Search Results

Search found 15224 results on 609 pages for 'parallel python'.

Page 390/609 | < Previous Page | 386 387 388 389 390 391 392 393 394 395 396 397  | Next Page >

  • Prepopulate drop-box according to another drop-box choice in Django Admin

    - by onorua
    I have models like this: class User(models.Model): Switch = models.ForeignKey(Switch, related_name='SwitchUsers') Port = models.ForeignKey(Port) class Switch(models.Model): Name = models.CharField(max_length=50) class Port(models.Model): PortNum = models.PositiveIntegerField() Switch = models.ForeignKey(Switch, related_name = "Ports") When I'm in Admin interface and choose Switch from Switches available, I would like to have Port prepopulated accordingly with Ports from the related Switch. As far as I understand I need to create some JS script to prepopulate it. Unfortunately I don't have this experience, and I would like to keep things simple as it possible and don't rewrite all Django admin interface. Just add this functionality for one Field. Could you please help me with my problem? Thank you.

    Read the article

  • Django says the "id may not be NULL" but why is it?

    - by Oli
    I'm going crazy today. I just tried to insert a new record and it threw back a "post_blogpost.id may not be NULL" error. Here's my model: class BlogPost(models.Model): title = models.CharField(max_length=100) slug = models.SlugField(max_length=100) who = models.ForeignKey(User, default=1) when = models.DateTimeField() intro = models.TextField(blank=True, null=True) content = models.TextField(blank=True, null=True) counter = models.PositiveIntegerField(default=0) published = models.BooleanField(default=False) css = models.TextField(blank=True, null=True) class Meta: ordering = ('-when', 'id') There are a number of functions beneath the model too but I won't include them in full here. Their names are: content_cache_key, clear_cache, __unicode__, reads, read, processed_content. I'm adding through the admin... And I'm running out of hair.

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • How to reload Django models without losing my locals in an interactive session?

    - by Gj
    I'm doing some research with an interactive shell and using a Django app (shell_plus) for storing data and browsing it using the convenient admin. Occasionally I add or change some of the app models, and run a syncdb (or South migration when changing a model). The changes to the models don't take effect in my interactive session even if I re-import the app models. Thus I'm forced to restart the shell_plus and lose my precious locals() in the process. Is there any way to reload the models during a session? Thanks!!

    Read the article

  • Is multi-level polymorphism possible in SQLAlchemy?

    - by Jace
    Is it possible to have multi-level polymorphism in SQLAlchemy? Here's an example: class Entity(Base): __tablename__ = 'entities' id = Column(Integer, primary_key=True) created_at = Column(DateTime, default=datetime.utcnow, nullable=False) entity_type = Column(Unicode(20), nullable=False) __mapper_args__ = {'polymorphic_on': entity_type} class File(Entity): __tablename__ = 'files' id = Column(None, ForeignKey('entities.id'), primary_key=True) filepath = Column(Unicode(255), nullable=False) file_type = Column(Unicode(20), nullable=False) __mapper_args__ = {'polymorphic_identity': u'file', 'polymorphic_on': file_type) class Image(File): __mapper_args__ = {'polymorphic_identity': u'image'} __tablename__ = 'images' id = Column(None, ForeignKey('files.id'), primary_key=True) width = Column(Integer) height = Column(Integer) When I call Base.metadata.create_all(), SQLAlchemy raises the following error: NotImplementedError: Can't generate DDL for the null type IntegrityError: (IntegrityError) entities.entity_type may not be NULL. This error goes away if I remove the Image model and the polymorphic_on key in File. What gives? (Edited: the exception raised was wrong.)

    Read the article

  • Django and mod_python intermittent error?

    - by Peter
    I have a Django site at http://sm.rutgers.edu/relive/af_api/index/. It is supposed to display "Home of the relive APIs". If you refresh this page many times, you can see different renderings. 1) The expected page. 2) Django "It worked!" page. 3) "ImportError at /index/" page. If you scroll down enough to ROOT_URLCONF part, you will see it says 'relive.urls'. But apparently, it should be 'af_api.urls', which is in my settings.py file. Since these results happen randomly, is it possible that either Django or mod_python is working unstably?

    Read the article

  • How do you automatically remove the preview window after autocompletion in Vim?

    - by Ben Davini
    I'm using omnifunc=pythoncomplete. When autocompleting a word (e.g., os.), I get the list of eligible class members and functions, as expected, as well as a scratch buffer preview window with documentation about the selected member or function. This is great, but after selecting the function I want, the preview window remains. I can get rid of it with ":pc", but I'd like it just to automatically disappear after I've selected my function, a la Eclipse. I've played around with "completeopt" but to no avail.

    Read the article

  • Testing InlineFormset clean methods

    - by Rory
    I have a Django project, with 2 models, a Structure and Bracket, the Bracket has a ForeignKey to a Structure (i.e. one-to-many, one Structure has many Brackets). I created a TabularInline for the admin site, so that there would be a table of Brackets on the Structure. I added a custom formset with some a custom clean method to do some extra validation, you can't have a Bracket that conflicts with another Bracket on the same Structure etc. The admin looks like this: class BracketInline(admin.TabularInline): model = Bracket formset = BracketInlineFormset class StructureAdmin(admin.ModelAdmin): inlines = [ BracketInline ] admin.site.register(Structure, StructureAdmin) That all works, and the validation works. However now I want to write some unittest to test my complex formset validation logic. My first attempt to validate known-good values is: data = {'form-TOTAL_FORMS': '1', 'form-INITIAL_FORMS': '0', 'form-MAX_NUM_FORMS': '', 'form-0-field1':'good-value', … } formset = BracketInlineFormset(data) self.assertTrue(formset.is_valid()) However that doesn't work and raises the exception: ====================================================================== ERROR: testValid (appname.tests.StructureTestCase) ---------------------------------------------------------------------- Traceback (most recent call last): File "/paht/to/project/tests.py", line 494, in testValid formset = BracketInlineFormset(data) File "/path/to/django/forms/models.py", line 672, in __init__ self.instance = self.fk.rel.to() AttributeError: 'BracketInlineFormset' object has no attribute 'fk' ---------------------------------------------------------------------- The Django documentation (for formset validation) implies one can do this. How come this isn't working? How do I test the custom clean()/validation for my inline formset?

    Read the article

  • How to write data by dynamic parameter name

    - by Maxim Welikobratov
    I need to be able to write data to datastore of google-app-engine for some known entity. But I don't want write assignment code for each parameter of the entity. I meen, I don't want do like this val_1 = self.request.get('prop_1') val_2 = self.request.get('prop_2') ... val_N = self.request.get('prop_N') item.prop_1 = val_1 item.prop_2 = val_2 ... item.prop_N = val_N item.put() instead, I want to do something like this args = self.request.arguments() for prop_name in args: item.set(prop_name, self.request.get(prop_name)) item.put() dose anybody know how to do this trick?

    Read the article

  • django on appengine

    - by aks
    I am impressed with django.Am am currenty a java developer.I want to make some cool websites for myself but i want to host it in some third pary environmet. Now the question is can i host the django application on appengine?If yes , how?? Are there any site built using django which are already hosted on appengine?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • How to make Universal Feed Parser only parse feeds?

    - by piquadrat
    I'm trying to get content from external feeds on my Django web site with Universal Feed Parser. I want to have some user error handling, e.g. if the user supplies a URL that is not a feed. When I tried how feedparser responds to faulty input, I was surprised to see that feedparser does not throw any Exceptions at all. E.g. on HTML content, it tries to parse some information from the HTML code, and on non-existing domains, it returns a mostly empty dictionary: {'bozo': 1, 'bozo_exception': URLError(gaierror(-2, 'Name or service not known'),), 'encoding': 'utf-8', 'entries': [], 'feed': {}, 'version': None} Other faulty input manifest themselves in the status_code or the namespaces values in the returned dictionary. So, what's the best approach to have sane error checking without resorting to an endless cascade of if .. elif .. elif ...?

    Read the article

  • Trying to output a list using class

    - by captain morgan
    Am trying to get the moving average of a price..but i keep getting an attribute error in my Moving_Average class. ('Moving_Average' object has no attribute 'days'). Here is what I have: class Moving_Average: def calculation(self, alist:list,days:int): m = self.days prices = alist[1::2] average = [0]* len(prices) signal = ['']* len(prices) for m in range(0,len(prices)-days+1): average[m+2] = sum(prices[m:m+days])/days if prices[m+2] < average[m+2]: signal[m+2]='SELL' elif prices[m+2] > average[m+2] and prices[m+1] < average[m+1]: signal[m+2]='BUY' else: signal[m+2] ='' return average,signal def print_report(symbol:str,strategy:str): print('SYMBOL: ', symbol) print('STRATEGY: ', strategy) print('Date Closing Strategy Signal') def user(): strategy = ''' Which of the following strategy would you like to use? * Simple Moving Average [S] * Directional Indicator[D] Please enter your choice: ''' if signal_strategy in 'Ss': days = input('Please enter the number of days for the average') days = int(days) strategy = 'Simple Moving Average {}-days'.format(str(days)) m = Moving_Average() ma = m.calculation(gg, days) print(ma) gg is an list that contains date and prices. [2013-10-01,60,2013-10-02,60] The output is supposed to look like: Date Price Average Signal 2013-10-01 60.0 2013-10-02 60.0 60.00 BUY

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • How to generate lots of redundant ajax elements like checkboxes and pulldowns in Django?

    - by iJames
    Hello folks. I've been getting lots of answers from stackoverflow now that I'm in Django just be searching. Now I hope my question will also create some value for everybody. In choosing Django, I was hoping there was some similar mechanism to the way you can do partials in ROR. This was going to help me in two ways. One was in generating repeating indexed forms or form elements, and also in rendering only a piece of the page on the round trip. I've done a little bit of that by using taconite with a simple URL click but now I'm trying to get more advanced. This will focus on the form issue which boils down to how to iterate over a secondary object. If I have a list of photo instances, each of which has a couple of parameters, let's say a size and a quantity. I want to generate form elements for each photo instance separately. But then I have two lists I want to iterate on at the same time. Context: photos : Photo.objects.all() and forms = {} for photo in photos: forms[photo.id] = PhotoForm() In other words we've got a list of photo objects and a dict of forms based on the photo.id. Here's an abstraction of the template: {% for photo in photos %} {% include "photoview.html" %} {% comment %} So here I want to use the photo.id as an index to get the correct form. So that each photo has its own form. I would want to have a different action and each form field would be unique. Is that possible? How can I iterate on that? Thanks! {% endcomment %} Quantity: {{ oi.quantity }} {{ form.quantity }} Dimensions: {{ oi.size }} {{ form.size }} {% endfor %} What can I do about this simple case. And how can I make it where every control is automatically updating the server instead of using a form at all? Thanks! James

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • PostgreSQL pgdb driver raises "can't rollback" exception

    - by David Parunakian
    Hello, for some reason I'm experiencing the Operational Error with "can't rollback" message when I attempt to roll back my transaction in the following context: try: cursors[instance].execute("lock revision, app, timeout IN SHARE MODE") cursors[instance].execute("insert into app (type, active, active_revision, contents, z) values ('session', true, %s, %s, 0) returning id", (cRevision, sessionId)) sAppId = cursors[instance].fetchone()[0] cursors[instance].execute("insert into revision (app_id, type) values (%s, 'active')", (sAppId,)) cursors[instance].execute("insert into timeout (app_id, last_seen) values (%s, now())", (sAppId,)) connections[instance].commit() except pgdb.DatabaseError, e: connections[instance].rollback() return "{status: 'error', errno:4, errmsg: \"%s\"}"%(str(e).replace('\"', '\\"').replace('\n', '\\n').replace('\r', '\\r')) The driver in use is PGDB. What is fundamentally wrong here?

    Read the article

  • Is django orm & templates thread safe?

    - by Piotr Czapla
    I'm using django orm and templates to create a background service that is ran as management command. Do you know if django is thread safe? I'd like to use threads to speed up processing. The processing is blocked by I/O not CPU so I don't care about performance hit caused by GIL.

    Read the article

  • getting global name not defined error

    - by nashr rafeeg
    i have the following class class notify(): def __init__(self,server="localhost", port=23053): self.host = server self.port = port register = gntp.GNTPRegister() register.add_header('Application-Name',"SVN Monitor") register.add_notification("svnupdate",True) growl(register) def svn_update(self, author="Unknown", files=0): notice = gntp.GNTPNotice() notice.add_header('Application-Name',"SVN Monitor") notice.add_header('Notification-Name', "svnupdate") notice.add_header('Notification-Title',"SVN Commit") # notice.add_header('Notification-Icon',"") notice.add_header('Notification-Text',Msg) growl(notice) def growl(data): s = socket.socket(socket.AF_INET, socket.SOCK_STREAM) s.connect((self.host,self.port)) s.send(data) response = gntp.parse_gntp(s.recv(1024)) print response s.close() but when ever i try to use this class via the follwoing code i get 'NameError: global name 'growl' is not defined' from growlnotify import * n = notify() n.svn_update() any one has an idea what is going on here ? cheers nash

    Read the article

  • Setting up relations/mappings for a SQLAlchemy many-to-many database

    - by Brent Ramerth
    I'm new to SQLAlchemy and relational databases, and I'm trying to set up a model for an annotated lexicon. I want to support an arbitrary number of key-value annotations for the words which can be added or removed at runtime. Since there will be a lot of repetition in the names of the keys, I don't want to use this solution directly, although the code is similar. My design has word objects and property objects. The words and properties are stored in separate tables with a property_values table that links the two. Here's the code: from sqlalchemy import Column, Integer, String, Table, create_engine from sqlalchemy import MetaData, ForeignKey from sqlalchemy.orm import relation, mapper, sessionmaker from sqlalchemy.ext.declarative import declarative_base engine = create_engine('sqlite:///test.db', echo=True) meta = MetaData(bind=engine) property_values = Table('property_values', meta, Column('word_id', Integer, ForeignKey('words.id')), Column('property_id', Integer, ForeignKey('properties.id')), Column('value', String(20)) ) words = Table('words', meta, Column('id', Integer, primary_key=True), Column('name', String(20)), Column('freq', Integer) ) properties = Table('properties', meta, Column('id', Integer, primary_key=True), Column('name', String(20), nullable=False, unique=True) ) meta.create_all() class Word(object): def __init__(self, name, freq=1): self.name = name self.freq = freq class Property(object): def __init__(self, name): self.name = name mapper(Property, properties) Now I'd like to be able to do the following: Session = sessionmaker(bind=engine) s = Session() word = Word('foo', 42) word['bar'] = 'yes' # or word.bar = 'yes' ? s.add(word) s.commit() Ideally this should add 1|foo|42 to the words table, add 1|bar to the properties table, and add 1|1|yes to the property_values table. However, I don't have the right mappings and relations in place to make this happen. I get the sense from reading the documentation at http://www.sqlalchemy.org/docs/05/mappers.html#association-pattern that I want to use an association proxy or something of that sort here, but the syntax is unclear to me. I experimented with this: mapper(Word, words, properties={ 'properties': relation(Property, secondary=property_values) }) but this mapper only fills in the foreign key values, and I need to fill in the other value as well. Any assistance would be greatly appreciated.

    Read the article

< Previous Page | 386 387 388 389 390 391 392 393 394 395 396 397  | Next Page >