Search Results

Search found 2776 results on 112 pages for 'overlapping matches'.

Page 42/112 | < Previous Page | 38 39 40 41 42 43 44 45 46 47 48 49  | Next Page >

  • java filenames filter pattern

    - by Sergey
    Hello, I need to implement File[] files = getFiles( String folderName, String ptrn ); Where ptrn is a command prompt style pattern like "*2010*.txt" I'm familar with FilenameFilter class, but can't implement public boolean accept(File dir, String filename) because String.matches() doesn't accept such patterns. Thanks!

    Read the article

  • Chrome extension Page Action JS

    - by Radek Šimko
    I'm trying to create an extension using this docs: http://code.google.com/chrome/extensions/content_scripts.html I want a part of JS code to run when document is ready (loaded). This is my manifest.json: { "name": "OwnExtension", "version": "0.1", "content_scripts": [ { "matches": ["https://my.site.eu/*"], "css": ["styles.css"], "js": ["main.js"] } ] } This is my main.js: alert(10); Am I doing sth wrong, that nothing happend when page https://my.site.eu/ loaded in browser?

    Read the article

  • Regular Expression for CSV with numbers

    - by Bernie Perez
    I'm looking for some regular expression to help parse my CSV file. The file has lines of number,number number,number Comment I want to skip number,number number,number Ex: 319,5446 564425,87 Text to skip 27,765564 I read each line into a string and I wanted to use some regular express to make sure the line matches the pattern of (number,number). If not then don't use the line.

    Read the article

  • Match Regex across newlines?

    - by Jörg Battermann
    I have a regex ( "(&lt;lof&lt;).*?(&gt;&gt;)" ) that works and matches perfectly on single line input. However, if the input contains newlines between the two () parts it does not match at all. What's the best way to ignore any newlines at all in that case?

    Read the article

  • find the all the stored procedures and jobs in sql server 2000

    - by kumar
    Hi, In SQL SERVER 2005 This query works fine : Select * from sys.procedures where object_definition(object_id) like '%J%' SELECT * FROM MSDB.DBO.SYSJOBS WHERE NAME LIKE '%J%' but in sql server 2000 it is not working. Here i need to find the all the stored procedures and jobs which matches my string ? how to find in sql server 2000 ? regards, kumar

    Read the article

  • Flatten date range memberships retaining only the highest priority membership (TRANSACT-SQL)

    - by shadowranger
    Problem statement: A table contains an item_id, a category_id and a date range (begin_date and end_date). No item may be in more than one category on any given date (in general; during daily rebuilding it can be in an invalid state temporarily). By default, all items are added (and re-added if removed) to a category (derived from outside data) automatically on a daily basis, and their membership in that category matches the lifespan of the item (items have their own begin and end date, and usually spend their entire lives in the same category, which is why this matches). For items in category X, it is occasionally desirable to override the default category by adding them to category Y. Membership in category Y could entirely replace membership in category X (that is, the begin and end dates for membership in category Y would match the begin and end dates of the item itself), or it could override it for an arbitrary period of time (at the beginning, middle or end the item's lifespan, possibly overriding for short periods at multiple times). Membership in category Y is not renewed automatically and additions to that category is done by manual data entry. Every day, when category X is rebuilt, we get an overlap, where any item in category Y will now be in category X as well (which is forbidden, as noted previously). Goal: After each repopulation of category X (which is done in a rather complicated and fragile manner, and ideally would be left alone), I'm trying to find an efficient means of writing a stored procedure that: Identifies the overlaps Changes existing entries, adds new ones where necessary (such as in the case where an item starts in category X, switches to category Y, then eventually switches back to category X before ending), or removes entries (when an item is in category Y for its entire life) such that every item remains in category Y (and only Y) where specified, while category X membership is maintained when not overridden by category Y. Does not affect memberships of categories A, B, C, Z, etc., which do not have override categories and are built separately, by completely different rules. Note: It can be assumed that X membership covers the entire lifespan of the item before this procedure is called, so it is unnecessary to query any data outside this table. Bonus credit: If for some reason there are two adjacent or overlapping memberships in for the same item in category Y, stitching them together into a single entry is appreciated, but not necessary. Example: item_id category_id begin_date end_date 1 X 20080101 20090628 1 Y 20090101 20090131 1 Y 20090601 20090628 2 X 20080201 20080731 2 Y 20080201 20080731 Should become: item_id category_id begin_date end_date 1 X 20080101 20081231 1 Y 20090101 20090131 1 X 20090201 20090531 1 Y 20090601 20090628 2 Y 20080201 20080731 If it matters, this needs to work on SQL Server 2005 and SQL Server 2008

    Read the article

  • Regular expressions

    - by Infinity
    Hello guys! I need a regular expression for findin a pattern. This is the pattern: id|name|code|mobile I created a pattern for this if I want to search by id (if id = 1): .*1.*|.*|.*|.* But it matches every pattern that contains number 1. What's the problem with it?

    Read the article

  • How to compare arrays in Perl?

    - by devtech
    I have two arrays A & B. I want to do a compare among the elements of the two arrays. my @a = qw"abc def efg ghy klm ghn"; my @b = qw"def ghy jgk lom com klm"; If any element matches then set a flag. Is there any simple way to do this? Please advise.

    Read the article

  • Using \b in C# regular expressions doesn't work?

    - by Nikhil
    I am wondering why the following regex does not match. string query = "\"1 2\" 3"; string pattern = string.Format(@"\b{0}\b", Regex.Escape("\"1 2\"")); string repl = Regex.Replace(query, pattern, "", RegexOptions.CultureInvariant); Note that if I remove the word boundary characters (\b) from pattern, it matches fine. Is there something about '\b' that might be tripping this up?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • XY-Scatter Chart In SSRS Won't Display Points

    - by Dalin Seivewright
    I'm a bit confused with this one. I have a Dataset with a BackupDate and a BackupTime as well as a BackupType. The BackupDate is comprised of 12 characters from the left of a datetime string within a table. The BackupTime is comprised of 8 characters from the right of that same datetime string. So for example: BackupDate would be 'December 12 2008' and the BackupTime would be '12:53PM.' I have added an XY-scatter chart to the report. I've added a 'series' value for the BackupType (so one can distinguish between a Full/Incr/Log backup). I've added a category value of BackupDate and set the Scale for the X-axis from the Min of BackupDate to the Max of BackupDate. I've then added an item to the Values with the Y variable set to BackupTime and the X variable set to BackupDate. The interval for the Y-axis is 12:00AM to 11:59PM and the formatting for the labels is 'hh:mmtt'. The BackupTime matches the format of the Y-axis. The BackupDate matches the format of the X-axis. 10 entries are retrieved by my Dataset and the Legend is properly populated by the BackupType field. No points are being plotted on the graph and no markers/pointers are shown if they are enabled. There should be a point on the graph for every point in time of each day there is a backup of a specific type. Am I missing something? Does anyone know of a good tutorial dealing specifically with XY-scatter graphs and using them in a way I intend? I am using the 2005 version of SSRS rather than the 2008 version. Screenshot of what my chart currently looks like: In case it could be dataset related: SELECT TOP (10) backup_type, LTRIM(RTRIM(LEFT(backup_finish_date, 12))) AS BackupDate, LTRIM(RTRIM(RIGHT(backup_finish_date, 8))) AS BackupTime FROM DBARepository.Backup_History As requested, here are the results of this query. There is a Where clause to constrain the results to a specific database of a specific server that was not included in the above SQL Query. Log Dec 26 2008 12:00PM Log Dec 27 2008 4:00AM Log Dec 27 2008 8:00AM Log Dec 27 2008 12:00PM Log Dec 27 2008 4:00PM Log Dec 27 2008 8:00PM Database Dec 27 2008 10:01PM Log Dec 28 2008 12:00AM Log Dec 28 2008 4:00AM Log Dec 28 2008 8:00AM

    Read the article

  • using regular expression in Java

    - by Mrityunjay
    Hi, i need to check a string that should contain only ABCDEFG characters, in any sequence and with only 7 characters. Please let me know the correct way of using regular expression. as corrently i am using String abs = "ABPID"; if(!Pattern.matches("[[ABCDEFG]", abs)) System.out.println("Error"); i am using the following code which works when i use the String abcdefg but for other cases it fails. please help me out.

    Read the article

  • Erlang: Find intersections in a ets table

    - by Yadira Suazo
    I have an ets with the next items: [at, {other_place}, me], [other_place, {place}, {other_place}]], [at, {place}, me], [on, {surface}, {object}], [small, {object}] And I have the list [[at, door, me],[on, floor, chair],[small, bannanas]] I need to compare every item in the ets table to an item in the list and if the first one is the same atom, replace the items in round brackets. So if I have [at, door, me], it matches with [at, {other_place}, me], I have to change {other_place} for the atom door in all the ets table.

    Read the article

  • rails solr search limit total search results / get fixed number of results

    - by kLeos
    I'm trying to perform a search, order the results randomly, and only return a number of results, not all matches. Something like limit(2) I've tried using the Solr param 'rows' but that doesn't seem to do anything: @featured_articles = Article.search do with(:is_featured, true) order_by :random adjust_solr_params do |params| params[:rows] = 2 end end @featured_articles.total should be 2, but it returns more than 2 How can I get a randomized fixed number of results?

    Read the article

  • Issue with my regular expression?

    - by Rubans
    I'm trying to locate the number matches in a relative path for directory up references("..\"). So I have the following pattern : "(..\)" which works as expected for the path "....\a\b" where it will give me 2 successfull groups ("..\") but when I try the path "..\a\b" it will also return 2 when it should be 1. I tried this in a reg ex tool such Expresso and it seems to work as expected in there but not in in .net, any ideas?

    Read the article

  • [bash] Escape a string for sed search pattern

    - by Alexander Gladysh
    In my bash script I have an external (received from user) string, which I should use in sed pattern. REPLACE="<funny characters here>" sed "s/KEYWORD/$REPLACE/g" How can I escape the $REPLACE string so it would be safely accepted by sed as a literal replacement? NOTE: The KEYWORD is a dumb substring with no matches etc. It is not supplied by user.

    Read the article

  • Double request from mod-rewrite

    - by Dave
    I've written a module that sets Apache environment variables to be used by mod-rewrite. It hooks into ap_hook_post_read_request() and that works fine, but if mod-rewrite matches a RewriteRule then it makes a second call to my request handler with the rewritten URL. This looks like a new request to me in that the environment variables are no longer set and therefore I have to execute my (expensive) code twice for each hit. What am I doing wrong, or is there a work around for this? Thanks

    Read the article

  • c# eventhandling error

    - by bragin.www
    i have method private void getValues(object sender, EventArgs e) { int id = int.Parse(dgvTable.Rows[dgvTable.CurrentRow.Index].Cells[0].Value.ToString()); var values = from c in v.db.TotalDoc where c.TotalID == id select c.TotalAmount; dgvValues.DataSource = values; } and datagridview "dgvTable" error at this line dgvTable.CellClick += new EventHadler(getValues); error text is: No overload for 'getValues' matches delegate 'System.EventHandler' please help!

    Read the article

  • Disadvantage of unlifted type products?

    - by peaker
    In Haskell, lifted type products mean that there's a semantic difference between (a,b,c) and (a, (b, c)). If all pattern matches of all products was always irrefutable, then there would be no difference, and (a, b, c) could be syntactic sugar for (a, (b, c)). Why did Haskell choose to lift type products?

    Read the article

  • Does anyone have experience simultaneously running a Drupal and Wordpress site and redirecting some

    - by DKinzer
    This is a really weird question and I apologize: I've been asked if it's possible not to import our blog from Wordpress to Drupal but just keep it in Wordpress as an archive and re-direct our users say from hostname/blog/... to hostname/wordpress/... when a URL matches the Wordpress URL pattern. I've never heard of anyone trying this and I'm wondering about pitfalls and whether or not it's even possible. Thanks! D

    Read the article

  • Is it bad practice to use an enum that maps to some seed data in a Database?

    - by skb
    I have a table in my database called "OrderItemType" which has about 5 records for the different OrderItemTypes in my system. Each OrderItem contains an OrderItemType, and this gives me referential integrity. In my middletier code, I also have an enum which matches the values in this table so that I can have business logic for the different types. My dev manager says he hates it when people do this, and I am not exactly sure why. Is there a better practice I should be following?

    Read the article

  • awk - Remove line if field is duplicate

    - by Kyle
    Looking for an awk (or sed) one-liner to remove lines from the output if the first field matches. An example for removing duplicate lines I've seen is: awk 'a !~ $0; {a=$0}' Tried using it for a basis with no luck (I thought changing the $0's to $1's would do the trick, but didn't seem to work).

    Read the article

  • I want Result Like Google

    - by parvaiz ahmad
    tbl_Phrases id Phrase 1 World top leading Company 2 Top Leading World Agencies 3 Top Companies 5 Top Leading Companies 6 World Top Market 7 Top Companies 8 Economic Market 9 World Company i want result by full text search where there is high proximity of relevance if i search like : get all phrase where phrase like World top leading Company the result should be like World top leading Company Top Leading Companies Top Leading World Agencies Top Companies World Company World Top Market means i want the phrase at the top whose relevance is 100% then the relevance decreases like 90%, 80% .....up to 10% at last if any word from input matches with any word from phrase

    Read the article

  • Find last match with python regular expression

    - by SDD
    I wanto to match the last occurence of a simple pattern in a string, e.g. list = re.findall(r"\w+ AAAA \w+", "foo bar AAAA foo2 AAAA bar2) print "last match: ", list[len(list)-1] however, if the string is very long, a huge list of matches is generated. Is there a more direct way to match the second occurence of "AAAA" or should I use this workaround?

    Read the article

< Previous Page | 38 39 40 41 42 43 44 45 46 47 48 49  | Next Page >