Search Results

Search found 48844 results on 1954 pages for 'first steps'.

Page 386/1954 | < Previous Page | 382 383 384 385 386 387 388 389 390 391 392 393  | Next Page >

  • ontouch - Switching positions of two views(images) in Android

    - by idish
    I've been looking for that 2 days long and haven't found anything related to it. I'll give an example for my goal. Let's say I have 2 images positioned side by side horizontally. I want the user to be able to switch their positions onlongtouch listener. so let's say that the first image was on the left and the second was on the right side, after switching positions between them, the first image would be in the right and the second would be on the left side. Basically, it is just like in the launcher where you can switch apps positions. Please, if anything is not clear for you, I would like to know, and I'll try to explain it better, thank you.

    Read the article

  • xsl:variable xsl:copy-of select

    - by user1901345
    I have the following XML: Picture 1 Picture 2 Picture 3 While this XSL does what is expected (output the attr of the first picture): It seems to be not possible to do the same inside the variable declaration using xsl:copy-of: Curious: If I just select "$FirstPicture" instead of "$FirstPicture/@attr" in the second example, it outputs the text node of Picture 1 as expected... Before you all suggest me to rewrite the code: This is just a simplified test, my real aim is to use a named template to select a node into the variable FirstPicture and reuse it for further selections. I hope someone could help me to understand the behavior or could suggest me a proper way to select a node with code which could be easily reused (the decission which node is the first one is complex in my real application). Thanks.

    Read the article

  • Shall I optimize or let compiler to do that?

    - by Knowing me knowing you
    What is the preferred method of writing loops according to efficiency: Way a) /*here I'm hoping that compiler will optimize this code and won't be calling size every time it iterates through this loop*/ for (unsigned i = firstString.size(); i < anotherString.size(), ++i) { //do something } or maybe should I do it this way: Way b) unsigned first = firstString.size(); unsigned second = anotherString.size(); and now I can write: for (unsigned i = first; i < second, ++i) { //do something } the second way seems to me like worse option for two reasons: scope polluting and verbosity but it has the advantage of being sure that size() will be invoked once for each object. Looking forward to your answers.

    Read the article

  • How do customize the g:sortableColumn?

    - by kakaotalk
    Well, I have one column in my list that I need to customize, the thing is grails' own g:sortable doesn't work. For instance, my first column shows employee ids, then my second column, shows the employees full name where full name is a combination of first name and last name. I got it to work, sorting and all, but when I try to place it in a table with g:sortable, the g:sortable just wouldn't work. I'm thinking about passing params around but it's a bit tricky. Any suggestions? I've looked around the internet, and seems like nothing. :\

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Strange Locking Behaviour in SQL Server 2005

    - by SQL Learner
    Can anyone please tell me why does the following statement inside a given stored procedure returns repeated results even with locks on the rows used by the first SELECT statement? BEGIN TRANSACTION DECLARE @Temp TABLE ( ID INT ) INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue <= 10 INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue >= 5 SELECT * FROM @Temp COMMIT TRANSACTION Any values in SomeTable for which SomeValue is between 5 and 10 will be returned twice, even though they were locked in the first SELECT. I thought that locks were in place for the whole transaction, and so I wasn't expecting the query to return repeated results. Why is this happening?

    Read the article

  • Delegate Example From C# In Depth Confusion

    - by ChloeRadshaw
    I am looking at this example: List<Product> products = Product. GetSampleProducts() ; products.Sort( (first, second) => first.Name.CompareTo(second. Name) ) ; foreach (Product product in products) { Console. WriteLine(product) ; } What function is actually called in the API when you do that? Does the compiler create a class which implemnents the IComparer interface? I thought delegates were anonymous methods - Here it seems to be an anonymous interface implementation which is casuing confusion

    Read the article

  • /dev/null file became regular file

    - by user197719
    In our production server suddenly /dev/null became a regular file and due to this sshd service got stopped and not able to login the server. And also we tried to the below steps to configure back to character device file, rm -rf /dev/null mknod /dev/null c 1 3 As soon as we run the rm command /dev/null is being re-created as a regular file before mknod can run. We can't figure out how this happening and which component is creating this file. So until we solve this issue we are unable to create /dev/null as character device file.

    Read the article

  • Ctrl-t / New-Tab in Internet Explorer 11 on Windows 8.1 Pro Doesn't Work

    - by Atlscrog
    Steps: Open IE on the desktop. Observe that home page opened. Click around (or not) and observe IE works. Either type ctrl-t or click on the new tab area next to current tab. Observe no new tab opens and the current page is now blank. At this point IE is inoperable and requires a restart. It seems to work fine in the Metro interface. I have reset the Internet Options and removed and re-added Internet Explorer under "Turn Windows Features on or off". Help :) Windows 8.1 Pro, 64-bit IE 11 AMD Phenom II X2 560 3.30 GHz 8 GB RAM

    Read the article

  • ipv6 ssh tunnel service for testing?

    - by Geuis
    I need to do some testing on a service that I run to make sure that it can handle ipv6 addresses. Basically, I need to connect to it from an ipv6 address. I've created a tunnel via tunnelbroker.net, but I'm finding the steps required to get a tunnel configured on my machine and router to be a lot of trouble. Given that I'm not a networking specialist and that I haven't had to dig into routing configuration in years, I'd like to know if there's an existing service that I can just ssh into and use it as my ipv6 endpoint. Simply being able to curl or wget from such an endpoint to my service would be more than enough to test what I need. Thanks!

    Read the article

  • objective-c - calling one constructor from another

    - by synic
    Say you had the following two constructors: - (id)initWithTitle:(NSString *)title; - (id)initWithTitle:(NSString *)title page:(NSString *)page; The second constructor is no different from the first, except that it sets up the member variable "page". Since it basically has to do the same thing, is there a way to call the first one from the second one to reduce code duplication, or do you have to set up a third method to do the common tasks? I'm talking about something similar to this, though I doubt this will work: - (id)initWithTitle:(NSString *)_title { if(self = [super init]) { self.title = _title; } return self; } - (id)initWithTitle:(NSString *)_title page:(NSString *)_page { if(self = [self initWithTitle:_title]) { self.page = _page; } return self; }

    Read the article

  • How to deal with delegate method calling back the object who send the message ?

    - by olipion
    I have two object: @protocol ObjectADelegate - (void)objectAfirst:(ObjectA *)obj; - (void)objectAsecond:(ObjectA *)obj; @end @interface ObjectA : NSObject { id<ObjectADelegate> delegate; - (void)callSecond { [self.delegate objectAsecond:self]; } @end @interface ObjectB : NSObject <ObjectADelegate>{ ObjectA *myObjectA; } @implementation ObjectB - (void)objectAfirst:(ObjectA *)obj { // First is finished, do second [obj callSecond]; } - (void)objectASecond:(ObjectA *)obj { // Do my stuff } @end As you can see in the code, when ObjectA send the message objectAfirst to its delegate, objectb use again objectA methods that result in objecta calling back objectb. It means that what first fire objectAfirst is not finished but objectA send the objectAsecond message. Could it be a problem ? Any way to let delay message handling in objectB ? for example, something like using [obj performSelector:@selector(callSecond) afterDelay:0.01]; instead of [obj callSecond]; ?

    Read the article

  • How to convert string to integer?

    - by user1260584
    So I'm having a hard time with my situation and need some advice. I'm trying to convert my two Strings that I have into integers, so that I can use them in math equations. Here is what I tried, however it brings me an error in the app. ' equals.setOnClickListener(new View.OnClickListener() { public void onClick(View arg0) { // TODO Auto-generated method stub num1 = edit.getText().toString(); num2 = edit.getText().toString(); int first = Integer.parseInt(num1); int second = Integer.parseInt(num2); edit.setText(first + second); } }); Is there something that I am doing wrong? Thank you for any help. EDIT: Yes this is Java. num1 and num2 are strings that I have previously named. What do you mean by trim?

    Read the article

  • Should I be using libraries if I'm trying to learn how to program?

    - by CodeJustin.com
    I have been programming "a lot" in the past few months and at first I was trying to find the "easyest" language. Fortunately I realized that it's not about the language, it's about learning HOW to code. I ran into the Stanford lectures online (programming methodology) and I watched them all (around 23 hours total) awhile ago. Then I got into Java ME and programmed about 28.47% of a mobile RPG game (only around 2k lines of code). I feel like I learned a lot from those two experiences compared to previous ones but now that I'm moving into flash/actionscript 3.0 development and I'm finding myself learning like I did when I first started with PHP. I'm not really getting whats under the hood kind of. I'm finding myself using libraries to speed up development time which doesn't seem like a bad thing BUT I personally do not know how to write the libraries myself off hand. So should I be coding everything myself or is it ok to use libraries when you don't even know how to code them?

    Read the article

  • Can I set JFrame's normal size while it is maximized?

    - by icza
    I'd like to set the normal size of a visible JFrame while it is in Frame.MAXIMIZED_BOTH state (by normal size i mean the size of frame when it is in Frame.NORMAL state) . The reason I want to do this is so that when the user un-maximizes the frame, it will have the proper size I want it to be. But if I do so, the window will switch to normal state. If I set the size first, then switch to MAXIMIZED_BOTH state, then I will see a disturbing blink or resize (which I don't want to). I've also tried setting the size first, then changing state to MAXIMIZED_BOTH, and then making it visible, but the state change is deferred if the window is not visible (and will only be executed once it is made visible, also resulting in a visual resize). So what can I do if I want my frame to have a predefined normal size, but I want it to appear maximized?

    Read the article

  • JDBC Pagination

    - by Zeeshan
    Hi, I want to implement pagination using JDBC. The actual thing I want to know is "How can i get first 50 and then next 50 records from database for page 1 and 2 respectively" My Query is Select * from data [data table contains 20,000 rows] For page #1 I get 50 records and for page #2 I want to get next 50 records. How can I implement it efficiently in JDBC? I have searched and found that rs.absolute(row) is the way to skip first page records but it takes some amount of time on large result sets and I don't want to bear this amount of time. Also, I don't want to use rownum and limit + offset in query because these are not good to use in query, I dont know why, still I don't want to use it in query. Can anyone help me how to get limited ResultSet for pagination or is there any way JDBC is giving us?

    Read the article

  • Perform tasks with delay, without delaying web response (ASP.NET)

    - by Tomas Lycken
    I'm working on a feature that needs to send two text messages with a 30 second delay, and it is crucial that both text messages are sent. Currently, this feature is built with ajax requests, that are sent with a 30 second javascript delay, but since this requires the user to have his browser open and left on the same page for at least 30 seconds, it is not a method I like. Instead, I have tried to solve this with threading. This is what I've done: Public Shared Sub Larma() Dim thread As New System.Threading.Thread(AddressOf Larma_Thread) thread.Start() End Sub Private Shared Sub Larma_Thread() StartaLarm() Thread.Sleep(1000 * 30) StoppaLarm() End Sub A web handler calls Larma(), and StartaLarm() and StoppaLarm() are the methods that send the first and second text messages respectively. However, I only get the first text message delivered - the second is never sent. Am I doing something wrong here? I have no deep understanding of how threading works in ASP.NET, so please let me know how to accomplish this.

    Read the article

  • css of pagination links

    - by fusion
    i'd like a basic idea of how to go about formatting the following paging of the search result. this is the paging code: //Create and print the Navigation bar $nav=""; $next = $page+1; $prev = $page-1; if($page > 1) { $nav .= "<div class=\"search_mainpg\"><div class=\"searchpage\" style=\"width:5%;\"><a onclick=\"showPage('','$prev'); return false;\" href=\"$self?page=" . $prev . "&q=" .urlencode($search_result) . "\">< Prev</a></div>"; $first = "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('','1'); return false;\" href=\"$self?page=1&q=" .urlencode($search_result) . "\"> << </a></div>" ; } else { $nav .= "&nbsp;"; $first = "&nbsp;"; } for($i = 1 ; $i <= $numpages ; $i++) { if($i == $page) { $nav .= "<b>$i</b>"; }else{ $nav .= "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('',$i); return false;\" href=\"$self?page=" . $i . "&q=" .urlencode($search_result) . "\">$i</a></div>"; } } if($page < $numpages) { $nav .= "<div class=\"searchpage\" style=\"width:5%;\"><a onclick=\"showPage('','$next'); return false;\" href=\"$self?page=" . $next . "&q=" .urlencode($search_result) . "\">Next ></a></div>"; $last = "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('','$numpages'); return false;\" href=\"$self?page=$numpages&q=" .urlencode($search_result) . "\"> >> </a></div></div>"; } else { $nav .= "&nbsp;"; $last = "&nbsp;"; } echo $first . $nav . $last; currently, it displays like this:

    Read the article

  • Passing data from one viewcontroller to another

    - by user1392515
    I subclassed two view controllers. The first one is supposed to pass data, a NSUrl object to the second one. .m of the first one: NSURL *temp = [NSURL URLWithString:@"http://example.com"]; UIViewController *presentationsFullScreen_ViewController = [self.storyboard instantiateViewControllerWithIdentifier:@"PresentationsFullScreen_ViewController"]; presentationsFullScreen_ViewController.urlToUse = temp; .h of the second one: #import <UIKit/UIKit.h> @interface PresentationsFullScreen_ViewController : UIViewController { NSURL *urlToUse; } @property (nonatomic,retain) NSURL *urlToUse; It is obviously not working and not compiling,telling me essentially that I didn't subclass it and that the property urlToUse is not found on UIViewController. How do I subclass correctly? Thanks!

    Read the article

  • Auto not being recognised by the compiler, what would be the best replacement?

    - by user1719605
    So I have wrote a program that uses auto however the compiler doesn't seem to recognize it, probably it is an earlier compiler. I was wondering for my code, with are suitable variables to fix my code so that I do not need to use the auto keyword? I'm thinking a pointer to a string? or a string iterator, though I am not sure. #include <cstdlib> #include <string> #include <iostream> #include <unistd.h> #include <algorithm> using namespace std; int main(int argc, char* argv[]) { enum MODE { WHOLE, PREFIX, SUFFIX, ANYWHERE, EMBEDDED } mode = WHOLE; bool reverse_match = false; int c; while ((c = getopt(argc, argv, ":wpsaev")) != -1) { switch (c) { case 'w': // pattern matches whole word mode = WHOLE; break; case 'p': // pattern matches prefix mode = PREFIX; break; case 'a': // pattern matches anywhere mode = ANYWHERE; break; case 's': // pattern matches suffix mode = SUFFIX; break; case 'e': // pattern matches anywhere mode = EMBEDDED; break; case 'v': // reverse sense of match reverse_match = true; break; } } argc -= optind; argv += optind; string pattern = argv[0]; string word; int matches = 0; while (cin >> word) { switch (mode) { case WHOLE: if (reverse_match) { if (pattern != word) { matches += 1; cout << word << endl; } } else if (pattern == word) { matches += 1; cout << word << endl; } break; case PREFIX: if (pattern.size() <= word.size()) { auto res = mismatch(pattern.begin(), pattern.end(), word.begin()); if (reverse_match) { if (res.first != word.end()) { matches += 1; cout << word << endl; } } else if (res.first == word.end()) { matches += 1; cout << word << endl; } } break; case ANYWHERE: if (reverse_match) { if (!word.find(pattern) != string::npos) { matches += 1; cout << word << endl; } } else if (word.find(pattern) != string::npos) { matches += 1; cout << word << endl; } break; case SUFFIX: if (pattern.size() <= word.size()) { auto res = mismatch(pattern.rbegin(), pattern.rend(), word.rbegin()); if (reverse_match) { if (res.first != word.rend()) { matches = +1; cout << word << endl; } } else if (res.first == word.rend()) { matches = +1; cout << word << endl; } } break; case EMBEDDED: if (reverse_match) { if (!pattern.find(word) != string::npos) { matches += 1; cout << word << endl;} } else if (pattern.find(word) != string::npos) { matches += 1; cout << word << endl; } break; } } return (matches == 0) ? 1 : 0; } Thanks in advance!

    Read the article

  • Is using a DataSet's column Expression works in background same as manual calculation?

    - by Harikrishna
    I have one datatable which is not bindided and records are coming from the file by parsing it in the datatable dynamically every time. Now there is three columns in the datatable Marks1,Marks2 and FinalMarks. And their types is decimal. Now for making addition of columns Marks1 and Marks2 's records and store it into FinalMarks column,For that what I do is : datatableResult.Columns["FinalMarks"].Expression="Marks1+Marks2"; It's works properly. It can be done in other way also is foreach (DataRow r in datatableResult.Rows) { r["FinalMarks"]=Convert.ToDecimal(r["Marks1"])+Convert.ToDecimal(r["Marks2"]); } Is first approach same as second approach in background means is both approach same or what? EDIT: I want to know that first approach works in background as second approach.

    Read the article

  • it's not possible to loop .click function (To create multipple buttons)

    - by user1542680
    Im Trying to create multiple buttons that each one of them doing something else. It working great outside of the "each" loop, But in the moment I'm inserting the .click function in the .each function it doesn't work... Here is the Code: $.each(data.arr, function(i, s){ html += '<div id="mybtn'+s.id+'"><button class="first">Btn1</button><button class="second">Btn2</button></div>'; var btnclass="#mybtn"+s.id+" .first"; $(btnclass).click(function(){ //do something }); }); Please Let me know what is wrong... Thank you very much!!! Eran.

    Read the article

< Previous Page | 382 383 384 385 386 387 388 389 390 391 392 393  | Next Page >