Search Results

Search found 15224 results on 609 pages for 'parallel python'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 388/609 | < Previous Page | 384 385 386 387 388 389 390 391 392 393 394 395  | Next Page >

  • Auto filling polymorphic table on save or on delete in django

    - by Mo J. Mughrabi
    Hi, Am working on an project in which I made an app "core" it will contain some of the reused models across my projects, most of those are polymorphic models (Generic content types) and will be linked to different models. Example below am trying to create audit model and will be linked to several models which may require auditing. This is the polls/models.py from django.db import models from django.contrib.auth.models import User from core.models import * from django.contrib.contenttypes import generic class Poll(models.Model): ## TODO: Document question = models.CharField(max_length=300) question_slug=models.SlugField(editable=False) start_poll_at = models.DateTimeField(null=True) end_poll_at = models.DateTimeField(null=True) is_active = models.BooleanField(default=True) audit_obj=generic.GenericRelation(Audit) def __unicode__(self): return self.question class Choice(models.Model): ## TODO: Document choice = models.CharField(max_length=200) poll=models.ForeignKey(Poll) audit_obj=generic.GenericRelation(Audit) class Vote(models.Model): ## TODO: Document choice=models.ForeignKey(Choice) Ip_Address=models.IPAddressField(editable=False) vote_at=models.DateTimeField("Vote at", editable=False) here is the core/modes.py from django.db import models from django.contrib.auth.models import User from django.contrib.contenttypes.models import ContentType from django.contrib.contenttypes import generic class Audit(models.Model): ## TODO: Document # Polymorphic model using generic relation through DJANGO content type created_at = models.DateTimeField("Created at", auto_now_add=True) created_by = models.ForeignKey(User, db_column="created_by", related_name="%(app_label)s_%(class)s_y+") updated_at = models.DateTimeField("Updated at", auto_now=True) updated_by = models.ForeignKey(User, db_column="updated_by", null=True, blank=True, related_name="%(app_label)s_%(class)s_y+") content_type = models.ForeignKey(ContentType) object_id = models.PositiveIntegerField(unique=True) content_object = generic.GenericForeignKey('content_type', 'object_id') and here is polls/admin.py from django.core.context_processors import request from polls.models import Poll, Choice from core.models import * from django.contrib import admin class ChoiceInline(admin.StackedInline): model = Choice extra = 3 class PollAdmin(admin.ModelAdmin): inlines = [ChoiceInline] admin.site.register(Poll, PollAdmin) Am quite new to django, what am trying to do here, insert a record in audit when a record is inserted in polls and then update that same record when a record is updated in polls.

    Read the article

  • Prepopulate drop-box according to another drop-box choice in Django Admin

    - by onorua
    I have models like this: class User(models.Model): Switch = models.ForeignKey(Switch, related_name='SwitchUsers') Port = models.ForeignKey(Port) class Switch(models.Model): Name = models.CharField(max_length=50) class Port(models.Model): PortNum = models.PositiveIntegerField() Switch = models.ForeignKey(Switch, related_name = "Ports") When I'm in Admin interface and choose Switch from Switches available, I would like to have Port prepopulated accordingly with Ports from the related Switch. As far as I understand I need to create some JS script to prepopulate it. Unfortunately I don't have this experience, and I would like to keep things simple as it possible and don't rewrite all Django admin interface. Just add this functionality for one Field. Could you please help me with my problem? Thank you.

    Read the article

  • Django says the "id may not be NULL" but why is it?

    - by Oli
    I'm going crazy today. I just tried to insert a new record and it threw back a "post_blogpost.id may not be NULL" error. Here's my model: class BlogPost(models.Model): title = models.CharField(max_length=100) slug = models.SlugField(max_length=100) who = models.ForeignKey(User, default=1) when = models.DateTimeField() intro = models.TextField(blank=True, null=True) content = models.TextField(blank=True, null=True) counter = models.PositiveIntegerField(default=0) published = models.BooleanField(default=False) css = models.TextField(blank=True, null=True) class Meta: ordering = ('-when', 'id') There are a number of functions beneath the model too but I won't include them in full here. Their names are: content_cache_key, clear_cache, __unicode__, reads, read, processed_content. I'm adding through the admin... And I'm running out of hair.

    Read the article

  • Algorithm to match natural text in mail

    - by snøreven
    I need to separate natural, coherent text/sentences in emails from lists, signatures, greetings and so on before further processing. example: Hi tom, last monday we did bla bla, lore Lorem ipsum dolor sit amet, consectetur adipisici elit, sed eiusmod tempor incidunt ut labore et dolore magna aliqua. list item 2 list item 3 list item 3 Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquid x ea commodi consequat. Quis aute iure reprehenderit in voluptate velit regards, K. ---line-of-funny-characters-####### example inc. 33 evil street, london mobile: 00 234534/234345 Ideally the algorithm would match only the bold parts. Is there any recommended approach - or are there even existing algorithms for that problem? Should I try approximate regular expressions or more statistical stuff based on number of punctation marks, length and so on?

    Read the article

  • How do i add a new object with suds?

    - by Jerome
    I'm trying to use suds but have so far been unsuccessful at figuring this out. Hopefully it's something simple that i'm missing. Any help would be highly appreciated. This is supposed to be the raw soap message that i need to achieve: <soapenv:Envelope xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:api="http://api.service.apimember.soapservice.com/"> <soapenv:Header/> <soapenv:Body> <api:insertOrUpdateMemberByObj> <token>t67GFCygjhkjyUy8y9hkjhlkjhuii</token> <member> <dynContent> <entry> <key>FIRSTNAME</key> <value>hhhhbbbbb</value> </entry> </dynContent> <email>[email protected]</email> </member> </api:insertOrUpdateMemberByObj> </soapenv:Body> </soapenv:Envelope> So i use suds to create the member object: member = client.factory.create('member') produces: (apiMember){ attributes = (attributes){ entry[] = <empty> } } How exactly do i append an 'entry'? I try this: member.attributes.entry.append({'key':'FIRSTNAME','value':'test'}) and that produces this: (apiMember){ attributes = (attributes){ entry[] = { value = "test" key = "FIRSTNAME" }, } } However, what i actually need is: (apiMember){ attributes = (attributes){ entry[] = (entry) { value = "test" key = "FIRSTNAME" }, } } How do i achieve this?

    Read the article

  • grabbing a substring while scraping with Python2.6

    - by Diego
    Hey can someone help with the following? I'm trying to scrape a site that has the following information.. I need to pull just the number after the </strong> tag.. [<li><strong>ISBN-13:</strong> 9780375853401</li>, <li><strong>Pub. Date: </strong> 05/11/2010</li>] [<li><strong>UPC:</strong> 490355000372</li>, <li><strong>Catalog No:</strong> 15024/25</li>, <li><strong>Label:</strong> CAMERATA</li>] here's a piece of the code I've been using to grab the above data using mechanize and BeautifulSoup. I'm stuck here as it won't let me use the find() function for a list br_results = mechanize.urlopen(br_results) html = br_results.read() soup = BeautifulSoup(html) local_links = soup.findAll("a", {"class" : "down-arrow csa"}) upc_code = soup.findAll("ul", {"class" : "bc-meta3"}) for upc in upc_code: upc_text = upc.contents.contents print upc_text

    Read the article

  • Setting up relations/mappings for a SQLAlchemy many-to-many database

    - by Brent Ramerth
    I'm new to SQLAlchemy and relational databases, and I'm trying to set up a model for an annotated lexicon. I want to support an arbitrary number of key-value annotations for the words which can be added or removed at runtime. Since there will be a lot of repetition in the names of the keys, I don't want to use this solution directly, although the code is similar. My design has word objects and property objects. The words and properties are stored in separate tables with a property_values table that links the two. Here's the code: from sqlalchemy import Column, Integer, String, Table, create_engine from sqlalchemy import MetaData, ForeignKey from sqlalchemy.orm import relation, mapper, sessionmaker from sqlalchemy.ext.declarative import declarative_base engine = create_engine('sqlite:///test.db', echo=True) meta = MetaData(bind=engine) property_values = Table('property_values', meta, Column('word_id', Integer, ForeignKey('words.id')), Column('property_id', Integer, ForeignKey('properties.id')), Column('value', String(20)) ) words = Table('words', meta, Column('id', Integer, primary_key=True), Column('name', String(20)), Column('freq', Integer) ) properties = Table('properties', meta, Column('id', Integer, primary_key=True), Column('name', String(20), nullable=False, unique=True) ) meta.create_all() class Word(object): def __init__(self, name, freq=1): self.name = name self.freq = freq class Property(object): def __init__(self, name): self.name = name mapper(Property, properties) Now I'd like to be able to do the following: Session = sessionmaker(bind=engine) s = Session() word = Word('foo', 42) word['bar'] = 'yes' # or word.bar = 'yes' ? s.add(word) s.commit() Ideally this should add 1|foo|42 to the words table, add 1|bar to the properties table, and add 1|1|yes to the property_values table. However, I don't have the right mappings and relations in place to make this happen. I get the sense from reading the documentation at http://www.sqlalchemy.org/docs/05/mappers.html#association-pattern that I want to use an association proxy or something of that sort here, but the syntax is unclear to me. I experimented with this: mapper(Word, words, properties={ 'properties': relation(Property, secondary=property_values) }) but this mapper only fills in the foreign key values, and I need to fill in the other value as well. Any assistance would be greatly appreciated.

    Read the article

  • Scrape zipcode table for different urls based on county

    - by Dr.Venkman
    I used lxml and ran into a wall as my new computer wont install lxml and the code doesnt work. I know this is simple - maybe some one can help with a beautiful soup script. this is my code: import codecs import lxml as lh from selenium import webdriver import time import re results = [] city = [ 'amador'] state = [ 'CA'] for state in states: for city in citys: browser = webdriver.Firefox() link2 = 'http://www.getzips.com/cgi-bin/ziplook.exe?What=3&County='+ city +'&State=' + state + '&Submit=Look+It+Up' browser.get(link2) bcontent = browser.page_source zipcode = bcontent[bcontent.find('<td width="15%"'):bcontent.find('<p>')+0] if len(zipcode) > 0: print zipcode else: print 'none' browser.quit() Thanks for the help

    Read the article

  • Accented characters in matplotlib

    - by OldJim
    Does anyone know a way to get matplotlib to render accented chars (é,ã,â,etc)? For instance i'm trying to use accented chars on set_yticklabels() and matplot renders squares instead, and when i use unicode() it renders the wrong chars. Is there a way to make this work? Thanks in advance, Jim.

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • SUDS rendering a duplicate node and wrapping everything in it

    - by PylonsN00b
    Here is my code: #Make the SOAP connection url = "https://api.channeladvisor.com/ChannelAdvisorAPI/v1/InventoryService.asmx?WSDL" headers = {'Content-Type': 'text/xml; charset=utf-8'} ca_client_inventory = Client(url, location="https://api.channeladvisor.com/ChannelAdvisorAPI/v1/InventoryService.asmx", headers=headers) #Make the SOAP headers login = ca_client_inventory.factory.create('APICredentials') login.DeveloperKey = 'REMOVED' login.Password = 'REMOVED' #Attach the headers ca_client_inventory.set_options(soapheaders=login) synch_inventory_item_list = ca_client_inventory.factory.create('SynchInventoryItemList') synch_inventory_item_list.accountID = "REMOVED" array_of_inventory_item_submit = ca_client_inventory.factory.create('ArrayOfInventoryItemSubmit') for product in products: inventory_item_submit = ca_client_inventory.factory.create('InventoryItemSubmit') inventory_item_list = get_item_list(product) inventory_item_submit = [inventory_item_list] array_of_inventory_item_submit.InventoryItemSubmit.append(inventory_item_submit) synch_inventory_item_list.itemList = array_of_inventory_item_submit #Call that service baby! ca_client_inventory.service.SynchInventoryItemList(synch_inventory_item_list) Here is what it outputs: <?xml version="1.0" encoding="UTF-8"?> <SOAP-ENV:Envelope xmlns:ns0="http://api.channeladvisor.com/webservices/" xmlns:ns1="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:tns="http://api.channeladvisor.com/webservices/" xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/"> <SOAP-ENV:Header> <tns:APICredentials> <tns:DeveloperKey>REMOVED</tns:DeveloperKey> <tns:Password>REMOVED</tns:Password> </tns:APICredentials> </SOAP-ENV:Header> <ns1:Body> <ns0:SynchInventoryItemList> <ns0:accountID> <ns0:accountID>REMOVED</ns0:accountID> <ns0:itemList> <ns0:InventoryItemSubmit> <ns0:Sku>1872</ns0:Sku> <ns0:Title>The Big Book Of Crazy Quilt Stitches</ns0:Title> <ns0:Subtitle></ns0:Subtitle> <ns0:Description>Embellish the seams and patches of crazy quilt projects with over 75 embroidery stitches and floral motifs. You&apos;ll use this handy reference book again and again to dress up wall hangings, pillows, sachets, clothing, and other nostalgic creations.</ns0:Description> <ns0:Weight>4</ns0:Weight> <ns0:FlagStyle/> <ns0:IsBlocked xsi:nil="true"/> <ns0:ISBN></ns0:ISBN> <ns0:UPC>028906018721</ns0:UPC> <ns0:EAN></ns0:EAN> <ns0:QuantityInfo> <ns0:UpdateType>UnShipped</ns0:UpdateType> <ns0:Total>0</ns0:Total> </ns0:QuantityInfo> <ns0:PriceInfo> <ns0:Cost>0.575</ns0:Cost> <ns0:RetailPrice xsi:nil="true"/> <ns0:StartingPrice xsi:nil="true"/> <ns0:ReservePrice xsi:nil="true"/> <ns0:TakeItPrice>6.95</ns0:TakeItPrice> <ns0:SecondChanceOfferPrice xsi:nil="true"/> <ns0:StorePrice>6.95</ns0:StorePrice> </ns0:PriceInfo> <ns0:ClassificationInfo> <ns0:Name>Books</ns0:Name> <ns0:AttributeList> <ns0:ClassificationAttributeInfo> <ns0:Name>Designer/Author</ns0:Name> <ns0:Value>Patricia Eaton</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Trim Size</ns0:Name> <ns0:Value></ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Binding</ns0:Name> <ns0:Value>Leaflet</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Release Date</ns0:Name> <ns0:Value>11/1/1999 0:00:00</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Skill Level</ns0:Name> <ns0:Value></ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Pages</ns0:Name> <ns0:Value>20</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Projects</ns0:Name> <ns0:Value></ns0:Value> </ns0:ClassificationAttributeInfo> </ns0:AttributeList> </ns0:ClassificationInfo> <ns0:ImageList> <ns0:ImageInfoSubmit> <ns0:PlacementName>ITEMIMAGEURL1</ns0:PlacementName> <ns0:FilenameOrUrl>1872.jpg</ns0:FilenameOrUrl> </ns0:ImageInfoSubmit> </ns0:ImageList> </ns0:InventoryItemSubmit> </ns0:itemList> </ns0:accountID> </ns0:SynchInventoryItemList> </ns1:Body> </SOAP-ENV:Envelope> See how it creates the accountID node twice and wraps the whole thing in it? WHY? How do I make it stop that?!

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • How to reload Django models without losing my locals in an interactive session?

    - by Gj
    I'm doing some research with an interactive shell and using a Django app (shell_plus) for storing data and browsing it using the convenient admin. Occasionally I add or change some of the app models, and run a syncdb (or South migration when changing a model). The changes to the models don't take effect in my interactive session even if I re-import the app models. Thus I'm forced to restart the shell_plus and lose my precious locals() in the process. Is there any way to reload the models during a session? Thanks!!

    Read the article

  • mod_wsgi daemon mode vs threaded fastcgi

    - by t0ster
    Can someone explain the difference between apache mod_wsgi in daemon mode and django fastcgi in threaded mode. They both use threads for concurrency I think. Supposing that I'm using nginx as front end to apache mod_wsgi. UPDATE: I'm comparing django built in fastcgi(./manage.py method=threaded maxchildren=15) and mod_wsgi in 'daemon' mode(WSGIDaemonProcess example threads=15). They both use threads and acquire GIL, am I right?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Using Range Function

    - by Michael Alexander Riechmann
    My goal is to make a program that takes an input (Battery_Capacity) and ultimately spits out a list of the (New_Battery_Capacity) and the Number of (Cycle) it takes for it ultimately to reach maximum capacity of 80. Cycle = range (160) Charger_Rate = 0.5 * Cycle Battery_Capacity = float(raw_input("Enter Current Capacity:")) New_Battery_Capacity = Battery_Capacity + Charger_Rate if Battery_Capacity < 0: print 'Battery Reading Malfunction (Negative Reading)' elif Battery_Capacity > 80: print 'Battery Reading Malfunction (Overcharged)' elif float(Battery_Capacity) % 0.5 !=0: print 'Battery Malfunction (Charges Only 0.5 Interval)' while Battery_Capacity >= 0 and Battery_Capacity < 80: print New_Battery_Capacity I was wondering why my Cycle = range(160) isn't working in my program?

    Read the article

  • Error handling in the RequestHandler without embedding in URI

    - by hyn
    When a user sends a filled form, I want to print an error message in case there is an input error. One of the GAE sample codes does this by embedding the error message in the URI. Inside the form handler (get): self.redirect('/compose?error_message=%s' % message) and in the handler (get) of redirected URI, gets the message from request: values = { 'error_message': self.request.get('error_message'), ... Is there a way to accomplish the same without embedding the message in the URI?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 384 385 386 387 388 389 390 391 392 393 394 395  | Next Page >