Search Results

Search found 16680 results on 668 pages for 'python datetime'.

Page 406/668 | < Previous Page | 402 403 404 405 406 407 408 409 410 411 412 413  | Next Page >

  • grabbing a substring while scraping with Python2.6

    - by Diego
    Hey can someone help with the following? I'm trying to scrape a site that has the following information.. I need to pull just the number after the </strong> tag.. [<li><strong>ISBN-13:</strong> 9780375853401</li>, <li><strong>Pub. Date: </strong> 05/11/2010</li>] [<li><strong>UPC:</strong> 490355000372</li>, <li><strong>Catalog No:</strong> 15024/25</li>, <li><strong>Label:</strong> CAMERATA</li>] here's a piece of the code I've been using to grab the above data using mechanize and BeautifulSoup. I'm stuck here as it won't let me use the find() function for a list br_results = mechanize.urlopen(br_results) html = br_results.read() soup = BeautifulSoup(html) local_links = soup.findAll("a", {"class" : "down-arrow csa"}) upc_code = soup.findAll("ul", {"class" : "bc-meta3"}) for upc in upc_code: upc_text = upc.contents.contents print upc_text

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • Scrape zipcode table for different urls based on county

    - by Dr.Venkman
    I used lxml and ran into a wall as my new computer wont install lxml and the code doesnt work. I know this is simple - maybe some one can help with a beautiful soup script. this is my code: import codecs import lxml as lh from selenium import webdriver import time import re results = [] city = [ 'amador'] state = [ 'CA'] for state in states: for city in citys: browser = webdriver.Firefox() link2 = 'http://www.getzips.com/cgi-bin/ziplook.exe?What=3&County='+ city +'&State=' + state + '&Submit=Look+It+Up' browser.get(link2) bcontent = browser.page_source zipcode = bcontent[bcontent.find('<td width="15%"'):bcontent.find('<p>')+0] if len(zipcode) > 0: print zipcode else: print 'none' browser.quit() Thanks for the help

    Read the article

  • Setting up relations/mappings for a SQLAlchemy many-to-many database

    - by Brent Ramerth
    I'm new to SQLAlchemy and relational databases, and I'm trying to set up a model for an annotated lexicon. I want to support an arbitrary number of key-value annotations for the words which can be added or removed at runtime. Since there will be a lot of repetition in the names of the keys, I don't want to use this solution directly, although the code is similar. My design has word objects and property objects. The words and properties are stored in separate tables with a property_values table that links the two. Here's the code: from sqlalchemy import Column, Integer, String, Table, create_engine from sqlalchemy import MetaData, ForeignKey from sqlalchemy.orm import relation, mapper, sessionmaker from sqlalchemy.ext.declarative import declarative_base engine = create_engine('sqlite:///test.db', echo=True) meta = MetaData(bind=engine) property_values = Table('property_values', meta, Column('word_id', Integer, ForeignKey('words.id')), Column('property_id', Integer, ForeignKey('properties.id')), Column('value', String(20)) ) words = Table('words', meta, Column('id', Integer, primary_key=True), Column('name', String(20)), Column('freq', Integer) ) properties = Table('properties', meta, Column('id', Integer, primary_key=True), Column('name', String(20), nullable=False, unique=True) ) meta.create_all() class Word(object): def __init__(self, name, freq=1): self.name = name self.freq = freq class Property(object): def __init__(self, name): self.name = name mapper(Property, properties) Now I'd like to be able to do the following: Session = sessionmaker(bind=engine) s = Session() word = Word('foo', 42) word['bar'] = 'yes' # or word.bar = 'yes' ? s.add(word) s.commit() Ideally this should add 1|foo|42 to the words table, add 1|bar to the properties table, and add 1|1|yes to the property_values table. However, I don't have the right mappings and relations in place to make this happen. I get the sense from reading the documentation at http://www.sqlalchemy.org/docs/05/mappers.html#association-pattern that I want to use an association proxy or something of that sort here, but the syntax is unclear to me. I experimented with this: mapper(Word, words, properties={ 'properties': relation(Property, secondary=property_values) }) but this mapper only fills in the foreign key values, and I need to fill in the other value as well. Any assistance would be greatly appreciated.

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • SUDS rendering a duplicate node and wrapping everything in it

    - by PylonsN00b
    Here is my code: #Make the SOAP connection url = "https://api.channeladvisor.com/ChannelAdvisorAPI/v1/InventoryService.asmx?WSDL" headers = {'Content-Type': 'text/xml; charset=utf-8'} ca_client_inventory = Client(url, location="https://api.channeladvisor.com/ChannelAdvisorAPI/v1/InventoryService.asmx", headers=headers) #Make the SOAP headers login = ca_client_inventory.factory.create('APICredentials') login.DeveloperKey = 'REMOVED' login.Password = 'REMOVED' #Attach the headers ca_client_inventory.set_options(soapheaders=login) synch_inventory_item_list = ca_client_inventory.factory.create('SynchInventoryItemList') synch_inventory_item_list.accountID = "REMOVED" array_of_inventory_item_submit = ca_client_inventory.factory.create('ArrayOfInventoryItemSubmit') for product in products: inventory_item_submit = ca_client_inventory.factory.create('InventoryItemSubmit') inventory_item_list = get_item_list(product) inventory_item_submit = [inventory_item_list] array_of_inventory_item_submit.InventoryItemSubmit.append(inventory_item_submit) synch_inventory_item_list.itemList = array_of_inventory_item_submit #Call that service baby! ca_client_inventory.service.SynchInventoryItemList(synch_inventory_item_list) Here is what it outputs: <?xml version="1.0" encoding="UTF-8"?> <SOAP-ENV:Envelope xmlns:ns0="http://api.channeladvisor.com/webservices/" xmlns:ns1="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:tns="http://api.channeladvisor.com/webservices/" xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/"> <SOAP-ENV:Header> <tns:APICredentials> <tns:DeveloperKey>REMOVED</tns:DeveloperKey> <tns:Password>REMOVED</tns:Password> </tns:APICredentials> </SOAP-ENV:Header> <ns1:Body> <ns0:SynchInventoryItemList> <ns0:accountID> <ns0:accountID>REMOVED</ns0:accountID> <ns0:itemList> <ns0:InventoryItemSubmit> <ns0:Sku>1872</ns0:Sku> <ns0:Title>The Big Book Of Crazy Quilt Stitches</ns0:Title> <ns0:Subtitle></ns0:Subtitle> <ns0:Description>Embellish the seams and patches of crazy quilt projects with over 75 embroidery stitches and floral motifs. You&apos;ll use this handy reference book again and again to dress up wall hangings, pillows, sachets, clothing, and other nostalgic creations.</ns0:Description> <ns0:Weight>4</ns0:Weight> <ns0:FlagStyle/> <ns0:IsBlocked xsi:nil="true"/> <ns0:ISBN></ns0:ISBN> <ns0:UPC>028906018721</ns0:UPC> <ns0:EAN></ns0:EAN> <ns0:QuantityInfo> <ns0:UpdateType>UnShipped</ns0:UpdateType> <ns0:Total>0</ns0:Total> </ns0:QuantityInfo> <ns0:PriceInfo> <ns0:Cost>0.575</ns0:Cost> <ns0:RetailPrice xsi:nil="true"/> <ns0:StartingPrice xsi:nil="true"/> <ns0:ReservePrice xsi:nil="true"/> <ns0:TakeItPrice>6.95</ns0:TakeItPrice> <ns0:SecondChanceOfferPrice xsi:nil="true"/> <ns0:StorePrice>6.95</ns0:StorePrice> </ns0:PriceInfo> <ns0:ClassificationInfo> <ns0:Name>Books</ns0:Name> <ns0:AttributeList> <ns0:ClassificationAttributeInfo> <ns0:Name>Designer/Author</ns0:Name> <ns0:Value>Patricia Eaton</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Trim Size</ns0:Name> <ns0:Value></ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Binding</ns0:Name> <ns0:Value>Leaflet</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Release Date</ns0:Name> <ns0:Value>11/1/1999 0:00:00</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Skill Level</ns0:Name> <ns0:Value></ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Pages</ns0:Name> <ns0:Value>20</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Projects</ns0:Name> <ns0:Value></ns0:Value> </ns0:ClassificationAttributeInfo> </ns0:AttributeList> </ns0:ClassificationInfo> <ns0:ImageList> <ns0:ImageInfoSubmit> <ns0:PlacementName>ITEMIMAGEURL1</ns0:PlacementName> <ns0:FilenameOrUrl>1872.jpg</ns0:FilenameOrUrl> </ns0:ImageInfoSubmit> </ns0:ImageList> </ns0:InventoryItemSubmit> </ns0:itemList> </ns0:accountID> </ns0:SynchInventoryItemList> </ns1:Body> </SOAP-ENV:Envelope> See how it creates the accountID node twice and wraps the whole thing in it? WHY? How do I make it stop that?!

    Read the article

  • How do i add a new object with suds?

    - by Jerome
    I'm trying to use suds but have so far been unsuccessful at figuring this out. Hopefully it's something simple that i'm missing. Any help would be highly appreciated. This is supposed to be the raw soap message that i need to achieve: <soapenv:Envelope xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:api="http://api.service.apimember.soapservice.com/"> <soapenv:Header/> <soapenv:Body> <api:insertOrUpdateMemberByObj> <token>t67GFCygjhkjyUy8y9hkjhlkjhuii</token> <member> <dynContent> <entry> <key>FIRSTNAME</key> <value>hhhhbbbbb</value> </entry> </dynContent> <email>[email protected]</email> </member> </api:insertOrUpdateMemberByObj> </soapenv:Body> </soapenv:Envelope> So i use suds to create the member object: member = client.factory.create('member') produces: (apiMember){ attributes = (attributes){ entry[] = <empty> } } How exactly do i append an 'entry'? I try this: member.attributes.entry.append({'key':'FIRSTNAME','value':'test'}) and that produces this: (apiMember){ attributes = (attributes){ entry[] = { value = "test" key = "FIRSTNAME" }, } } However, what i actually need is: (apiMember){ attributes = (attributes){ entry[] = (entry) { value = "test" key = "FIRSTNAME" }, } } How do i achieve this?

    Read the article

  • Error handling in the RequestHandler without embedding in URI

    - by hyn
    When a user sends a filled form, I want to print an error message in case there is an input error. One of the GAE sample codes does this by embedding the error message in the URI. Inside the form handler (get): self.redirect('/compose?error_message=%s' % message) and in the handler (get) of redirected URI, gets the message from request: values = { 'error_message': self.request.get('error_message'), ... Is there a way to accomplish the same without embedding the message in the URI?

    Read the article

  • Tkinter Packing Strangeness: Buttons packed above others

    - by Parand
    I'm sure I'm doing something obvious wrong here, but I can't see it. I end up with the "Should be on top" label packed at the bottom instead of at the top. What am I doing wrong? from Tkinter import * class SelectAction(Frame): buttons = {} def callback(self): print "Callback" def createWidgets(self): logo_label = Label(text="Should be on top").pack(fill=X) for name, text, callback in ( ('setup_account', 'Account Settings', self.callback), ('do_action', 'Do Something', self.callback), ): self.buttons[name] = Button(self, text=text, command=callback).pack(fill=X) def __init__(self, master=None): Frame.__init__(self, master) self.pack() self.createWidgets() if __name__ == "__main__": root = Tk() app = SelectAction(master=root) app.mainloop() root.destroy()

    Read the article

  • Programmatically sync the db in Django

    - by Attila Oláh
    I'm trying to sync my db from a view, something like this: from django import http from django.core import management def syncdb(request): management.call_command('syncdb') return http.HttpResponse('Database synced.') The issue is, it will block the dev server by asking for user input from the terminal. How can I pass it the '--noinput' option to prevent asking me anything? I have other ways of marking users as super-user, so there's no need for the user input, but I really need to call syncdb (and flush) programmatically, without logging on to the server via ssh. Any help is appreciated.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Performing non-blocking requests? - Django

    - by RadiantHex
    Hi folks, I have been playing with other frameworks, such as NodeJS, lately. I love the possibility to return a response, and still being able to do further operations. e.g. def view(request): do_something() return HttpResponse() do_more_stuff() #not possible!!! Maybe Django already offers a way to perform operations after returning a request, if that is the case that would be great. Help would be very much appreciated! =D

    Read the article

  • mod_wsgi daemon mode vs threaded fastcgi

    - by t0ster
    Can someone explain the difference between apache mod_wsgi in daemon mode and django fastcgi in threaded mode. They both use threads for concurrency I think. Supposing that I'm using nginx as front end to apache mod_wsgi. UPDATE: I'm comparing django built in fastcgi(./manage.py method=threaded maxchildren=15) and mod_wsgi in 'daemon' mode(WSGIDaemonProcess example threads=15). They both use threads and acquire GIL, am I right?

    Read the article

  • How to reload Django models without losing my locals in an interactive session?

    - by Gj
    I'm doing some research with an interactive shell and using a Django app (shell_plus) for storing data and browsing it using the convenient admin. Occasionally I add or change some of the app models, and run a syncdb (or South migration when changing a model). The changes to the models don't take effect in my interactive session even if I re-import the app models. Thus I'm forced to restart the shell_plus and lose my precious locals() in the process. Is there any way to reload the models during a session? Thanks!!

    Read the article

  • Accented characters in matplotlib

    - by OldJim
    Does anyone know a way to get matplotlib to render accented chars (é,ã,â,etc)? For instance i'm trying to use accented chars on set_yticklabels() and matplot renders squares instead, and when i use unicode() it renders the wrong chars. Is there a way to make this work? Thanks in advance, Jim.

    Read the article

  • how to speed up the code??

    - by kaushik
    i have very huge code about 600 lines plus. cant post the whole thing here. but a particular code snippet is taking so much time,leading to problems. here i post that part of code please tell me what to do speed up the processing.. please suggest the part which may be the reason and measure to improve them if this small part of code is understandable. using_data={} def join_cost(a , b): global using_data #print a #print b save_a=[] save_b=[] print 1 #for i in range(len(m)): #if str(m[i][0])==str(a): save_a=database_index[a] #for i in range(len(m)): # if str(m[i][0])==str(b): #print 'save_a',save_a #print 'save_b',save_b print 2 save_b=database_index[b] using_data[save_a[0]]=save_a s=str(save_a[1]).replace('phone','text') s=str(s)+'.pm' p=os.path.join("c:/begpython/wavnk/",s) x=open(p , 'r') print 3 for i in range(6): x.readline() k2='a' j=0 o=[] while k2 is not '': k2=x.readline() k2=k2.rstrip('\n') oj=k2.split(' ') o=o+[oj] #print o[j] j=j+1 #print j #print o[2][0] temp=long(1232332) end_time=save_a[4] #print end_time k=(j-1) for i in range(k): diff=float(o[i][0])-float(end_time) if diff<0: diff=diff*(-1) if temp>diff: temp=diff pm_row=i #print pm_row #print temp #print o[pm_row] #pm_row=3 q=[] print 4 l=str(p).replace('.pm','.mcep') z=open(l ,'r') for i in range(pm_row): z.readline() k3=z.readline() k3=k3.rstrip('\n') q=k3.split(' ') #print q print 5 s=str(save_b[1]).replace('phone','text') s=str(s)+'.pm' p=os.path.join("c:/begpython/wavnk/",s) x=open(p , 'r') for i in range(6): x.readline() k2='a' j=0 o=[] while k2 is not '': k2=x.readline() k2=k2.rstrip('\n') oj=k2.split(' ') o=o+[oj] #print o[j] j=j+1 #print j #print o[2][0] temp=long(1232332) strt_time=save_b[3] #print strt_time k=(j-1) for i in range(k): diff=float(o[i][0])-float(strt_time) if diff<0: diff=diff*(-1) if temp>diff: temp=diff pm_row=i #print pm_row #print temp #print o[pm_row] #pm_row=3 w=[] l=str(p).replace('.pm','.mcep') z=open(l ,'r') for i in range(pm_row): z.readline() k3=z.readline() k3=k3.rstrip('\n') w=k3.split(' ') #print w cost=0 for i in range(12): #print q[i] #print w[i] h=float(q[i])-float(w[i]) cost=cost+math.pow(h,2) j_cost=math.sqrt(cost) #print cost return j_cost def target_cost(a , b): a=(b+1)*3 b=(a+1)*2 t_cost=(a+b)*5/2 return t_cost r1='shht:ra_77' r2='grx_18' g=[] nodes=[] nodes=nodes+[[r1]] for i in range(len(y_in_db_format)): g=y_in_db_format[i] #print g #print g[0] g.remove(str(g[0])) nodes=nodes+[g] nodes=nodes+[[r2]] print nodes print "lenght of nodes",len(nodes) lists=[] #lists=lists+[r1] for i in range(len(nodes)): for j in range(len(nodes[i])): lists=lists+[nodes[i][j]] #lists=lists+[r2] print lists distance={} for i in range(len(lists)): if i==0: distance[str(lists[i])]=0 else: distance[str(lists[i])]=long(123231223) #print distance group_dist=[] infinity=long(123232323) for i in range(len(nodes)): distances=[] for j in range(len(nodes[i])): #distances=[] if i==0: distances=distances+[[nodes[i][j], 0]] else: distances=distances+[[nodes[i][j],infinity]] group_dist=group_dist+[distances] #print distances print "group_distances",group_dist #print "check",group_dist[0][0][1] #costs={} #for i in range(len(lists)): #if i==0: # costs[str(lists[i])]=1 #else: # costs[str(lists[i])]=get_selfcost(lists[i]) path=[] for i in range(len(nodes)): mini=[] if i!=(len(nodes)-1): #temp=long(123234324) #Now calculate the cost between the current node and each of its neighbour for k in range(len(nodes[(i+1)])): for j in range(len(nodes[i])): current=nodes[i][j] #print "current_node",current j_distance=join_cost( current , nodes[i+1][k]) #t_distance=target_cost( current , nodes[i+1][k]) t_distance=34 #print distance #print "distance between current and neighbours",distance total_distance=(.5*(float(group_dist[i][j][1])+float(j_distance))+.5*(float(t_distance))) #print "total distance between the intial_nodes and current neighbour",total_distance if int(group_dist[i+1][k][1]) > int(total_distance): group_dist[i+1][k][1]=total_distance #print "updated distance",group_dist[i+1][k][1] a=current #print "the neighbour",nodes[i+1][k],"updated the value",a mini=mini+[[str(nodes[i+1][k]),a]] print mini

    Read the article

  • how to speed up the code??

    - by kaushik
    in my program i have a method which requires about 4 files to be open each time it is called,as i require to take some data.all this data from the file i have been storing in list for manupalation. I approximatily need to call this method about 10,000 times.which is making my program very slow? any method for handling this files in a better ways and is storing the whole data in list time consuming what is better alternatives for list? I can give some code,but my previous question was closed as that only confused everyone as it is a part of big program and need to be explained completely to understand,so i am not giving any code,please suggest ways thinking this as a general question... thanks in advance

    Read the article

  • django on appengine

    - by aks
    I am impressed with django.Am am currenty a java developer.I want to make some cool websites for myself but i want to host it in some third pary environmet. Now the question is can i host the django application on appengine?If yes , how?? Are there any site built using django which are already hosted on appengine?

    Read the article

  • Sqlalchemy complex in_ clause

    - by lostlogic
    I'm trying to find a way to cause sqlalchemy to generate sql of the following form: select * from t where (a,b) in ((a1,b1),(a2,b2)); Is this possible? If not, any suggestions on a way to emulate it? Thanks kindly!

    Read the article

  • Deterministic key serialization

    - by Mike Boers
    I'm writing a mapping class which uses SQLite as the storage backend. I am currently allowing only basestring keys but it would be nice if I could use a couple more types hopefully up to anything that is hashable (ie. same requirements as the builtin dict). To that end I would like to derive a deterministic serialization scheme. Ideally, I would like to know if any implementation/protocol combination of pickle is deterministic for hashable objects (e.g. can only use cPickle with protocol 0). I noticed that pickle and cPickle do not match: >>> import pickle >>> import cPickle >>> def dumps(x): ... print repr(pickle.dumps(x)) ... print repr(cPickle.dumps(x)) ... >>> dumps(1) 'I1\n.' 'I1\n.' >>> dumps('hello') "S'hello'\np0\n." "S'hello'\np1\n." >>> dumps((1, 2, 'hello')) "(I1\nI2\nS'hello'\np0\ntp1\n." "(I1\nI2\nS'hello'\np1\ntp2\n." Another option is to use repr to dump and ast.literal_eval to load. This would only be valid for builtin hashable types. I have written a function to determine if a given key would survive this process (it is rather conservative on the types it allows): def is_reprable_key(key): return type(key) in (int, str, unicode) or (type(key) == tuple and all( is_reprable_key(x) for x in key)) The question for this method is if repr itself is deterministic for the types that I have allowed here. I believe this would not survive the 2/3 version barrier due to the change in str/unicode literals. This also would not work for integers where 2**32 - 1 < x < 2**64 jumping between 32 and 64 bit platforms. Are there any other conditions (ie. do strings serialize differently under different conditions)? (If this all fails miserably then I can store the hash of the key along with the pickle of both the key and value, then iterate across rows that have a matching hash looking for one that unpickles to the expected key, but that really does complicate a few other things and I would rather not do it.) Any insights?

    Read the article

< Previous Page | 402 403 404 405 406 407 408 409 410 411 412 413  | Next Page >