I have 100 Rows, each Storing 500KB of information, My InnoDB size is 10MB, now when I call UPDATE on all rows (no insert/ no delete), the innodb grows by ~8MB for every run I do. All I am doing is I am storing exactly 500KB of data in each row, with little modification, and size of blob is fixed. What can I do to prevent this? I know about optimize table, but I cant do it because on regular usage, the table is going to be 60-100GB big, and running optimize will just stall entire server.

    Read the article

  • actionscript find and convert text to url

    - by gravesit
    I have this script that grabs a twitter feed and displays in a little widget. What I want to do is look at the text for a url and convert that url to a link. public class Main extends MovieClip { private var twitterXML:XML; // This holds the xml data public function Main() { // This is Untold Entertainment's Twitter id. Did you grab yours? var myTwitterID= "username"; // Fire the loadTwitterXML method, passing it the url to your Twitter info: loadTwitterXML("http://twitter.com/statuses/user_timeline/" + myTwitterID + ".xml"); } private function loadTwitterXML(URL:String):void { var urlLoader:URLLoader = new URLLoader(); // When all the junk has been pulled in from the url, we'll fire finishedLoadingXML: urlLoader.addEventListener(Event.COMPLETE, finishLoadingXML); urlLoader.load(new URLRequest(URL)); } private function finishLoadingXML(e:Event = null):void { // All the junk has been pulled in from the xml! Hooray! // Remove the eventListener as a bit of housecleaning: e.target.removeEventListener(Event.COMPLETE, finishLoadingXML); // Populate the xml object with the xml data: twitterXML = new XML(e.target.data); showTwitterStatus(); } private function addTextToField(text:String,field:TextField):void{ /*Regular expressions for replacement, g: replace all, i: no lower/upper case difference Finds all strings starting with "http://", followed by any number of characters niether space nor new line.*/ var reg:RegExp=/(\b(https?|ftp|file):\/\/[-A-Z0-9+&@#\/%?=~_|!:,.;]*[-A-Z0-9+&@#\/%=~_|])/ig; //Replaces Note: "$&" stands for the replaced string. text.replace(reg,"<a href=\"$&\">$&</a>"); field.htmlText=text; } private function showTwitterStatus():void { // Uncomment this line if you want to see all the fun stuff Twitter sends you: //trace(twitterXML); // Prep the text field to hold our latest Twitter update: twitter_txt.wordWrap = true; twitter_txt.autoSize = TextFieldAutoSize.LEFT; // Populate the text field with the first element in the status.text nodes: addTextToField(twitterXML.status.text[0], twitter_txt); }

    Read the article

  • Making simple tabs in android

    - by user2910566
    I am new to Android. I am making a tab Activity that has 3 tabs in it. . I came across reading some interesting articles that tab can be made in three ways:: Regular TabHost Using simple Fragments Using Action Bar Sherlock I have a set of questions Which is a better choice & why ? Which gives more flexibility, efficiency & performance ? Which would be the preferd choice in case of requirement changes happen in future ? My research indicate :: ActionBarsherlock is better ! Is there something better than this ? If so what is it ?

    Read the article

  • Zend Framework: How to handle exceptions in Ajax requests?

    - by understack
    Normally when an exception is thrown, Error controller takes command and displays error page with regular common header and footer. This behavior is not wanted in Ajax request. Because in case of error, whole html page is sent over. And in cases where I'm directly loading the content of http response in a div, this is even more unwanted. Instead in case of Ajax request, I just want to receive 'the actual error' thrown by exception. How can I do this? I think, one dirty way could be: set a var in ajax request and process accordingly. Not a good solution.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • PHP editors for Ubuntu

    - by mepo
    What are the Light weight PHP editors available for ubuntu? And is there a ubuntu version of the Notepad++ editor. For those who haven't used Notepad++, do not confuse it with Notepad.exe. Notepad.exe is the lightweight Windows editor by Microsoft. Notepad++ is an Open Source programmer's text editor for Windows based on SciTE. It has syntax highlighting, code collapsing, language recognition, macro recording, regular expression search and replace across line breaks and in files on disk, copy filenames and paths to clipboard, and many other advance text editing tools. Only the more full-featured editors for Linux would be likely to be suitable replacements for Notepad++. Thanks

    Read the article

  • PHP reg expr. replace ALL URLs except img src URLs

    - by zilveer
    Hi, I have searched but havent been able to find my answer. It follows like: I would like to replace all URL in a string to links except the URLs within img src tag. I have a regular expression for replacing all the URLs to links, but would like it to NOT replace the URLs within img src="" attribute. How can i do this? Here is the code for replacing all URLs: /*** make sure there is an http:// on all URLs ***/ $str = preg_replace("/([^\w\/])(www\.[a-z0-9\-]+\.[a-z0-9\-]+)/i", "$1http://$2",$str); /*** make all URLs links ***/ $str = preg_replace("/([\w]+:\/\/[\w-?&;#~=\.\/\@]+[\w\/])/i","<a target=\"_blank\" href=\"$1\">$1</a>",$str); /Regards

    Read the article

< Previous Page | 379 380 381 382 383 384 385 386 387 388 389 390  | Next Page >