Search Results

Search found 2776 results on 112 pages for 'overlapping matches'.

Page 41/112 | < Previous Page | 37 38 39 40 41 42 43 44 45 46 47 48  | Next Page >

  • regular expression help

    - by hao
    <li class="zk_list_c2 f_l"><a title="abc" target="_blank" href="link"> abc </a>&nbsp;</li> how would i extract abc and link? $pattern="/<li class=\"zk_list_c2 f_l\"><a title=\"(.*)\" target=\"_blank\" href=\"(.*)\">\s*(.*)\s*<\/a>&nbsp;<\/li>/m"; preg_match_all($pattern, $content, $matches); the one i have right now doesnt seems to work

    Read the article

  • Regular expressions and matching question marks in URLs

    - by James P.
    I'm having trouble finding a regular expression that matches the following String. Korben;http://feeds.feedburner.com/KorbensBlog-UpgradeYourMind?format=xml;1 One problem is escaping the question mark. Java's pattern matcher doesn't seem to accept \? as a valid escape sequence but it also fails to work with the tester at myregexp.com. Here's what I have so far: ([a-zA-Z0-9])+;http://([a-zA-Z0-9./-]+);[0-9]+ Any suggestions?

    Read the article

  • What method should be used for searching this mysql dataset?

    - by GeoffreyF67
    I've got a mysql dataset that contains 86 million rows. I need to have a relatively fast search through this data. The data I'll be searching through is all strings. I also need to do partial matches. Now, if I have 'foobar' and search for '%oob%' I know it'll be really slow - it has to look at every row to see if there is a match. What methods can be used to speed queries like this up? G-Man

    Read the article

  • Google Chrome Extension

    - by Jamie
    Is there a way to replace inside the DOM of a page using the replace() in javascript In the source code I want to replace: <div class="topbar">Bookmark Us</div> to <div class="topbar"><span class="larger-font">Bookmark Us</span></div> When a Google Chrome extenstion is on the matched website of a URL and it will do the above. Any page that matches: http://www.domain.com/support.php Thanks.

    Read the article

  • Determining when scrolled to bottom of a page with Javascript

    - by chimerical
    I'm trying to determine when I've scrolled to the bottom of the page (without using any JS library), but so far, I'm a bit confused over which one of the following to use. The most promising one I've seen is window.scrollY, but even when scrolled to the bottom of the page, it never matches the value of window.innerHeight. What's the best way to do this? window.innerWidth window.innerHeight window.outerWidth window.outerHeight window.scrollX window.scrollY document.body.scrollWidth document.body.scrollHeight document.body.scrollTop document.body.scrollLeft document.body.offsetTop document.body.offsetLeft document.body.offsetWidth document.body.offsetHeight

    Read the article

  • How to debug 'no entities specified' when working with ZSync and CoreData Syncing

    - by monotreme
    I'm trying to get ZSync to work between a desktop and iPhone app. I've got my schemas set up and all info matches between my MOM and my schema so I should be good to go. When I initiate my sync, however, I get this error. |Miscellaneous|Error| SyncServices precondition failure in [ISyncSession _validateClient:entityNames:beforeDate:clientHasTruthForEntityNames:target:selector:]: no entities specified Anyone know what this means, and how to debug it? I'm a novice with this SyncServices stuff. Cheers!

    Read the article

  • How do I debug this javascript -- I don't get an error in Firebug but it's not working as expected.

    - by Angela
    I installed the plugin better-edit-in-place (http://github.com/nakajima/better-edit-in-place) but I dont' seem to be able to make it work. The plugin creates javascript, and also automatically creates a rel and class. The expected behavior is to make an edit-in-place, but it currently is not. Nothing happens when I mouse over. When I use firebug, it is rendering the value to be edited correctly: <span rel="/emails/1" id="email_1_days" class="editable">7</span> And it is showing the full javascript which should work on class editable. I didn't copy everything, just the chunks that seemed should be operationable if I have a class name in the DOM. // Editable: Better in-place-editing // http://github.com/nakajima/nakatype/wikis/better-edit-in-place-editable-js var Editable = Class.create({ initialize: function(element, options) { this.element = $(element); Object.extend(this, options); // Set default values for options this.editField = this.editField || {}; this.editField.type = this.editField.type || 'input'; this.onLoading = this.onLoading || Prototype.emptyFunction; this.onComplete = this.onComplete || Prototype.emptyFunction; this.field = this.parseField(); this.value = this.element.innerHTML; this.setupForm(); this.setupBehaviors(); }, // In order to parse the field correctly, it's necessary that the element // you want to edit in place for have an id of (model_name)_(id)_(field_name). // For example, if you want to edit the "caption" field in a "Photo" model, // your id should be something like "photo_#{@photo.id}_caption". // If you want to edit the "comment_body" field in a "MemberBlogPost" model, // it would be: "member_blog_post_#{@member_blog_post.id}_comment_body" parseField: function() { var matches = this.element.id.match(/(.*)_\d*_(.*)/); this.modelName = matches[1]; this.fieldName = matches[2]; if (this.editField.foreignKey) this.fieldName += '_id'; return this.modelName + '[' + this.fieldName + ']'; }, // Create the editing form for the editable and inserts it after the element. // If window._token is defined, then we add a hidden element that contains the // authenticity_token for the AJAX request. setupForm: function() { this.editForm = new Element('form', { 'action': this.element.readAttribute('rel'), 'style':'display:none', 'class':'in-place-editor' }); this.setupInputElement(); if (this.editField.tag != 'select') { this.saveInput = new Element('input', { type:'submit', value: Editable.options.saveText }); if (this.submitButtonClass) this.saveInput.addClassName(this.submitButtonClass); this.cancelLink = new Element('a', { href:'#' }).update(Editable.options.cancelText); if (this.cancelButtonClass) this.cancelLink.addClassName(this.cancelButtonClass); } var methodInput = new Element('input', { type:'hidden', value:'put', name:'_method' }); if (typeof(window._token) != 'undefined') { this.editForm.insert(new Element('input', { type: 'hidden', value: window._token, name: 'authenticity_token' })); } this.editForm.insert(this.editField.element); if (this.editField.type != 'select') { this.editForm.insert(this.saveInput); this.editForm.insert(this.cancelLink); } this.editForm.insert(methodInput); this.element.insert({ after: this.editForm }); }, // Create input element - text input, text area or select box. setupInputElement: function() { this.editField.element = new Element(this.editField.type, { 'name':this.field, 'id':('edit_' + this.element.id) }); if(this.editField['class']) this.editField.element.addClassName(this.editField['class']); if(this.editField.type == 'select') { // Create options var options = this.editField.options.map(function(option) { return new Option(option[0], option[1]); }); // And assign them to select element options.each(function(option, index) { this.editField.element.options[index] = options[index]; }.bind(this)); // Set selected option try { this.editField.element.selectedIndex = $A(this.editField.element.options).find(function(option) { return option.text == this.element.innerHTML; }.bind(this)).index; } catch(e) { this.editField.element.selectedIndex = 0; } // Set event handlers to automaticall submit form when option is changed this.editField.element.observe('blur', this.cancel.bind(this)); this.editField.element.observe('change', this.save.bind(this)); } else { // Copy value of the element to the input this.editField.element.value = this.element.innerHTML; } }, // Sets up event handles for editable. setupBehaviors: function() { this.element.observe('click', this.edit.bindAsEventListener(this)); if (this.saveInput) this.editForm.observe('submit', this.save.bindAsEventListener(this)); if (this.cancelLink) this.cancelLink.observe('click', this.cancel.bindAsEventListener(this)); }, // Event Handler that activates form and hides element. edit: function(event) { this.element.hide(); this.editForm.show(); this.editField.element.activate ? this.editField.element.activate() : this.editField.element.focus(); if (event) event.stop(); }, // Event handler that makes request to server, then handles a JSON response. save: function(event) { var pars = this.editForm.serialize(true); var url = this.editForm.readAttribute('action'); this.editForm.disable(); new Ajax.Request(url + ".json", { method: 'put', parameters: pars, onSuccess: function(transport) { var json = transport.responseText.evalJSON(); var value; if (json[this.modelName]) { value = json[this.modelName][this.fieldName]; } else { value = json[this.fieldName]; } // If we're using foreign key, read value from the form // instead of displaying foreign key ID if (this.editField.foreignKey) { value = $A(this.editField.element.options).find(function(option) { return option.value == value; }).text; } this.value = value; this.editField.element.value = this.value; this.element.update(this.value); this.editForm.enable(); if (Editable.afterSave) { Editable.afterSave(this); } this.cancel(); }.bind(this), onFailure: function(transport) { this.cancel(); alert("Your change could not be saved."); }.bind(this), onLoading: this.onLoading.bind(this), onComplete: this.onComplete.bind(this) }); if (event) { event.stop(); } }, // Event handler that restores original editable value and hides form. cancel: function(event) { this.element.show(); this.editField.element.value = this.value; this.editForm.hide(); if (event) { event.stop(); } }, // Removes editable behavior from an element. clobber: function() { this.element.stopObserving('click'); try { this.editForm.remove(); delete(this); } catch(e) { delete(this); } } }); // Editable class methods. Object.extend(Editable, { options: { saveText: 'Save', cancelText: 'Cancel' }, create: function(element) { new Editable(element); }, setupAll: function(klass) { klass = klass || '.editable'; $$(klass).each(Editable.create); } }); But when I point my mouse at the element, no in-place-editing action!

    Read the article

  • Regex negative lookahead

    - by Alyn
    I need to modify this regex href=\"(.*)\" which matches this... href="./pothole_locator_map.aspx?lang=en-gb&lat=53.153977&lng=-3.533306" To NOT match this... href="./pothole_locator_map.aspx?lang=en-gb&lat=53.153977&lng=-3.533306&returnurl=AbandonedVehicles.aspx" Tried this, but with no luck href=\"(.*)\"(?!&returnurl=AbandonedVehicles.aspx) Any help would be much appreciated. Thanks, Al.

    Read the article

  • How do you code up a pattern matching block in scala?

    - by egervari
    How do you code a function that takes in a block of code that contains case statements? For instance, in my block of code, I don't want to code a match or a default case... looking something like this myApi { case Whatever() => // code for case 1 case SomethingElse() => // code for case 2 } And inside of my myApi(), it'll actually do the matches. Help?

    Read the article

  • Regex to match all of a set except certain ones

    - by Davy8
    I'm sure this has been asked before, but I can't seem to find it (or know the proper wording to search for) Basically I want a regex that matches all non-alphanumeric except hyphens. So basically match \W+ except exclude '-' I'm not sure how to exclude specific ones from a premade set.

    Read the article

  • SED: Matching on 2 patterns on the same line

    - by Brian Knott
    Hi I want to delete a line using sed if it matches 2 regular expressions in the same line. EG the line starts with /* and end with */ (comment). The following script will do most of that. sed -e '/^\/*/ d' -e '/*\/$/ d' filename This script will remove all lines that start with * and end with */. I want it to remove the line only if is meets both criteria not one.

    Read the article

  • How to find files according RegEx in C#

    - by bao
    I need to get list of files on some drive with paths that matches specific pattern, for example FA\d\d\d\d.xml where \d is digit (0,1,2..9). So files can have names like FA5423.xml. What is the most efficient name to do this?

    Read the article

  • Rails Pretty URL with Decimals

    - by Kevin Sylvestre
    I have a rails application that allows searches using longitude and latitude. I have added a 'pretty' route with: map.connect 'stores/near/:longitude/:latitude', :controller => 'stores', :action => 'index' This works for integer latitude and longitude values (http://localhost:3000/stores/near/-88/49) but fails for decimal values (http://localhost:3000/stores/near/-88.341/49.123) giving: Routing Error No route matches "/stores/near/-88/49.0" with {:method=>:get} Any ideas how to use pretty URLs in rails with decimals?

    Read the article

  • find the all the stored procedures and jobs in sql server 2000

    - by kumar
    Hi, In SQL SERVER 2005 This query works fine : Select * from sys.procedures where object_definition(object_id) like '%J%' SELECT * FROM MSDB.DBO.SYSJOBS WHERE NAME LIKE '%J%' but in sql server 2000 it is not working. Here i need to find the all the stored procedures and jobs which matches my string ? how to find in sql server 2000 ? regards, kumar

    Read the article

  • MS-ACCESS query to match first few characters in string comparision

    - by neobee
    What query is suitable to compare two tables specied below, however only part of string in location(table1) will matches with the Location(table2). Location(table1) Location(table2) india- north USxcs India-west Indiaasd India- east Indiaavvds India- south Africassdcasv US- north Africavasvdsa us-west UKsacvavsdv uk- east Indiacascsa uk- south UScssca Africa-middle Indiacsasca Africa-south Africaccc Africa-east UKcac only 1st two characters of location(table1) and 1st two characters of location(table2) should match. Please help only any four characters of location(table1)and any two characters of location(table2)should match.

    Read the article

  • php search function

    - by Luke
    I am attempting to create a search function for user profiles on my site. $search= $_POST['search']; $res=mysql_query("SELECT * FROM ".TBL_USERS." WHERE username LIKE '$search%'"); This is the code I use. This will only work if you search something that matches the start of the result. Is there any way I can return values that have what i type as part of the username regardingless of upper or lower cases? Thankyou

    Read the article

  • Regular expressions

    - by Infinity
    Hello guys! I need a regular expression for findin a pattern. This is the pattern: id|name|code|mobile I created a pattern for this if I want to search by id (if id = 1): .*1.*|.*|.*|.* But it matches every pattern that contains number 1. What's the problem with it?

    Read the article

  • Autocomplete server-side implementation

    - by toluju
    What is a fast and efficient way to implement the server-side component for an autocomplete feature in an html input box? I am writing a service to autocomplete user queries in our web interface's main search box, and the completions are displayed in an ajax-powered dropdown. The data we are running queries against is simply a large table of concepts our system knows about, which matches roughly with the set of wikipedia page titles. For this service obviously speed is of utmost importance, as responsiveness of the web page is important to the user experience. The current implementation simply loads all concepts into memory in a sorted set, and performs a simple log(n) lookup on a user keystroke. The tailset is then used to provide additional matches beyond the closest match. The problem with this solution is that it does not scale. It currently is running up against the VM heap space limit (I've set -Xmx2g, which is about the most we can push on our 32 bit machines), and this prevents us from expanding our concept table or adding more functionality. Switching to 64-bit VMs on machines with more memory isn't an immediate option. I've been hesitant to start working on a disk-based solution as I am concerned that disk seek time will kill performance. Are there possible solutions that will let me scale better, either entirely in memory or with some fast disk-backed implementations? Edits: @Gandalf: For our use case it is important the the autocompletion is comprehensive and isn't just extra help for the user. As for what we are completing, it is a list of concept-type pairs. For example, possible entries are [("Microsoft", "Software Company"), ("Jeff Atwood", "Programmer"), ("StackOverflow.com", "Website")]. We are using Lucene for the full search once a user selects an item from the autocomplete list, but I am not yet sure Lucene would work well for the autocomplete itself. @Glen: No databases are being used here. When I'm talking about a table I just mean the structured representation of my data. @Jason Day: My original implementation to this problem was to use a Trie, but the memory bloat with that was actually worse than the sorted set due to needing a large number of object references. I'll read on the ternary search trees to see if it could be of use.

    Read the article

  • Match Regex across newlines?

    - by Jörg Battermann
    I have a regex ( "(&lt;lof&lt;).*?(&gt;&gt;)" ) that works and matches perfectly on single line input. However, if the input contains newlines between the two () parts it does not match at all. What's the best way to ignore any newlines at all in that case?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • What color to use in owner-draw Windows List Control background?

    - by Mark Ransom
    I have an owner-drawn list control in my Windows program. I use CListCtrl::GetBkColor to get the background color, and for a selected item I use GetSysColor(COLOR_HIGHLIGHT). This matches what Windows uses for non owner drawn list controls, except for the case where the control doesn't have focus - then the background is replaced with gray. Does Windows use one of the GetSysColor constants for the selected but unfocused background? If so, which one?

    Read the article

  • How to compare arrays in Perl?

    - by devtech
    I have two arrays A & B. I want to do a compare among the elements of the two arrays. my @a = qw"abc def efg ghy klm ghn"; my @b = qw"def ghy jgk lom com klm"; If any element matches then set a flag. Is there any simple way to do this? Please advise.

    Read the article

  • Disadvantage of unlifted type products?

    - by peaker
    In Haskell, lifted type products mean that there's a semantic difference between (a,b,c) and (a, (b, c)). If all pattern matches of all products was always irrefutable, then there would be no difference, and (a, b, c) could be syntactic sugar for (a, (b, c)). Why did Haskell choose to lift type products?

    Read the article

< Previous Page | 37 38 39 40 41 42 43 44 45 46 47 48  | Next Page >