Search Results

Search found 15224 results on 609 pages for 'parallel python'.

Page 388/609 | < Previous Page | 384 385 386 387 388 389 390 391 392 393 394 395  | Next Page >

  • Removing specific ticks from matplotlib plot

    - by Jsg91
    I'm trying to remove the origin ticks from my plot below to stop them overlapping, alternatively just moving them away from each other would also be great I tried this: xticks = ax.xaxis.get_major_ticks() xticks[0].label1.set_visible(False) yticks = ax.yaxis.get_major_ticks() yticks[0].label1.set_visible(False) However this removed the first and last ticks from the y axis like so: Does anyone have an idea about how to do this? Any help would be greatly appreciated.

    Read the article

  • Get particular row as series from pandas dataframe

    - by Pratyush
    How do we get a particular filtered row as series? Example dataframe: >>> df = pd.DataFrame({'date': [20130101, 20130101, 20130102], 'location': ['a', 'a', 'c']}) >>> df date location 0 20130101 a 1 20130101 a 2 20130102 c I need to select the row where location is c as a series. I tried: row = df[df["location"] == "c"].head(1) # gives a dataframe row = df.ix[df["location"] == "c"] # also gives a dataframe with single row In either cases I can't the row as series.

    Read the article

  • Django says the "id may not be NULL" but why is it?

    - by Oli
    I'm going crazy today. I just tried to insert a new record and it threw back a "post_blogpost.id may not be NULL" error. Here's my model: class BlogPost(models.Model): title = models.CharField(max_length=100) slug = models.SlugField(max_length=100) who = models.ForeignKey(User, default=1) when = models.DateTimeField() intro = models.TextField(blank=True, null=True) content = models.TextField(blank=True, null=True) counter = models.PositiveIntegerField(default=0) published = models.BooleanField(default=False) css = models.TextField(blank=True, null=True) class Meta: ordering = ('-when', 'id') There are a number of functions beneath the model too but I won't include them in full here. Their names are: content_cache_key, clear_cache, __unicode__, reads, read, processed_content. I'm adding through the admin... And I'm running out of hair.

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • Django repeating vars/cache issue?

    - by Mark
    I'm trying to build a better/more powerful form class for Django. It's working well, except for these sub-forms. Actually, it works perfectly right after I re-start apache, but after I refresh the page a few times, my HTML output starts to look like this: <input class="text" type="text" id="pickup_addr-pickup_addr-pickup_addr-id-pickup_addr-venue" value="" name="pickup_addr-pickup_addr-pickup_addr-pickup_addr-venue" /> The pickup_addr- part starts repeating many times. I was looking for loops around the prefix code that might have cause this to happen, but the output isn't even consistent when I refresh the page, so I think something is getting cached somewhere, but I can't even imagine how that's possible. The prefix car should be reset when the class is initialized, no? Unless it's somehow not initializing something? class Form(object): count = 0 def __init__(self, data={}, prefix='', action='', id=None, multiple=False): self.fields = {} self.subforms = {} self.data = {} self.action = action self.id = fnn(id, 'form%d' % Form.count) self.errors = [] self.valid = True if not empty(prefix) and prefix[-1:] not in ('-','_'): prefix += '-' for name, field in inspect.getmembers(self, lambda m: isinstance(m, Field)): if name[:2] == '__': continue field_name = fnn(field.name, name) field.label = fnn(field.label, humanize(field_name)) field.name = field.widget.name = prefix + field_name + ife(multiple, '[]') field.id = field.auto_id = field.widget.id = ife(field.id==None, 'id-') + prefix + fnn(field.id, field_name) + ife(multiple, Form.count) field.errors = [] val = fnn(field.widget.get_value(data), field.default) if isinstance(val, basestring): try: val = field.coerce(field.format(val)) except Exception, err: self.valid = False field.errors.append(escape_html(err)) field.val = self.data[name] = field.widget.val = val for rule in field.rules: rule.fields = self.fields rule.val = field.val rule.name = field.name self.fields[name] = field for name, form in inspect.getmembers(self, lambda m: ispropersubclass(m, Form)): if name[:2] == '__': continue self.subforms[name] = self.__dict__[name] = form(data=data, prefix='%s%s-' % (prefix, name)) Form.count += 1 Let me know if you need more code... I know it's a lot, but I just can't figure out what's causing this!

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Django: Geocoding an address on form submission?

    - by User
    Trying to wrap my head around django forms and the django way of doing things. I want to create a basic web form that allows a user to input an address and have that address geocoded and saved to a database. I created a Location model: class Location(models.Model): address = models.CharField(max_length=200) city = models.CharField(max_length=100) state = models.CharField(max_length=100, null=True) postal_code = models.CharField(max_length=100, null=True) country = models.CharField(max_length=100) latitude = models.DecimalField(max_digits=18, decimal_places=10, null=True) longitude = models.DecimalField(max_digits=18, decimal_places=10, null=True) And defined a form: class LocationForm(forms.ModelForm): class Meta: model = models.Location exclude = ('latitude','longitude') In my view I'm using form.save() to save the form. This works and saves an address to the database. I created a module to geocode an address. I'm not sure what the django way of doing things is, but I guess in my view, before I save the form, I need to geocode the address and set the lat and long. How do I set the latitude and longitude before saving?

    Read the article

  • How to reload Django models without losing my locals in an interactive session?

    - by Gj
    I'm doing some research with an interactive shell and using a Django app (shell_plus) for storing data and browsing it using the convenient admin. Occasionally I add or change some of the app models, and run a syncdb (or South migration when changing a model). The changes to the models don't take effect in my interactive session even if I re-import the app models. Thus I'm forced to restart the shell_plus and lose my precious locals() in the process. Is there any way to reload the models during a session? Thanks!!

    Read the article

  • Algorithm to match natural text in mail

    - by snøreven
    I need to separate natural, coherent text/sentences in emails from lists, signatures, greetings and so on before further processing. example: Hi tom, last monday we did bla bla, lore Lorem ipsum dolor sit amet, consectetur adipisici elit, sed eiusmod tempor incidunt ut labore et dolore magna aliqua. list item 2 list item 3 list item 3 Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquid x ea commodi consequat. Quis aute iure reprehenderit in voluptate velit regards, K. ---line-of-funny-characters-####### example inc. 33 evil street, london mobile: 00 234534/234345 Ideally the algorithm would match only the bold parts. Is there any recommended approach - or are there even existing algorithms for that problem? Should I try approximate regular expressions or more statistical stuff based on number of punctation marks, length and so on?

    Read the article

  • Error handling in the RequestHandler without embedding in URI

    - by hyn
    When a user sends a filled form, I want to print an error message in case there is an input error. One of the GAE sample codes does this by embedding the error message in the URI. Inside the form handler (get): self.redirect('/compose?error_message=%s' % message) and in the handler (get) of redirected URI, gets the message from request: values = { 'error_message': self.request.get('error_message'), ... Is there a way to accomplish the same without embedding the message in the URI?

    Read the article

  • Programmatically sync the db in Django

    - by Attila Oláh
    I'm trying to sync my db from a view, something like this: from django import http from django.core import management def syncdb(request): management.call_command('syncdb') return http.HttpResponse('Database synced.') The issue is, it will block the dev server by asking for user input from the terminal. How can I pass it the '--noinput' option to prevent asking me anything? I have other ways of marking users as super-user, so there's no need for the user input, but I really need to call syncdb (and flush) programmatically, without logging on to the server via ssh. Any help is appreciated.

    Read the article

  • Scrape zipcode table for different urls based on county

    - by Dr.Venkman
    I used lxml and ran into a wall as my new computer wont install lxml and the code doesnt work. I know this is simple - maybe some one can help with a beautiful soup script. this is my code: import codecs import lxml as lh from selenium import webdriver import time import re results = [] city = [ 'amador'] state = [ 'CA'] for state in states: for city in citys: browser = webdriver.Firefox() link2 = 'http://www.getzips.com/cgi-bin/ziplook.exe?What=3&County='+ city +'&State=' + state + '&Submit=Look+It+Up' browser.get(link2) bcontent = browser.page_source zipcode = bcontent[bcontent.find('<td width="15%"'):bcontent.find('<p>')+0] if len(zipcode) > 0: print zipcode else: print 'none' browser.quit() Thanks for the help

    Read the article

  • Tkinter Packing Strangeness: Buttons packed above others

    - by Parand
    I'm sure I'm doing something obvious wrong here, but I can't see it. I end up with the "Should be on top" label packed at the bottom instead of at the top. What am I doing wrong? from Tkinter import * class SelectAction(Frame): buttons = {} def callback(self): print "Callback" def createWidgets(self): logo_label = Label(text="Should be on top").pack(fill=X) for name, text, callback in ( ('setup_account', 'Account Settings', self.callback), ('do_action', 'Do Something', self.callback), ): self.buttons[name] = Button(self, text=text, command=callback).pack(fill=X) def __init__(self, master=None): Frame.__init__(self, master) self.pack() self.createWidgets() if __name__ == "__main__": root = Tk() app = SelectAction(master=root) app.mainloop() root.destroy()

    Read the article

  • how to fill a part of a circle using PIL?

    - by valya
    hello. I'm trying to use PIL for a task but the result is very dirty. What I'm doing is trying to fill a part of a piece of a circle, as you can see on the image. Here is my code: def gen_image(values): side = 568 margin = 47 image = Image.open(settings.MEDIA_ROOT + "/i/promo_circle.jpg") draw = ImageDraw.Draw(image) draw.ellipse((margin, margin, side-margin, side-margin), outline="white") center = side/2 r = side/2 - margin cnt = len(values) for n in xrange(cnt): angle = n*(360.0/cnt) - 90 next_angle = (n+1)*(360.0/cnt) - 90 nr = (r * values[n] / 5) max_r = r min_r = nr for cr in xrange(min_r*10, max_r*10): cr = cr/10.0 draw.arc((side/2-cr, side/2-cr, side/2+cr, side/2+cr), angle, next_angle, fill="white") return image

    Read the article

  • What is the Simplest Possible Payment Gateway to Implement? (using Django)

    - by b14ck
    I'm developing a web application that will require users to either make one time deposits of money into their account, or allow users to sign up for recurring billing each month for a certain amount of money. I've been looking at various payment gateways, but most (if not all) of them seem complex and difficult to get working. I also see no real active Django projects which offer simple views for making payments. Ideally, I'd like to use something like Amazon FPS, so that I can see online transaction logs, refund money, etc., but I'm open to other things. I just want the EASIEST possible payment gateway to integrate with my site. I'm not looking for anything fancy, whatever does the job, and requires < 10 hours to get working from start to finish would be perfect. I'll give answer points to whoever can point out a good one. Thanks!

    Read the article

  • SQLAlchemy declarative syntax with autoload in Pylons

    - by Juliusz Gonera
    I would like to use autoload to use an existings database. I know how to do it without declarative syntax (model/_init_.py): def init_model(engine): """Call me before using any of the tables or classes in the model""" t_events = Table('events', Base.metadata, schema='events', autoload=True, autoload_with=engine) orm.mapper(Event, t_events) Session.configure(bind=engine) class Event(object): pass This works fine, but I would like to use declarative syntax: class Event(Base): __tablename__ = 'events' __table_args__ = {'schema': 'events', 'autoload': True} Unfortunately, this way I get: sqlalchemy.exc.UnboundExecutionError: No engine is bound to this Table's MetaData. Pass an engine to the Table via autoload_with=<someengine>, or associate the MetaData with an engine via metadata.bind=<someengine> The problem here is that I don't know where to get the engine from (to use it in autoload_with) at the stage of importing the model (it's available in init_model()). I tried adding meta.Base.metadata.bind(engine) to environment.py but it doesn't work. Anyone has found some elegant solution?

    Read the article

  • django on appengine

    - by aks
    I am impressed with django.Am am currenty a java developer.I want to make some cool websites for myself but i want to host it in some third pary environmet. Now the question is can i host the django application on appengine?If yes , how?? Are there any site built using django which are already hosted on appengine?

    Read the article

  • Sqlalchemy complex in_ clause

    - by lostlogic
    I'm trying to find a way to cause sqlalchemy to generate sql of the following form: select * from t where (a,b) in ((a1,b1),(a2,b2)); Is this possible? If not, any suggestions on a way to emulate it? Thanks kindly!

    Read the article

  • how to speed up the code??

    - by kaushik
    i have very huge code about 600 lines plus. cant post the whole thing here. but a particular code snippet is taking so much time,leading to problems. here i post that part of code please tell me what to do speed up the processing.. please suggest the part which may be the reason and measure to improve them if this small part of code is understandable. using_data={} def join_cost(a , b): global using_data #print a #print b save_a=[] save_b=[] print 1 #for i in range(len(m)): #if str(m[i][0])==str(a): save_a=database_index[a] #for i in range(len(m)): # if str(m[i][0])==str(b): #print 'save_a',save_a #print 'save_b',save_b print 2 save_b=database_index[b] using_data[save_a[0]]=save_a s=str(save_a[1]).replace('phone','text') s=str(s)+'.pm' p=os.path.join("c:/begpython/wavnk/",s) x=open(p , 'r') print 3 for i in range(6): x.readline() k2='a' j=0 o=[] while k2 is not '': k2=x.readline() k2=k2.rstrip('\n') oj=k2.split(' ') o=o+[oj] #print o[j] j=j+1 #print j #print o[2][0] temp=long(1232332) end_time=save_a[4] #print end_time k=(j-1) for i in range(k): diff=float(o[i][0])-float(end_time) if diff<0: diff=diff*(-1) if temp>diff: temp=diff pm_row=i #print pm_row #print temp #print o[pm_row] #pm_row=3 q=[] print 4 l=str(p).replace('.pm','.mcep') z=open(l ,'r') for i in range(pm_row): z.readline() k3=z.readline() k3=k3.rstrip('\n') q=k3.split(' ') #print q print 5 s=str(save_b[1]).replace('phone','text') s=str(s)+'.pm' p=os.path.join("c:/begpython/wavnk/",s) x=open(p , 'r') for i in range(6): x.readline() k2='a' j=0 o=[] while k2 is not '': k2=x.readline() k2=k2.rstrip('\n') oj=k2.split(' ') o=o+[oj] #print o[j] j=j+1 #print j #print o[2][0] temp=long(1232332) strt_time=save_b[3] #print strt_time k=(j-1) for i in range(k): diff=float(o[i][0])-float(strt_time) if diff<0: diff=diff*(-1) if temp>diff: temp=diff pm_row=i #print pm_row #print temp #print o[pm_row] #pm_row=3 w=[] l=str(p).replace('.pm','.mcep') z=open(l ,'r') for i in range(pm_row): z.readline() k3=z.readline() k3=k3.rstrip('\n') w=k3.split(' ') #print w cost=0 for i in range(12): #print q[i] #print w[i] h=float(q[i])-float(w[i]) cost=cost+math.pow(h,2) j_cost=math.sqrt(cost) #print cost return j_cost def target_cost(a , b): a=(b+1)*3 b=(a+1)*2 t_cost=(a+b)*5/2 return t_cost r1='shht:ra_77' r2='grx_18' g=[] nodes=[] nodes=nodes+[[r1]] for i in range(len(y_in_db_format)): g=y_in_db_format[i] #print g #print g[0] g.remove(str(g[0])) nodes=nodes+[g] nodes=nodes+[[r2]] print nodes print "lenght of nodes",len(nodes) lists=[] #lists=lists+[r1] for i in range(len(nodes)): for j in range(len(nodes[i])): lists=lists+[nodes[i][j]] #lists=lists+[r2] print lists distance={} for i in range(len(lists)): if i==0: distance[str(lists[i])]=0 else: distance[str(lists[i])]=long(123231223) #print distance group_dist=[] infinity=long(123232323) for i in range(len(nodes)): distances=[] for j in range(len(nodes[i])): #distances=[] if i==0: distances=distances+[[nodes[i][j], 0]] else: distances=distances+[[nodes[i][j],infinity]] group_dist=group_dist+[distances] #print distances print "group_distances",group_dist #print "check",group_dist[0][0][1] #costs={} #for i in range(len(lists)): #if i==0: # costs[str(lists[i])]=1 #else: # costs[str(lists[i])]=get_selfcost(lists[i]) path=[] for i in range(len(nodes)): mini=[] if i!=(len(nodes)-1): #temp=long(123234324) #Now calculate the cost between the current node and each of its neighbour for k in range(len(nodes[(i+1)])): for j in range(len(nodes[i])): current=nodes[i][j] #print "current_node",current j_distance=join_cost( current , nodes[i+1][k]) #t_distance=target_cost( current , nodes[i+1][k]) t_distance=34 #print distance #print "distance between current and neighbours",distance total_distance=(.5*(float(group_dist[i][j][1])+float(j_distance))+.5*(float(t_distance))) #print "total distance between the intial_nodes and current neighbour",total_distance if int(group_dist[i+1][k][1]) > int(total_distance): group_dist[i+1][k][1]=total_distance #print "updated distance",group_dist[i+1][k][1] a=current #print "the neighbour",nodes[i+1][k],"updated the value",a mini=mini+[[str(nodes[i+1][k]),a]] print mini

    Read the article

  • how to speed up the code??

    - by kaushik
    in my program i have a method which requires about 4 files to be open each time it is called,as i require to take some data.all this data from the file i have been storing in list for manupalation. I approximatily need to call this method about 10,000 times.which is making my program very slow? any method for handling this files in a better ways and is storing the whole data in list time consuming what is better alternatives for list? I can give some code,but my previous question was closed as that only confused everyone as it is a part of big program and need to be explained completely to understand,so i am not giving any code,please suggest ways thinking this as a general question... thanks in advance

    Read the article

< Previous Page | 384 385 386 387 388 389 390 391 392 393 394 395  | Next Page >