Search Results

Search found 2776 results on 112 pages for 'overlapping matches'.

Page 40/112 | < Previous Page | 36 37 38 39 40 41 42 43 44 45 46 47  | Next Page >

  • ruby recursive regex

    - by Reed Debaets
    So why is this not working? I'm creating a regex that will match a formula (which is then part of a larger standard description). But I'm stuck here, as it doesn't appear to want to match embedded formulas within a formula. stat = /(Stat3|Stat2|Stat1)/ number_sym = /[0-9]*/ formula_sym = /((target's )?#{stat}|#{number_sym}|N#{number_sym})\%?/ math_sym = /(\+|\-|\*|\/|\%)/ formula = /^\((#{formula}|#{formula_sym}) (#{math_sym} (#{formula}|#{formula_sym}))?\)$/ p "(target's Stat2 * N1%)".match(formula).to_s #matches p "((target's Stat2 * N1%) + 3)".match(formula).to_s #no match p "(Stat1 + ((target's Stat2 * N1%) + 3))".match(formula).to_s #no match

    Read the article

  • Regex to exclude 1 word out of a regex code.

    - by Mech Software
    I need a regex expert to help out on this one. Examples I've found on here and the net I cant seem to get right. I'm using PHP and I have the following regex expression /([^a-zA-Z0-9])GC([A-Z0-9]+)/ This matches items like GCABCD GC123A, etc. What i need to do is EXCLUDE GCSTATS from this. So basically I want it to work just as it has, except, ignore GCSTATS in the regex.

    Read the article

  • Help with Oracle Query

    - by Gnaniyar Zubair
    I want to delete all the records where field name class="10010" from Table A and AentryId = BentryId from Table B. if i delete the entryId 12 which matches className=10010 from Table A and the same time that same id should delete from Table B also. Table A: AentryId className 12 10010 13 10011 14 10010 15 10011 Table B: BentryId name 12 xyz 13 abc 14 aaa

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • LINQ - array property contains element from another array

    - by Rob
    I have a object (product), with a property of type 'array' e.g. product.tags = {"tag1","tag2","tag9"} I have an array of input tags to filter on. ... but this is not quite working: List<string> filterTags = new List<string>() { "tag1", "tag3" }; var matches = from p in products where p.Tags.Contains(filterTags) select p; Any recommendations? Thanks.

    Read the article

  • Regex validate dates like "Sun, 20 Jun 10"

    - by Trindaz
    Hi, I'm working on a regular expression that will only return true when a date string is in a format something like 'ddd, dd mmm yy'. Valid matches would be values like "Sun, 20 Jun 10" or "Mon, 21 Jun 10" but not "Sunday, 20 Jun 10" or "20 Jun 10". This will be used with mb_ereg in PHP. My attempts so far have only got me half way there. Any help appreciated! Thanks, Dave

    Read the article

  • Java Google App Engine Datastore: 'IN' operator available on JDO query filters, as with Python?

    - by Jim Blackler
    This page describes an 'IN' operator that can be used in GAE Datastore to compare a field against a list of possible matches, not just a single value: However this is for Python. In Java (App Engine 1.2.5), trying query.setFilter("someField IN param"); on my javax.jdo.query fires a JDOUserException 'Portion of expression could not be parsed: IN param'. Is there a way this can be done?

    Read the article

  • PHP regular expression find and append to string

    - by Gary
    I'm trying to use regular expressions (preg_match and preg_replace) to do the following: Find a string like this: {%title=append me to the title%} Then extract out the title part and the append me to the title part. Which I can then use to perform a str_replace(), etc. Given that I'm terrible at regular expressions, my code is failing... preg_match('/\{\%title\=(\w+.)\%\}/', $string, $matches); What pattern do I need? :/

    Read the article

  • JQUERY Effect highlight, control the Start & End colors

    - by nobosh
    I have the following: $(".notifycell_email_dailydigest").effect('highlight'); The element I want to highlight is over a gray background. Problem is the highlight goes from Yellow to white, and has this ugly slow pause at the end on the white which makes the animation look horrible. How can I modify the highlighy to start with the yellow but end on the gray so it matches the background? Thanks

    Read the article

  • Slow (to none) performance on SQL 2005 after attaching SQL 2000 database

    - by ploft
    Issue: Using the detach/attach SQL database from a SQL 2000 SP4 instance to a much beefier SQL 2005 SP2 server. Run reindex, reorganize and update statistics a couple of times, but without any success. Queries on SQL 2000 took about 1-2 sec. to complete, now the same queries take 2-3 min on the SQL 2005 (and even 2008 - tested it there also). Have looked at the execution plans and the overall percent matches or are alike on each server.

    Read the article

  • Array comparision

    - by devtech
    Hello Guys, I have two arrays A & B,I want to do a compare among the elements between the two arrays. @a = "abc,def,efg,ghy,klm,ghn" @b= "def,ghy,jgk,lom,com,klm" if any element matches then set a flag 0 else 1. Is there any simple way to do this. please advise

    Read the article

  • MySQL - Fulltext Index Search Issue

    - by RC
    Hi all, Two rows in the my database have the following data: brand | product | style ================================================= Doc Martens | Doc Martens 1460 Boots | NULL NewBalance | New Balance WR1062 SG Width | NULL Mininum word length is set to 3, and a FULLTEXT index is created across all the three columns above. When I run a search for IS BOOLEAN matches for +doc in the index, I get the first row returned as a result. When I search for +new, I get no results. Can someone explain why? Thanks.

    Read the article

  • multiple word Predictive/autocomplete textarea?

    - by pablo
    Hi there I'm lookin for a javascript plugin (for js/any framework) I want to create a textarea that while I type will using a supplied data array, check for predictive matches to the current word im typing and try to suggest a solution. All solutions I've found so far (for jquery) only match one word, then end... I want to write like a sentence or paragraph but have autocomplete ability. Mockup image attached.

    Read the article

  • How to find files according RegEx in C#

    - by bao
    I need to get list of files on some drive with paths that matches specific pattern, for example FA\d\d\d\d.xml where \d is digit (0,1,2..9). So files can have names like FA5423.xml. What is the most efficient name to do this?

    Read the article

  • Determining when scrolled to bottom of a page with Javascript

    - by chimerical
    I'm trying to determine when I've scrolled to the bottom of the page (without using any JS library), but so far, I'm a bit confused over which one of the following to use. The most promising one I've seen is window.scrollY, but even when scrolled to the bottom of the page, it never matches the value of window.innerHeight. What's the best way to do this? window.innerWidth window.innerHeight window.outerWidth window.outerHeight window.scrollX window.scrollY document.body.scrollWidth document.body.scrollHeight document.body.scrollTop document.body.scrollLeft document.body.offsetTop document.body.offsetLeft document.body.offsetWidth document.body.offsetHeight

    Read the article

  • Parsing or Extracting the content of html table.

    - by Harikrishna
    Can I parse the html tables by giving only column name ? Like only those data should be extracted from the table which matches those column names I give. Like for example I have table of column names like serial no., name, address, phone no,total Rs.. And I want to extract the information about only name, phone no and total Rs.. Then how can I do it?

    Read the article

  • SQL Query to truncate table in IBM DB2

    - by Cshah
    Hi, Can any one give me the syntax to truncate a table in IBM DB2. I m running the following command: truncate table tableName immediate; The eror is DB2 SQL Error: SQLCODE=-104, SQLSTATE=42601, SQLERRMC=table;truncate ;JOIN , DRIVER=3.50.152 Message: An unexpected token "table" was found following "truncate ". Expected tokens may include: "JOIN ".. SQLCODE=-104, SQLSTATE=42601, DRIVER=3.50.152 The syntax matches the one specified in the reference docs of IBM : http://publib.boulder.ibm.com/infocenter/dzichelp/v2r2/index.jsp?topic=/com.ibm.db29.doc.sqlref/db2z_sql_truncate.htm

    Read the article

  • How do I debug this javascript -- I don't get an error in Firebug but it's not working as expected.

    - by Angela
    I installed the plugin better-edit-in-place (http://github.com/nakajima/better-edit-in-place) but I dont' seem to be able to make it work. The plugin creates javascript, and also automatically creates a rel and class. The expected behavior is to make an edit-in-place, but it currently is not. Nothing happens when I mouse over. When I use firebug, it is rendering the value to be edited correctly: <span rel="/emails/1" id="email_1_days" class="editable">7</span> And it is showing the full javascript which should work on class editable. I didn't copy everything, just the chunks that seemed should be operationable if I have a class name in the DOM. // Editable: Better in-place-editing // http://github.com/nakajima/nakatype/wikis/better-edit-in-place-editable-js var Editable = Class.create({ initialize: function(element, options) { this.element = $(element); Object.extend(this, options); // Set default values for options this.editField = this.editField || {}; this.editField.type = this.editField.type || 'input'; this.onLoading = this.onLoading || Prototype.emptyFunction; this.onComplete = this.onComplete || Prototype.emptyFunction; this.field = this.parseField(); this.value = this.element.innerHTML; this.setupForm(); this.setupBehaviors(); }, // In order to parse the field correctly, it's necessary that the element // you want to edit in place for have an id of (model_name)_(id)_(field_name). // For example, if you want to edit the "caption" field in a "Photo" model, // your id should be something like "photo_#{@photo.id}_caption". // If you want to edit the "comment_body" field in a "MemberBlogPost" model, // it would be: "member_blog_post_#{@member_blog_post.id}_comment_body" parseField: function() { var matches = this.element.id.match(/(.*)_\d*_(.*)/); this.modelName = matches[1]; this.fieldName = matches[2]; if (this.editField.foreignKey) this.fieldName += '_id'; return this.modelName + '[' + this.fieldName + ']'; }, // Create the editing form for the editable and inserts it after the element. // If window._token is defined, then we add a hidden element that contains the // authenticity_token for the AJAX request. setupForm: function() { this.editForm = new Element('form', { 'action': this.element.readAttribute('rel'), 'style':'display:none', 'class':'in-place-editor' }); this.setupInputElement(); if (this.editField.tag != 'select') { this.saveInput = new Element('input', { type:'submit', value: Editable.options.saveText }); if (this.submitButtonClass) this.saveInput.addClassName(this.submitButtonClass); this.cancelLink = new Element('a', { href:'#' }).update(Editable.options.cancelText); if (this.cancelButtonClass) this.cancelLink.addClassName(this.cancelButtonClass); } var methodInput = new Element('input', { type:'hidden', value:'put', name:'_method' }); if (typeof(window._token) != 'undefined') { this.editForm.insert(new Element('input', { type: 'hidden', value: window._token, name: 'authenticity_token' })); } this.editForm.insert(this.editField.element); if (this.editField.type != 'select') { this.editForm.insert(this.saveInput); this.editForm.insert(this.cancelLink); } this.editForm.insert(methodInput); this.element.insert({ after: this.editForm }); }, // Create input element - text input, text area or select box. setupInputElement: function() { this.editField.element = new Element(this.editField.type, { 'name':this.field, 'id':('edit_' + this.element.id) }); if(this.editField['class']) this.editField.element.addClassName(this.editField['class']); if(this.editField.type == 'select') { // Create options var options = this.editField.options.map(function(option) { return new Option(option[0], option[1]); }); // And assign them to select element options.each(function(option, index) { this.editField.element.options[index] = options[index]; }.bind(this)); // Set selected option try { this.editField.element.selectedIndex = $A(this.editField.element.options).find(function(option) { return option.text == this.element.innerHTML; }.bind(this)).index; } catch(e) { this.editField.element.selectedIndex = 0; } // Set event handlers to automaticall submit form when option is changed this.editField.element.observe('blur', this.cancel.bind(this)); this.editField.element.observe('change', this.save.bind(this)); } else { // Copy value of the element to the input this.editField.element.value = this.element.innerHTML; } }, // Sets up event handles for editable. setupBehaviors: function() { this.element.observe('click', this.edit.bindAsEventListener(this)); if (this.saveInput) this.editForm.observe('submit', this.save.bindAsEventListener(this)); if (this.cancelLink) this.cancelLink.observe('click', this.cancel.bindAsEventListener(this)); }, // Event Handler that activates form and hides element. edit: function(event) { this.element.hide(); this.editForm.show(); this.editField.element.activate ? this.editField.element.activate() : this.editField.element.focus(); if (event) event.stop(); }, // Event handler that makes request to server, then handles a JSON response. save: function(event) { var pars = this.editForm.serialize(true); var url = this.editForm.readAttribute('action'); this.editForm.disable(); new Ajax.Request(url + ".json", { method: 'put', parameters: pars, onSuccess: function(transport) { var json = transport.responseText.evalJSON(); var value; if (json[this.modelName]) { value = json[this.modelName][this.fieldName]; } else { value = json[this.fieldName]; } // If we're using foreign key, read value from the form // instead of displaying foreign key ID if (this.editField.foreignKey) { value = $A(this.editField.element.options).find(function(option) { return option.value == value; }).text; } this.value = value; this.editField.element.value = this.value; this.element.update(this.value); this.editForm.enable(); if (Editable.afterSave) { Editable.afterSave(this); } this.cancel(); }.bind(this), onFailure: function(transport) { this.cancel(); alert("Your change could not be saved."); }.bind(this), onLoading: this.onLoading.bind(this), onComplete: this.onComplete.bind(this) }); if (event) { event.stop(); } }, // Event handler that restores original editable value and hides form. cancel: function(event) { this.element.show(); this.editField.element.value = this.value; this.editForm.hide(); if (event) { event.stop(); } }, // Removes editable behavior from an element. clobber: function() { this.element.stopObserving('click'); try { this.editForm.remove(); delete(this); } catch(e) { delete(this); } } }); // Editable class methods. Object.extend(Editable, { options: { saveText: 'Save', cancelText: 'Cancel' }, create: function(element) { new Editable(element); }, setupAll: function(klass) { klass = klass || '.editable'; $$(klass).each(Editable.create); } }); But when I point my mouse at the element, no in-place-editing action!

    Read the article

  • Array comparison

    - by devtech
    I have two arrays A & B. I want to do a compare among the elements of the two arrays. @a = "abc,def,efg,ghy,klm,ghn" @b = "def,ghy,jgk,lom,com,klm" If any element matches then set a flag 0 else 1. Is there any simple way to do this? Please advise.

    Read the article

  • Regular expressions and matching question marks in URLs

    - by James P.
    I'm having trouble finding a regular expression that matches the following String. Korben;http://feeds.feedburner.com/KorbensBlog-UpgradeYourMind?format=xml;1 One problem is escaping the question mark. Java's pattern matcher doesn't seem to accept \? as a valid escape sequence but it also fails to work with the tester at myregexp.com. Here's what I have so far: ([a-zA-Z0-9])+;http://([a-zA-Z0-9./-]+);[0-9]+ Any suggestions?

    Read the article

< Previous Page | 36 37 38 39 40 41 42 43 44 45 46 47  | Next Page >