Search Results

Search found 14657 results on 587 pages for 'portable python'.

Page 386/587 | < Previous Page | 382 383 384 385 386 387 388 389 390 391 392 393  | Next Page >

  • Can you change/redirect a django form's function by passing in your own function?

    - by Derek
    I'm dealing with django-paypal and want to change the button src images. So I went the the conf.py file in the source and edited the src destination. However, I really want to leave the source alone, and I noticed that the class PayPalPaymentsForm(forms.Form): has def get_image(self): return { (True, self.SUBSCRIBE): SUBSCRIPTION_SANDBOX_IMAGE, (True, self.BUY): SANDBOX_IMAGE, (True, self.DONATE): DONATION_SANDBOX_IMAGE, (False, self.SUBSCRIBE): SUBSCRIPTION_IMAGE, (False, self.BUY): IMAGE, (False, self.DONATE): DONATION_IMAGE, }[TEST, self.button_type] which handles all the image src destinations. Since changing this def in the source is worse than changing conf, I was wondering if there was a way to pass in customized defs you make like passing in initial arguments in forms? This way no source code is changed, and I can customize the get_image def as much as I need. passing in def something like this? def get_image(self): .... .... paypal = { 'amount': 10, 'item_name': 'test1', 'item_number': 'test1_slug', # PayPal wants a unique invoice ID 'invoice': str(uuid.uuid4()), } form = PayPalPaymentsForm(initial=paypal, get_image) Thanks!

    Read the article

  • How to give points for each indices of list

    - by Eric Jung
    def voting_borda(rank_ballots): '''(list of list of str) -> tuple of (str, list of int) The parameter is a list of 4-element lists that represent rank ballots for a single riding. The Borda Count is determined by assigning points according to ranking. A party gets 3 points for each first-choice ranking, 2 points for each second-choice ranking and 1 point for each third-choice ranking. (No points are awarded for being ranked fourth.) For example, the rank ballot shown above would contribute 3 points to the Liberal count, 2 points to the Green count and 1 point to the CPC count. The party that receives the most points wins the seat. Return a tuple where the first element is the name of the winning party according to Borda Count and the second element is a four-element list that contains the total number of points for each party. The order of the list elements corresponds to the order of the parties in PARTY_INDICES.''' #>>> voting_borda([['GREEN','NDP', 'LIBERAL', 'CPC'], ['GREEN','CPC','LIBERAL','NDP'], ['LIBERAL','NDP', 'CPC', 'GREEN']]) #('GREEN',[4, 6, 5, 3]) list_of_party_order = [] for sublist in rank_ballots: for party in sublist[0]: if party == 'GREEN': GREEN_COUNT += 3 elif party == 'NDP': NDP_COUNT += 3 elif party == 'LIBERAL': LIBERAL_COUNT += 3 elif party == 'CPC': CPC_COUNT += 3 for party in sublist[1]: if party == 'GREEN': GREEN_COUNT += 2 elif party == 'NDP': NDP_COUNT += 2 elif party == 'LIBERAL': LIBERAL_COUNT += 2 elif party == 'CPC': CPC_COUNT += 2 for party in sublist[2]: if party == 'GREEN': GREEN_COUNT += 1 elif party == 'NDP': NDP_COUNT += 1 elif party == 'LIBERAL': LIBERAL_COUNT += 1 elif party == 'CPC': CPC_COUNT += 1 I don't know how I would give points for each indices of the list MORE SIMPLY. Can someone please help me? Without being too complicated. Thank you!

    Read the article

  • Distance between numpy arrays, columnwise

    - by Jaapsneep
    I have 2 arrays in 2D, where the column vectors are feature vectors. One array is of size F x A, the other of F x B, where A << B. As an example, for A = 2 and F = 3 (B can be anything): arr1 = np.array( [[1, 4], [2, 5], [3, 6]] ) arr2 = np.array( [[1, 4, 7, 10, ..], [2, 5, 8, 11, ..], [3, 6, 9, 12, ..]] ) I want to calculate the distance between arr1 and a fragment of arr2 that is of equal size (in this case, 3x2), for each possible fragment of arr2. The column vectors are independent of each other, so I believe I should calculate the distance between each column vector in arr1 and a collection of column vectors ranging from i to i + A from arr2 and take the sum of these distances (not sure though). Does numpy offer an efficient way of doing this, or will I have to take slices from the second array and, using another loop, calculate the distance between each column vector in arr1 and the corresponding column vector in the slice?

    Read the article

  • How would make this run with an if statement and one for loop?

    - by Nick Jacobs
    I'm trying to get this to run by using an if statment, a for loop, and a list. The list is part of the parameters. I am not sure how to write the if statement and have the program loop through all of the different words and set everything how it is supposed to be. newSndIdx=0; for i in range (8700, 12600+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx +=1 newSndIdx=newSndIdx+500 for i in range (15700, 17600+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx +=1 newSndIdx=newSndIdx+500 for i in range (18750, 22350+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx +=1 newSndIdx=newSndIdx+500 for i in range (23700, 27250+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx +=1 newSndIdx=newSndIdx+500 for i in range (106950, 115300+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx+=1

    Read the article

  • Trie Backtracking in Recursion

    - by Darksky
    I am building a tree for a spell checker with suggestions. Each node contains a key (a letter) and a value (array of letters down that path). So assume the following sub-trie in my big trie: W / \ a e | | k k | | is word--> e e | ... This is just a subpath of a sub-trie. W is a node and a and e are two nodes in its value array etc... At each node, I check if the next letter in the word is a value of the node. I am trying to support mistyped vowels for now. So 'weke' will yield 'wake' as a suggestion. Here's my searchWord function in my trie: def searchWord(self, word, path=""): if len(word) > 0: key = word[0] word = word[1:] if self.values.has_key(key): path = path + key nextNode = self.values[key] return nextNode.searchWord(word, path) else: # check here if key is a vowel. If it is, check for other vowel substitutes else: if self.isWord: return path # this is the word found else: return None Given 'weke', at the end when word is of length zero and path is 'weke', my code will hit the second big else block. weke is not marked as a word and so it will return with None. This will return out of searchWord with None. To avoid this, at each stack unwind or recursion backtrack, I need to check if a letter is a vowel and if it is, do the checking again. I changed the if self.values.has_key(key) loop to the following: if self.values.has_key(key): path = path + key nextNode = self.values[key] ret = nextNode.searchWord(word, path) if ret == None: # check if key == vowel and replace path # return nextNode.searchWord(... return ret What am I doing wrong here? What can I do when backtracking to achieve what I'm trying to do?

    Read the article

  • Is there a functional way to do this?

    - by Ishpeck
    def flattenList(toFlatten): final=[] for el in toFlatten: if isinstance(el, list): final.extend(flattenList(el)) else: final.append(el) return final When I don't know how deeply the lists will nest, this is the only way I can think to do this. 2

    Read the article

  • remove border of a gtk.button

    - by spanctus
    Hi, I want to remove the border of the gtk.button, but i Don't know how to do it. I tried with : button = gtk.Button() button.set_style("inner-border",0) but i have an error : the property doesn't exist. I tried too to create a new gtk.Style and use it for the button, but same error. Anyone has an idea ? Thanks

    Read the article

  • Moving a turtle to the center of a circle.

    - by Maggie
    I've just started using the turtle graphics program, but I can't figure out how to move the turtle automatically to the center of a circle (no matter where the circle is located) without it drawing any lines. I thought I could use the goto.() function but it's too specific and I need something general.

    Read the article

  • any faster alternative??

    - by kaushik
    cost=0 for i in range(12): cost=cost+math.pow(float(float(q[i])-float(w[i])),2) cost=(math.sqrt(cost)) Any faster alternative to this? i am need to improve my entire code so trying to improve each statements performance. thanking u

    Read the article

  • any faster alternative??

    - by kaushik
    I have to read a file from a particular line number and i know the line number say "n": i have been thinking of two choice: 1)for i in range(n) fname.readline() k=readline() print k 2)i=0 for line in fname: dictionary[i]=line i=i+1 but i want to know faster alternative as i might have to perform this on different files 20000 times. is there is any other better alternatives?? thanking u

    Read the article

  • Application closes on Nokia E71 when using urllib.urlopen

    - by sammr
    Hello, Im running the following code on my Nokia E71. But after the text input, the program closes abruptly. I have a GPRS connection on my phone,but i still seem to be having some problem with urllib.urlopen The code is as follows : import appuifw,urllib amountInDollars = appuifw.query(u"Enter amount in Dollars","text") data=urllib.urlopen("http://www.google.com").read() appuifw.note(u"Hey","info") Any way to fix this problem ? Thank You

    Read the article

  • Use Regular expression with fileinput

    - by chrissygormley
    Hello, I am trying to replace a variable stored in another file using regular expression. The code I have tried is: r = re.compile(r"self\.uid\s*=\s*('\w{12})'") for line in fileinput.input(['file.py'], inplace=True): print line.replace(r.match(line), sys.argv[1]), The format of the variable in the file is: self.uid = '027FC8EBC2D1' I am trying to pass in a parameter in this format and use regular expression to verify that the sys.argv[1] is correct format and to find the variable stored in this file and replace it with the new variable. Can anyone help. Thanks for the help.

    Read the article

  • SQLAlchemy introspection of ORM classes/objects

    - by Adam Batkin
    I am looking for a way to introspect SQLAlchemy ORM classes/entities to determine the types and other constraints (like maximum lengths) of an entity's properties. For example, if I have a declarative class: class User(Base): __tablename__ = "USER_TABLE" id = sa.Column(sa.types.Integer, primary_key=True) fullname = sa.Column(sa.types.String(100)) username = sa.Column(sa.types.String(20), nullable=False) password = sa.Column(sa.types.String(20), nullable=False) created_timestamp = sa.Column(sa.types.DateTime, nullable=False) I would want to be able to find out that the 'fullname' field should be a String with a maximum length of 100, and is nullable. And the 'created_timestamp' field is a DateTime and is not nullable.

    Read the article

  • Removing the port number from URL

    - by DrewSSP
    I'm new to anything related to servers and am trying to deploy a django application. Today I bought a domain name for the app and am having trouble configuring it so that the base URL does not need the port number at the end of it. I have to type www.trackthecharts.com:8001 to see the website when I only want to use www.trackethecharts.com. I think the problem is somewhere in my nginx, gunicorn or supervisor configuration. gunicorn_config.py command = '/opt/myenv/bin/gunicorn' pythonpath = '/opt/myenv/top-chart-app/' bind = '162.243.76.202:8001' workers = 3 root@django-app:~# nginx config server { server_name 162.243.76.202; access_log off; location /static/ { alias /opt/myenv/static/; } location / { proxy_pass http://127.0.0.1:8001; proxy_set_header X-Forwarded-Host $server_name; proxy_set_header X-Real-IP $remote_addr; add_header P3P 'CP="ALL DSP COR PSAa PSDa OUR NOR ONL UNI COM NAV"'; } } supervisor config [program:top_chart_gunicorn] command=/opt/myenv/bin/gunicorn -c /opt/myenv/gunicorn_config.py djangoTopChartApp.wsgi autostart=true autorestart=true stderr_logfile=/var/log/supervisor_gunicorn.err.log stdout_logfile=/var/log/supervisor_gunicorn.out.log Thanks for taking a look.

    Read the article

  • google contacts api service account oauth2.0 sub user

    - by user3709507
    I am trying to use the Google Contacts API to connect to a user's contact information, on my Google apps domain. Generating an access_token using the gdata api's ContactsService clientlogin function while using the API key for my project works fine, but I would prefer to not store the user's credentials, and from the information I have found that method uses OAuth1.0 So, to use OAuth2.0 I have: Generated a Service Account in the developer's console for my project Granted access to the service account for the scope of https://www.google.com/m8/feeds/ in the Google apps domain admin panel Attempted to generate credentials using SignedJwtAssertionCredentials: credentials = SignedJwtAssertionCredentials( service_account_name=service_account_email, private_key=key_from_p12_file, scope='https://www.google.com/m8/feeds/', sub=user_email') The problem I am running into is that attempting to generate an access token using this method fails. It succeeds in generating the token when I remove the sub parameter, but then that token fails when I try to fetch the user's contacts. Does anyone know why this might be happening?

    Read the article

  • SQLAlchemy Expression Language problem

    - by Torkel
    I'm trying to convert this to something sqlalchemy expression language compatible, I don't know if it's possible out of box and are hoping someone more experienced can help me along. The backend is PostgreSQL and if I can't make it as an expression I'll create a string instead. SELECT DISTINCT date_trunc('month', x.x) as date, COALESCE(b.res1, 0) AS res1, COALESCE(b.res2, 0) AS res2 FROM generate_series( date_trunc('year', now() - interval '1 years'), date_trunc('year', now() + interval '1 years'), interval '1 months' ) AS x LEFT OUTER JOIN( SELECT date_trunc('month', access_datetime) AS when, count(NULLIF(resource_id != 1, TRUE)) AS res1, count(NULLIF(resource_id != 2, TRUE)) AS res2 FROM tracking_entries GROUP BY date_trunc('month', access_datetime) ) AS b ON (date_trunc('month', x.x) = b.when) First of all I got a class TrackingEntry mapped to tracking_entries, the select statement within the outer joined can be converted to something like (pseudocode):: from sqlalchemy.sql import func, select from datetime import datetime, timedelta stmt = select([ func.date_trunc('month', TrackingEntry.resource_id).label('when'), func.count(func.nullif(TrackingEntry.resource_id != 1, True)).label('res1'), func.count(func.nullif(TrackingEntry.resource_id != 2, True)).label('res2') ], group_by=[func.date_trunc('month', TrackingEntry.access_datetime), ]) Considering the outer select statement I have no idea how to build it, my guess is something like: outer = select([ func.distinct(func.date_trunc('month', ?)).label('date'), func.coalesce(?.res1, 0).label('res1'), func.coalesce(?.res2, 0).label('res2') ], from_obj=[ func.generate_series( datetime.now(), datetime.now() + timedelta(days=365), timedelta(days=1) ).label(x) ]) Then I suppose I have to link those statements together without using foreign keys: outer.outerjoin(stmt???).??(func.date_trunc('month', ?.?), ?.when) Anyone got any suggestions or even better a solution?

    Read the article

  • build an API service in Django

    - by Peter
    Hi all, I want to build an API service using Django. A basic workflow goes like this: First, an http request goes to http://mycompany.com/create.py?id=001&callback=http://callback.com. It will create a folder on the server with name 001. Second, if the folder does not exist, it will be created. You get response immediately in XML format. It will look like: <?xml version="1.0" encoding="UTF-8"?> <response> <status> <statusCode>0</statusCode> <message>Success</message> </status> <group id="001"/> </response> Finally, the server will do its job (i.e. creating the folder). After it is done, the server does a callback to the URL provided. Currently, I use return render_to_response('create.xml', {'statusCode': statusCode, 'statusMessage': statusMessage, 'groupId': groupId, }, mimetype = 'text/xml') to send the XML response back. I have an XML template which has statusCode, statusMessage, groupId placeholders. <?xml version="1.0" encoding="UTF-8"?> <response> <status> <statusCode>{{ statusCode }}</statusCode> <message>{{ statusMessage }}</message> </status> {% if not statusCode %} <group id="{{ groupId }}"/> {% endif %} </response> But in this way I have to put step 3 before step 2, because otherwise step 3 will not be executed if it is after return statement. Can somebody give me some suggestions how to do this? Thanks.

    Read the article

  • Using sqlalchemy to query using multiple column where in clause

    - by crunkchitis
    I'm looking to execute this query using sqlalchemy. SELECT name, age, favorite_color, favorite_food FROM kindergarten_classroom WHERE (favorite_color, favorite_food) IN (('lavender','lentil soup'),('black','carrot juice')); I only want kids that like (lavender AND lentil soup) OR (black and carrot juice). This is similar, but doesn't get me all of the way there: Sqlalchemy in clause

    Read the article

  • class inheretence of a attribute which is itself a class

    - by alex
    i have a class which inherets a attribute from a super-class. this attribute is a class itself. class classA(superClass): def func(self,x): if self.attributeB is None: do somthing and in the other class i have class superClass: self.attributB = classB() i get the error AttributeError: class classA has no attribute 'attributeB' when i access the attribute like i showed but if on command line i can see it works, x = classA() x.attributeB is None True so the test works. whats going on in the above code?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Assigning a material in Blender with a script

    - by Narcolapser
    Question: How do you assign a material with a script to an object in blender? Info: I have this script to import a proprietary model type of mine that is basically a star map with object consisting of a single vertex. in order to make them look like stars and be visible they are all going to have a halo material assigned to them. I'm figuring out how to make this material and give it the values just fine, but I can't seem to get it to assign. I tried the most obvious thing which was: objectName.setMaterial(materialName) but that did nothing. and when i would take an object that had a material and call the getMaterial function on it, it would return nothing. there is something I'm missing here, can some one shed some light on it? Thanks. ~TA

    Read the article

< Previous Page | 382 383 384 385 386 387 388 389 390 391 392 393  | Next Page >