Search Results

Search found 16680 results on 668 pages for 'python datetime'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 402/668 | < Previous Page | 398 399 400 401 402 403 404 405 406 407 408 409  | Next Page >

  • Twisted - how to create multi protocol process and send the data between the protocols

    - by SpankMe
    Hey, Im trying to write a program that would be listening for data (simple text messages) on some port (say tcp 6666) and then pass them to one or more different protocols - irc, xmpp and so on. I've tried many approaches and digged the Internet, but I cant find easy and working solution for such task. The code I am currently fighting with is here: http://pastebin.com/ri7caXih I would like to know how to from object like: ircf = ircFactory('asdfasdf', '#asdf666') get access to self protocol methods, because this: self.protocol.dupa1(msg) returns error about self not being passed to active protocol object. Or maybe there is other, better, easier and more kosher way to create single reactor with multiple protocols and have actions triggeres when a message arrives on any of them, and then pass that message to other protocols for handling/processing/sending? Any help will be highly appreciated!

    Read the article

  • How to add a context processor from a Django app

    - by Edan Maor
    Say I'm writing a Django app, and all the templates in the app require a certain variable. The "classic" way to deal with this, afaik, is to write a context processor and add it to TEMPLATE_CONTEXT_PROCESSORS in the settings.py. My question is, is this the right way to do it, considering that apps are supposed to be "independent" from the actual project using them? In other words, when deploying that app to a new project, is there any way to avoid the project having to explicitly mess around with its settings?

    Read the article

  • Simple pygtk and threads example please.

    - by wtzolt
    Hello, Can someone give me a simple example involving threads in this manner, please. Problem with my code is that when I click button One, GUI freezes until its finished. I want buttons to stay responsive when def is being executed. How can i fix that? class fun: wTree = None def __init__( self ): self.wTree = gtk.glade.XML( "ui.glade" ) dic = { "on_buttonOne" : self.one, "on_buttonTwo" : self.two, } self.wTree.signal_autoconnect( dic ) gtk.main() def sone(self, widget): time.sleep(1) print "1" time.sleep(1) print "2" time.sleep(1) print "3" def stwo(self, widget): time.sleep(1) print "4" time.sleep(1) print "5" time.sleep(1) print "6" do=fun() Pretty please, help me.

    Read the article

  • Splitting a person's name into forename and surname

    - by Nick
    ok so basically I am asking the question of their name I want this to be one input rather than Forename and Surname. Now is there any way of splitting this name? and taking just the last word from the "Sentence" e.g. name = "Thomas Winter" print name.split() and what would be output is just "Winter"

    Read the article

  • Is using os.path.abspath to validate an untrusted filename's location secure?

    - by mcmt
    I don't think I'm missing anything. Then again I'm kind of a newbie. def GET(self, filename): name = urllib.unquote(filename) full = path.abspath(path.join(STATIC_PATH, filename)) #Make sure request is not tricksy and tries to get out of #the directory, e.g. filename = "../.ssh/id_rsa". GET OUTTA HERE assert full[:len(STATIC_PATH)] == STATIC_PATH, "bad path" return open(full).read() Edit: I realize this will return the wrong HTTP error code if the file doesn't exist (at least under web.py). I will fix this.

    Read the article

  • redefine __and__ operator

    - by wiso
    Why I can't redefine the __and__ operator? class Cut(object): def __init__(self, cut): self.cut = cut def __and__(self, other): return Cut("(" + self.cut + ") && (" + other.cut + ")") a = Cut("a>0") b = cut("b>0") c = a and b print c.cut() I want (a>0) && (b>0), but I got b, that the usual behaviour of and

    Read the article

  • How to get bit rotation function to accept any bit size?

    - by calccrypto
    i have these 2 functions i got from some other code def ROR(x, n): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (32 - n)) def ROL(x, n): return ROR(x, 32 - n) and i wanted to use them in a program, where 16 bit rotations are required. however, there are also other functions that require 32 bit rotations, so i wanted to leave the 32 in the equation, so i got: def ROR(x, n, bits = 32): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (bits - n)) def ROL(x, n, bits = 32): return ROR(x, bits - n) however, the answers came out wrong when i tested this set out. yet, the values came out correctly when the code is def ROR(x, n): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (16 - n)) def ROL(x, n,bits): return ROR(x, 16 - n) what is going on and how do i fix this?

    Read the article

  • Numpy modify array in place?

    - by User
    I have the following code which is attempting to normalize the values of an m x n array (It will be used as input to a neural network, where m is the number of training examples and n is the number of features). However, when I inspect the array in the interpreter after the script runs, I see that the values are not normalized; that is, they still have the original values. I guess this is because the assignment to the array variable inside the function is only seen within the function. How can I do this normalization in place? Or do I have to return a new array from the normalize function? import numpy def normalize(array, imin = -1, imax = 1): """I = Imin + (Imax-Imin)*(D-Dmin)/(Dmax-Dmin)""" dmin = array.min() dmax = array.max() array = imin + (imax - imin)*(array - dmin)/(dmax - dmin) print array[0] def main(): array = numpy.loadtxt('test.csv', delimiter=',', skiprows=1) for column in array.T: normalize(column) return array if __name__ == "__main__": a = main()

    Read the article

  • Multiprocessing Bomb

    - by iKarampa
    I was working the following example from Doug Hellmann tutorial on multiprocessing: import multiprocessing def worker(): """worker function""" print 'Worker' return if __name__ == '__main__': jobs = [] for i in range(5): p = multiprocessing.Process(target=worker) jobs.append(p) p.start() When I tried to run it outside the if statement: import multiprocessing def worker(): """worker function""" print 'Worker' jobs = [] for i in range(5): p = multiprocessing.Process(target=worker) jobs.append(p) p.start() It started spawning processes non-stop, without any way of to terminating it. Why would that happen? Why it did not generate 5 processes and exit? Why do I need the if statement?

    Read the article

  • How to classify NN/NNP/NNS obtained from POS tagged document as a product feature

    - by Shweta .......
    I'm planning to perform sentiment analysis on reviews of product features (collected from Amazon dataset). I have extracted review text from the dataset and performed POS tagging on that. I'm able to extract NN/NNP as well. But my doubt is how do I come to know that extracted words classify as features of the products? I know there are classifiers in nltk but I don't know how I should use it for my project. I'm assuming there are 2 ways of finding whether the extracted word is a product feature or not. One is to compare with a bag of words and find out if my word exists in that. Doubt: How do I create/get bag of words? Second way is to implement some kind of apriori algorithm to find out frequently occurring words as features. I would like to know which method is good and how to go about implementing it. Some pointers to available softwares or code snippets would be helpful! Thanks!

    Read the article

  • Why wont numpy matrix let me print its rows?

    - by uberjumper
    Okay this is probably a really dumb question, however its really starting to hurt. I have a numpy matrix, and basically i print it out row by row. However i want to make each row be formatted and separated properly. >>> arr = numpy.matrix([[x for x in range(5)] for y in range(5)]) >>> arr matrix([[0, 1, 2, 3, 4], [0, 1, 2, 3, 4], [0, 1, 2, 3, 4], [0, 1, 2, 3, 4], [0, 1, 2, 3, 4]]) Lets say i want to print the first row, and add a '|' between each element: >>> '|'.join(map(str, arr[0,])) '[[0 1 2 3 4]]' Err... >>> '|'.join(map(lambda x: str(x[0]), arr[0])) '[[0 1 2 3 4]]' I am really confused by this behavior why does it do this?

    Read the article

  • Dynamically add items to Tkinter Canvas

    - by nick369
    I'm attempting to learn Tkinter with the goal of being able to create a 'real-time' scope to plot data. As a test, I'm trying to draw a polygon on the canvas every time the 'draw' button is pressed. The triangle position is randomized. I have two problems: There is a triangle on the canvas as soon as the program starts, why and how do I fix this? It doesn't draw any triangles when I press the button, at least none that I can see. CODE from Tkinter import * from random import randint class App: def __init__(self,master): #frame = Frame(master) #frame.pack(side = LEFT) self.plotspc = Canvas(master,height = 100, width = 200, bg = "white") self.plotspc.grid(row=0,column = 2, rowspan = 5) self.button = Button(master, text = "Quit", fg = "red", \ command = master.quit) self.button.grid(row=0,column=0) self.drawbutton = Button(master, text = "Draw", command = \ self.pt([50,50])) self.drawbutton.grid(row = 0, column = 1) def pt(self, coords): coords[0] = coords[0] + randint(-20,20) coords[1] = coords[1] + randint(-20,20) x = (0,5,10) y = (0,10,0) xp = [coords[0] + xv for xv in x] yp = [coords[1] + yv for yv in y] ptf = zip(xp,yp) self.plotspc.create_polygon(*ptf) if _name_ == "_main_": root = Tk() app = App(root) root.mainloop() The code is formatting strangely within the code tags, I have no idea how to fix this.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • How to set the size of a wx.aui.AuiManager Pane that is centered?

    - by aF
    Hello, I have three panes with the InfoPane center option. I want to know how to set their size. Using this code: import wx import wx.aui class MyFrame(wx.Frame): def __init__(self, parent, id=-1, title='wx.aui Test', pos=wx.DefaultPosition, size=(800, 600), style=wx.DEFAULT_FRAME_STYLE): wx.Frame.__init__(self, parent, id, title, pos, size, style) self._mgr = wx.aui.AuiManager(self) # create several text controls text1 = wx.TextCtrl(self, -1, 'Pane 1 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text2 = wx.TextCtrl(self, -1, 'Pane 2 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text3 = wx.TextCtrl(self, -1, 'Main content window', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) # add the panes to the manager self._mgr.AddPane(text1, wx.CENTER) self._mgr.AddPane(text2, wx.CENTER) self._mgr.AddPane(text3, wx.CENTER) # tell the manager to 'commit' all the changes just made self._mgr.Update() self.Bind(wx.EVT_CLOSE, self.OnClose) def OnClose(self, event): # deinitialize the frame manager self._mgr.UnInit() # delete the frame self.Destroy() app = wx.App() frame = MyFrame(None) frame.Show() app.MainLoop() I want to know what is called when we change the size of the panes. If you tell me that, I can do the rest by myself :)

    Read the article

  • How can I draw a log-normalized imshow plot with a colorbar representing the raw data in matplotlib

    - by Adam Fraser
    I'm using matplotlib to plot log-normalized images but I would like the original raw image data to be represented in the colorbar rather than the [0-1] interval. I get the feeling there's a more matplotlib'y way of doing this by using some sort of normalization object and not transforming the data beforehand... in any case, there could be negative values in the raw image. import matplotlib.pyplot as plt import numpy as np def log_transform(im): '''returns log(image) scaled to the interval [0,1]''' try: (min, max) = (im[im > 0].min(), im.max()) if (max > min) and (max > 0): return (np.log(im.clip(min, max)) - np.log(min)) / (np.log(max) - np.log(min)) except: pass return im a = np.ones((100,100)) for i in range(100): a[i] = i f = plt.figure() ax = f.add_subplot(111) res = ax.imshow(log_transform(a)) # the colorbar drawn shows [0-1], but I want to see [0-99] cb = f.colorbar(res) I've tried using cb.set_array, but that didn't appear to do anything, and cb.set_clim, but that rescales the colors completely. Thanks in advance for any help :)

    Read the article

  • etree.findall: 'OR'-lookup?

    - by piquadrat
    I want to find all stylesheet definitions in a XHTML file with lxml.etree.findall. This could be as simple as elems = tree.findall('link[@rel="stylesheet"]') + tree.findall('style') But the problem with CSS style definitions is that the order matters, e.g. <link rel="stylesheet" type="text/css" href="/media/css/first.css" /> <style>body:{font-size: 10px;}</style> <link rel="stylesheet" type="text/css" href="/media/css/second.css" /> if the contents of the style tag is applied after the rules in the two link tags, the result may be completely different from the one where the rules are applied in order of definition. So, how would I do a lookup that inlcudes both link[@rel="stylesheet"] and style?

    Read the article

  • A graph-based tuple merge?

    - by user1644030
    I have paired values in tuples that are related matches (and technically still in CSV files). Neither of the paired values are necessarily unique. tupleAB = (A####, B###), (A###, B###), (A###, B###)... tupleBC = (B####, C###), (B###, C###), (B###, C###)... tupleAC = (A####, C###), (A###, C###), (A###, C###)... My ideal output would be a dictionary with a unique ID and a list of "reinforced" matches. The way I try to think about it is in a graph-based context. For example, if: tupleAB[x] = (A0001, B0012) tupleBC[y] = (B0012, C0230) tupleAC[z] = (A0001, C0230) This would produce: output = {uniquekey0001, [A0001, B0012, C0230]} Ideally, this would also be able to scale up to more than three tuples (for example, adding a "D" match that would result in an additional three tuples - AD, BD, and CD - and lists of four items long; and so forth). In regards to scaling up to more tuples, I am open to having "graphs" that aren't necessarily fully connected, i.e., every node connected to every other node. My hunch is that I could easily filter based on the list lengths. I am open to any suggestions. I think, with a few cups of coffee, I could work out a brute force solution, but I thought I'd ask the community if anyone was aware of a more elegant solution. Thanks for any feedback.

    Read the article

  • Dynamically setting the queryset of a ModelMultipleChoiceField to a custom recordset

    - by Daniel Quinn
    I've seen all the howtos about how you can set a ModelMultipleChoiceField to use a custom queryset and I've tried them and they work. However, they all use the same paradigm: the queryset is just a filtered list of the same objects. In my case, I'm trying to get the admin to draw a multiselect form that instead of using usernames as the text portion of the , I'd like to use the name field from my account class. Here's a breakdown of what I've got: # models.py class Account(models.Model): name = models.CharField(max_length=128,help_text="A display name that people understand") user = models.ForeignKey(User, unique=True) # Tied to the User class in settings.py class Organisation(models.Model): administrators = models.ManyToManyField(User) # admin.py from django.forms import ModelMultipleChoiceField from django.contrib.auth.models import User class OrganisationAdminForm(forms.ModelForm): def __init__(self, *args, **kwargs): from ethico.accounts.models import Account self.base_fields["administrators"] = ModelMultipleChoiceField( queryset=User.objects.all(), required=False ) super(OrganisationAdminForm, self).__init__(*args, **kwargs) class Meta: model = Organisation This works, however, I want queryset above to draw a selectbox with the Account.name property and the User.id property. This didn't work: queryset=Account.objects.all().order_by("name").values_list("user","name") It failed with this error: 'tuple' object has no attribute 'pk' I figured that this would be easy, but it's turned into hours of dead-ends. Anyone care to shed some light?

    Read the article

  • twisted reactor stops too early

    - by pygabriel
    I'm doing a batch script to connect to a tcp server and then exiting. My problem is that I can't stop the reactor, for example: cmd = raw_input("Command: ") # custom factory, the protocol just send a line reactor.connectTCP(HOST,PORT, CommandClientFactory(cmd) d = defer.Deferred() d.addCallback(lambda x: reactor.stop()) reactor.callWhenRunning(d.callback,None) reactor.run() In this code the reactor stops before that the tcp connection is done and the cmd is passed. How can I stop the reactor after that all the operation are finished?

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • SQLAlchemy - SQLite for testing and Postgresql for devlopment - How to port?

    - by StackUnderflow
    I want to use sqlite memory database for all my testing and Postgresql for my development/production server. But the SQL syntax is not same in both dbs. for ex: SQLite has autoincrement, and Postgresql has serial Is it easy to port the SQL script from sqlite to postgresql... what are your solutions? If you want me to use standard SQL, how should I go about generating primary key in both the databases?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 398 399 400 401 402 403 404 405 406 407 408 409  | Next Page >