Search Results

Search found 14657 results on 587 pages for 'portable python'.

Page 387/587 | < Previous Page | 383 384 385 386 387 388 389 390 391 392 393 394  | Next Page >

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • How to display multiple images?

    - by misterwebz
    I'm trying to get multiple image paths from my database in order to display them, but it currently doesn't work. Here's what i'm using: def get_image(self, userid, id): image = meta.Session.query(Image).filter_by(userid=userid) permanent_file = open(image[id].image_path, 'rb') if not os.path.exists(image.image_path): return 'No such file' data = permanent_file.read() permanent_file.close() response.content_type = guess_type(image.image_path)[0] or 'text/plain' return data I'm getting an error regarding this part: image[id].image_path What i want is for Pylons to display several jpg files on 1 page. Any idea how i could achieve this?

    Read the article

  • Get wrong PATH_INFO after rewriting in lighttpd

    - by Satoru.Logic
    In my lighttpd config file, I have a rewrite rule like this: $HTTP["host"] == "sub.example.com" { url.rewrite = ( "^/(.*)" => "/sub/$1" ) } So when a user visits http://sub.example.com, she's actually visiting http://example.com/sub. The problem is that the PATH_INFO seems wrong, URL: http://sub.example.com/extra PATH_INFO: expected: /extra what I get: /sub/extra Now whenever I call request.get_path(), it returns something like http://sub.example.com/sub/extra, which is not what I want. Of course, I can just override the get_path method of the request class, but I wonder if there is a simpler way like changing the lighttpd config?

    Read the article

  • django join-like expansion of queryset

    - by jimbob
    I have a list of Persons each which have multiple fields that I usually filter what's upon, using the object_list generic view. Each person can have multiple Comments attached to them, each with a datetime and a text string. What I ultimately want to do is have the option to filter comments based on dates. class Person(models.Model): name = models.CharField("Name", max_length=30) ## has ~30 other fields, usually filtered on as well class Comment(models.Model): date = models.DateTimeField() person = models.ForeignKey(Person) comment = models.TextField("Comment Text", max_length=1023) What I want to do is get a queryset like Person.objects.filter(comment__date__gt=date(2011,1,1)).order_by('comment__date') send that queryset to object_list and be able to only see the comments ordered by date with only so many objects on a page. E.g., if "Person A" has comments 12/3/11, 1/2/11, 1/5/11, "Person B" has no comments, and person C has a comment on 1/3, I would see: "Person A", 1/2 - comment "Person C", 1/3 - comment "Person A", 1/5 - comment I would strongly prefer not to have to switch to filtering based on Comments.objects.filter(), as that would make me have to largely repeat large sections of code in the both the view and template. Right now if I tried executing the following command, I will get a queryset returning (PersonA, PersonC, PersonA), but if I try rendering that in a template each persons comment_set will contain all their comments even if they aren't in the date range. Ideally they're would be some sort of functionality where I could expand out a Person queryset's comment_set into a larger queryset that can be sorted and ordered based on the comment and put into a object_list generic view. This normally is fairly simple to do in SQL with a JOIN, but I don't want to abandon the ORM, which I use everywhere else.

    Read the article

  • ahow can I resolve Django Error: str' object has no attribute 'autoescape'?

    - by Angelbit
    Hi have tried to create a inclusion tag on Django but don't work and return str' object has no attribute 'autoescape' this is the code of custom tag: from django import template from quotes.models import Quotes register = template.Library() def show_quote(): quote = Quotes.objects.values('quote', 'author').get(id=0) return {'quote': quote['quote']} register.inclusion_tag('quotes.html')(show_quote) EDIT: Quote class from django.db import models class Quotes(models.Model): quote = models.CharField(max_length=255) author = models.CharField(max_length=100) class Meta: db_table = 'quotes' quotes.html <blockquote id="quotes">{{ quote }}</blockquote>

    Read the article

  • Making only one task run at a time in celerybeat

    - by Noufal Ibrahim
    I have a task which I execute once a minute using celerybeat. It works fine. Sometimes though, the task takes a few seconds more than a minute to run because of which two instances of the task run. This leads to some race conditions that mess things up. I can (and probably should) fix my task to work properly but I wanted to know if celery has any builtin ways to ensure this. My cursory Google searches and RTFMs yielded no results.

    Read the article

  • Why is django.test.client.Client not keeping me logged in.

    - by Mystic
    I'm using django.test.client.Client to test whether some text shows up when a user is logged in. However, I the Client object doesn't seem to be keeping me logged in. This test passes if done manually with Firefox but not when done with the Client object. class Test(TestCase): def test_view(self): user.set_password(password) user.save() client = self.client # I thought a more manual way would work, but no luck # client.post('/login', {'username':user.username, 'password':password}) login_successful = client.login(username=user.username, password=password) # this assert passes self.assertTrue(login_successful) response = client.get("/path", follow=True) #whether follow=True or not doesn't seem to work self.assertContains(response, "needle" ) When I print response it returns the login form that is hidden by: {% if not request.user.is_authenticated %} ... form ... {% endif %} This is confirmed when I run ipython manage.py shell. The problem seems to be that the Client object is not keeping the session authenticated.

    Read the article

  • What's the straightforward way to implement one to many editing in list_editable in django admin?

    - by Nate Pinchot
    Given the following models: class Store(models.Model): name = models.CharField(max_length=150) class ItemGroup(models.Model): group = models.CharField(max_length=100) code = models.CharField(max_length=20) class ItemType(models.Model): store = models.ForeignKey(Store, on_delete=models.CASCADE, related_name="item_types") item_group = models.ForeignKey(ItemGroup) type = models.CharField(max_length=100) Inline's handle adding multiple item_types to a Store nicely when viewing a single Store. The content admin team would like to be able to edit stores and their types in bulk. Is there a simple way to implement Store.item_types in list_editable which also allows adding new records, similar to horizontal_filter? If not, is there a straightforward guide that shows how to implement a custom list_editable template? I've been Googling but haven't been able to come up with anything. Also, if there is a simpler or better way to set up these models that would make this easier to implement, feel free to comment.

    Read the article

  • What can I use the Google App Engine for?

    - by Sergio Boombastic
    This question possibly doesn't belong here. We'll see how the answers pan out, if this doesn't belong here please move it to where it belongs. I'm following the getting started guide for Google App Engine, and I'm seeing what it can and can't do. Basically, I'm seeing it's very similar to an MVC pattern. You create your model, then create a View that uses that Model to display information. Not only that, but it uses a controller of some kind in this fashion: application = webapp.WSGIApplication( [('/', MainPage)], debug=True) My question is, why would you use this Google App Engine if it's the same as using a number of other MVC frameworks? Is the only benefit you gain the load balancing being handled by Google automagically? What is a good example of something you would need the App Engine for? I'm trying to learn, so thanks for the discussion.

    Read the article

  • Trying to output a list using class

    - by captain morgan
    Am trying to get the moving average of a price..but i keep getting an attribute error in my Moving_Average class. ('Moving_Average' object has no attribute 'days'). Here is what I have: class Moving_Average: def calculation(self, alist:list,days:int): m = self.days prices = alist[1::2] average = [0]* len(prices) signal = ['']* len(prices) for m in range(0,len(prices)-days+1): average[m+2] = sum(prices[m:m+days])/days if prices[m+2] < average[m+2]: signal[m+2]='SELL' elif prices[m+2] > average[m+2] and prices[m+1] < average[m+1]: signal[m+2]='BUY' else: signal[m+2] ='' return average,signal def print_report(symbol:str,strategy:str): print('SYMBOL: ', symbol) print('STRATEGY: ', strategy) print('Date Closing Strategy Signal') def user(): strategy = ''' Which of the following strategy would you like to use? * Simple Moving Average [S] * Directional Indicator[D] Please enter your choice: ''' if signal_strategy in 'Ss': days = input('Please enter the number of days for the average') days = int(days) strategy = 'Simple Moving Average {}-days'.format(str(days)) m = Moving_Average() ma = m.calculation(gg, days) print(ma) gg is an list that contains date and prices. [2013-10-01,60,2013-10-02,60] The output is supposed to look like: Date Price Average Signal 2013-10-01 60.0 2013-10-02 60.0 60.00 BUY

    Read the article

  • SQLAlchemy: a better way for update with declarative?

    - by hadrien
    I am a SQLAlchemy noob. Let's say I have an user table in declarative mode: class User(Base): __tablename__ = 'user' id = Column(u'id', Integer(), primary_key=True) name = Column(u'name', String(50)) When I know user's id without object loaded into session, I update such user like this: ex = update(User.__table__).where(User.id==123).values(name=u"Bob Marley") Session.execute(ex) I dislike using User.__table__, should I stop worrying with that? Is there a better way to do this? Thanx!

    Read the article

  • Sending message from one server to another in Twisted

    - by Casey Patton
    I've implemented my servers in the following way: def makeServer(application, port): factory = protocol.ServerFactory() factory.protocol = MyChat factory.clients = [] internet.TCPServer(port, factory).setServiceParent(application) application = service.Application("chatserver") server1 = makeServer(application, port=1025) server2 = makeServer(application, port=1026) server3 = makeServer(application, port=1027) Note that MyChat is an event handling class that has a "receiveMessage" action: def lineReceived(self, line): print "received", repr(line) for c in self.factory.clients: c.transport.write(message + '\n') I want server1 to be able to pass messages to server2. Rather, I want server1 to be treated as a client of server2. If server1 receives the message "hi" then I want it to send that same exact message to server2. How can I accomplish this?

    Read the article

  • Regex and unicode

    - by dbr
    I have a script that parses the filenames of TV episodes (show.name.s01e02.avi for example), grabs the episode name (from the www.thetvdb.com API) and automatically renames them into something nicer (Show Name - [01x02].avi) The script works fine, that is until you try and use it on files that have Unicode show-names (something I never really thought about, since all the files I have are English, so mostly pretty-much all fall within [a-zA-Z0-9'\-]) How can I allow the regular expressions to match accented characters and the likes? Currently the regex's config section looks like.. config['valid_filename_chars'] = """0123456789abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ!@£$%^&*()_+=-[]{}"'.,<>`~? """ config['valid_filename_chars_regex'] = re.escape(config['valid_filename_chars']) config['name_parse'] = [ # foo_[s01]_[e01] re.compile('''^([%s]+?)[ \._\-]\[[Ss]([0-9]+?)\]_\[[Ee]([0-9]+?)\]?[^\\/]*$'''% (config['valid_filename_chars_regex'])), # foo.1x09* re.compile('''^([%s]+?)[ \._\-]\[?([0-9]+)x([0-9]+)[^\\/]*$''' % (config['valid_filename_chars_regex'])), # foo.s01.e01, foo.s01_e01 re.compile('''^([%s]+?)[ \._\-][Ss]([0-9]+)[\.\- ]?[Ee]([0-9]+)[^\\/]*$''' % (config['valid_filename_chars_regex'])), # foo.103* re.compile('''^([%s]+)[ \._\-]([0-9]{1})([0-9]{2})[\._ -][^\\/]*$''' % (config['valid_filename_chars_regex'])), # foo.0103* re.compile('''^([%s]+)[ \._\-]([0-9]{2})([0-9]{2,3})[\._ -][^\\/]*$''' % (config['valid_filename_chars_regex'])), ]

    Read the article

  • Can you change/redirect a django form's function by passing in your own function?

    - by Derek
    I'm dealing with django-paypal and want to change the button src images. So I went the the conf.py file in the source and edited the src destination. However, I really want to leave the source alone, and I noticed that the class PayPalPaymentsForm(forms.Form): has def get_image(self): return { (True, self.SUBSCRIBE): SUBSCRIPTION_SANDBOX_IMAGE, (True, self.BUY): SANDBOX_IMAGE, (True, self.DONATE): DONATION_SANDBOX_IMAGE, (False, self.SUBSCRIBE): SUBSCRIPTION_IMAGE, (False, self.BUY): IMAGE, (False, self.DONATE): DONATION_IMAGE, }[TEST, self.button_type] which handles all the image src destinations. Since changing this def in the source is worse than changing conf, I was wondering if there was a way to pass in customized defs you make like passing in initial arguments in forms? This way no source code is changed, and I can customize the get_image def as much as I need. passing in def something like this? def get_image(self): .... .... paypal = { 'amount': 10, 'item_name': 'test1', 'item_number': 'test1_slug', # PayPal wants a unique invoice ID 'invoice': str(uuid.uuid4()), } form = PayPalPaymentsForm(initial=paypal, get_image) Thanks!

    Read the article

  • Does urllib2.urlopen() actually fetch the page?

    - by beagleguy
    hi all, I was condering when I use urllib2.urlopen() does it just to header reads or does it actually bring back the entire webpage? IE does the HTML page actually get fetch on the urlopen call or the read() call? handle = urllib2.urlopen(url) html = handle.read() The reason I ask is for this workflow... I have a list of urls (some of them with short url services) I only want to read the webpage if I haven't seen that url before I need to call urlopen() and use geturl() to get the final page that link goes to (after the 302 redirects) so I know if I've crawled it yet or not. I don't want to incur the overhead of having to grab the html if I've already parsed that page. thanks!

    Read the article

  • Django save method

    - by Marijus
    So I have a model with a FileField for excel spreadsheet. What I need to do this add another column in this spreadsheet, in each row let user pick from a drop-down list then save it and display it in html. All the picking and uploading will happen through the admin interface. So I have figured out way how to display a spreadsheet in html, however I have no idea how to write this save method. I could really use some hints and tips..

    Read the article

  • PyGTK: Trouble with size of ScrolledWindow

    - by canavanin
    Hi everyone! I am using PyGTK and the gtk.Assistant. On one page I have placed a treeview (one column, just strings) in a gtk.ScrolledWindow (I wanted the vertical scrollbar, since the list contains about 35 items). Everything is working fine; the only thing that bugs me is that I have not been able to figure out from the documentation how to set the size of the scrolled window. Currently only three items are displayed at a time; I would like to set this number to 10 or so. Below is the code. As you can see I have tried using a gtk.Adjustment to influence the scrolled window's size, but as - once more - I have been incompetent at retrieving the required info from the documentation, I don't actually know what values should be put into there. self.page7 = gtk.VBox() # The gtk.Adjustment: page_size = gtk.Adjustment(lower=10, page_size=100) # just used some arbitrary numbers here >_< scrolled_win = gtk.ScrolledWindow(page_size) scrolled_win.set_policy(gtk.POLICY_AUTOMATIC, gtk.POLICY_AUTOMATIC) # only display scroll bars when required self.character_traits_treeview = gtk.TreeView() self.character_traits_treestore = gtk.TreeStore(str) self.character_traits_treeview.set_model(self.character_traits_treestore) tc = gtk.TreeViewColumn("Character traits") self.character_traits_treeview.append_column(tc) cr = gtk.CellRendererText() tc.pack_start(cr, True) tc.add_attribute(cr, "text", 0) self.character_trait_selection = self.character_traits_treeview.get_selection() self.character_trait_selection.connect('changed', self.check_number_of_character_trait_selections) self.character_trait_selection.set_mode(gtk.SELECTION_MULTIPLE) self.make_character_traits_treestore() # adding the treeview to the scrolled window: scrolled_win.add(self.character_traits_treeview) self.page7.pack_start(scrolled_win, False, False, 0) self.assistant.append_page(self.page7) self.assistant.set_page_title(self.page7, "Step 7: Select 2-3 character traits") self.assistant.set_page_type(self.page7, gtk.ASSISTANT_PAGE_CONTENT) self.assistant.set_page_complete(self.page7, False) def check_number_of_character_trait_selections(self, blah): # ... def make_character_traits_treestore(self): # ... I know I should RTFM, but as I can't make head or tail of it, and as further searching, too, has been to no avail, I'm just hoping that someone on here can give me a hint. Thanks a lot in advance! PS: Here are the links to: the gtk.ScrolledWindow documentation the gtk.Adjustment documentation

    Read the article

  • Distance between numpy arrays, columnwise

    - by Jaapsneep
    I have 2 arrays in 2D, where the column vectors are feature vectors. One array is of size F x A, the other of F x B, where A << B. As an example, for A = 2 and F = 3 (B can be anything): arr1 = np.array( [[1, 4], [2, 5], [3, 6]] ) arr2 = np.array( [[1, 4, 7, 10, ..], [2, 5, 8, 11, ..], [3, 6, 9, 12, ..]] ) I want to calculate the distance between arr1 and a fragment of arr2 that is of equal size (in this case, 3x2), for each possible fragment of arr2. The column vectors are independent of each other, so I believe I should calculate the distance between each column vector in arr1 and a collection of column vectors ranging from i to i + A from arr2 and take the sum of these distances (not sure though). Does numpy offer an efficient way of doing this, or will I have to take slices from the second array and, using another loop, calculate the distance between each column vector in arr1 and the corresponding column vector in the slice?

    Read the article

  • How to override inner class methods if the inner class is defined as a property of the top class

    - by Maddy
    I have a code snippet like this class A(object): class b: def print_hello(self): print "Hello world" b = property(b) And I want to override the inner class b (please dont worry about the lowercase name) behaviour. Say, I want to add a new method or I want to change an existing method, like: class C(A): class b(A.b): def print_hello(self): print "Inner Class: Hello world" b = property(b) Now if I create C's object as c = C(), and call c.b I get TypeError: 'property' object is not callable error. How would I get pass this and call print_hello of the extended inner class? Disclaimer: I dont want to change the code for A class.

    Read the article

  • Can some explain why this wont draw a circle? It is drawing roughly 3/4?

    - by Brandon Shockley
    If we want to use n small lines to outline our circle then we can just divide both the circumference and 360 degrees by n (i.e , (2*pi*r)/n and 360/n). Did I not do that? import turtle, math window = turtle.Screen() window.bgcolor('blue') body = turtle.Turtle() body.pencolor('black') body.fillcolor('white') body.speed(10) body.width(3) body.hideturtle() body.up() body.goto(0, 200) lines = 40 toprad = 40 top_circum = 2 * math.pi * toprad sol = top_circum / lines circle = 360 / lines for stops in range(lines): body.pendown() body.left(sol) body.forward(circle) window.exitonclick()

    Read the article

  • virtualenvwrapper .hook problem

    - by Wraith
    I've used virtualenvwrapper, but I'm having problems running it on a new computer. My .bashrc file is updated per the instructions: export WORKON_HOME=$DEV_HOME/projects source /usr/local/bin/virtualenvwrapper.sh But when source is run, I get the following: bash: /25009.hook: Permission denied bash: /25009.hook: No such file or directory This previous post leads me to believe the filename is being recycled and locked because virtualenvwrapper.sh uses $$. Is there any way to fix this?

    Read the article

  • Images to video - converting to IplImage makes video blue

    - by user891908
    I want to create a video from images using opencv. The strange problem is that if i will write image (bmp) to disk and then load (cv.LoadImage) it it renders fine, but when i try to load image from StringIO and convert it to IplImage, it turns video to blue. Heres the code: import StringIO output = StringIO.StringIO() FOREGROUND = (0, 0, 0) TEXT = 'MY TEXT' font_path = 'arial.ttf' font = ImageFont.truetype(font_path, 18, encoding='unic') text = TEXT.decode('utf-8') (width, height) = font.getsize(text) # Create with background with place for text w,h=(600,600) contentimage=Image.open('0.jpg') background=Image.open('background.bmp') x, y = contentimage.size # put content onto background background.paste(contentimage,(((w-x)/2),0)) draw = ImageDraw.Draw(background) draw.text((0,0), text, font=font, fill=FOREGROUND) pi = background pi.save(output, "bmp") #pi.show() #shows image in full color output.seek(0) pi= Image.open(output) print pi, pi.format, "%dx%d" % pi.size, pi.mode cv_im = cv.CreateImageHeader(pi.size, cv.IPL_DEPTH_8U, 3) cv.SetData(cv_im, pi.tostring()) print pi.size, cv.GetSize(cv_im) w = cv.CreateVideoWriter("2.avi", cv.CV_FOURCC('M','J','P','G'), 1,(cv.GetSize(cv_im)[0],cv.GetSize(cv_im)[1]), is_color=1) for i in range(1,5): cv.WriteFrame(w, cv_im) del w

    Read the article

< Previous Page | 383 384 385 386 387 388 389 390 391 392 393 394  | Next Page >