Search Results

Search found 16680 results on 668 pages for 'python datetime'.

Page 404/668 | < Previous Page | 400 401 402 403 404 405 406 407 408 409 410 411  | Next Page >

  • twisted reactor stops too early

    - by pygabriel
    I'm doing a batch script to connect to a tcp server and then exiting. My problem is that I can't stop the reactor, for example: cmd = raw_input("Command: ") # custom factory, the protocol just send a line reactor.connectTCP(HOST,PORT, CommandClientFactory(cmd) d = defer.Deferred() d.addCallback(lambda x: reactor.stop()) reactor.callWhenRunning(d.callback,None) reactor.run() In this code the reactor stops before that the tcp connection is done and the cmd is passed. How can I stop the reactor after that all the operation are finished?

    Read the article

  • How small is *too small* for an opensource project?

    - by Adam Lewis
    I have a fair number of smaller projects / libraries that I have been using over the past 2 years. I am thinking about moving them to Google Code to make it easier to share with co-workers and easier to import them into new projects on my own environments. The are things like a simple FSMs, CAN (Controller Area Network) drivers, and GPIB drivers. Most of them are small (less than 500 lines), so it makes me wonder are these types of things too small for a stand alone open-source project? Note that I would like to make it opensource because it does not give me, or my company, any real advantage.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Django: Applying Calculations To A Query Set

    - by TheLizardKing
    I have a QuerySet that I wish to pass to a generic view for pagination: links = Link.objects.annotate(votes=Count('vote')).order_by('-created')[:300] This is my "hot" page which lists my 300 latest submissions (10 pages of 30 links each). I want to now sort this QuerySet by an algorithm that HackerNews uses: (p - 1) / (t + 2)^1.5 p = votes minus submitter's initial vote t = age of submission in hours Now because applying this algorithm over the entire database would be pretty costly I am content with just the last 300 submissions. My site is unlikely to be the next digg/reddit so while scalability is a plus it is required. My question is now how do I iterate over my QuerySet and sort it by the above algorithm? For more information, here are my applicable models: class Link(models.Model): category = models.ForeignKey(Category, blank=False, default=1) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) modified = models.DateTimeField(auto_now=True) url = models.URLField(max_length=1024, unique=True, verify_exists=True) name = models.CharField(max_length=512) def __unicode__(self): return u'%s (%s)' % (self.name, self.url) class Vote(models.Model): link = models.ForeignKey(Link) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) def __unicode__(self): return u'%s vote for %s' % (self.user, self.link) Notes: I don't have "downvotes" so just the presence of a Vote row is an indicator of a vote or a particular link by a particular user.

    Read the article

  • How to make scipy.interpolate give a an extrapolated result beyond the input range?

    - by Salim Fadhley
    I'm trying to port a program which uses a hand-rolled interpolator (developed by a mathematitian colleage) over to use the interpolators provided by scipy. I'd like to use or wrap the scipy interpolator so that it has as close as possible behavior to the old interpolator. A key difference between the two functions is that in our original interpolator - if the input value is above or below the input range, our original interpolator will extrapolate the result. If you try this with the scipy interpolator it raises a ValueError. Consider this program as an example: import numpy as np from scipy import interpolate x = np.arange(0,10) y = np.exp(-x/3.0) f = interpolate.interp1d(x, y) print f(9) print f(11) # Causes ValueError, because it's greater than max(x) Is there a sensible way to make it so that instead of crashing, the final line will simply do a linear extrapolate, continuing the gradients defined by the first and last two pouints to infinity. Note, that in the real software I'm not actually using the exp function - that's here for illustration only!

    Read the article

  • In Django, why is user.is_authenticated a method and not a member variable like is_staff

    - by luc
    Hello all, I've lost some time with a bug in my app due to user authentication. I think that it's a bit confusing but maybe someone can explain the reason and it will appear to me very logical. The user.is_staff is a member variable while user.is_authenticated is a method. However is_authenticated only returns True or False depending if the class is User or AnonymousUser (see http://docs.djangoproject.com/en/dev/topics/auth/) Is there a reason for that? Why user.is_authenticated is a method? Thanks in advance

    Read the article

  • List Directories and get the name of the Directory

    - by chrissygormley
    Hello, I am trying to get the code to list all the directories in a folder, change directory into that folder and get the name of the current folder. The code I have so far is below and isn't working at the minute. I seem to be getting the parent folder name. import os for directories in os.listdir(os.getcwd()): dir = os.path.join('/home/user/workspace', directories) os.chdir(dir) current = os.path.dirname(dir) new = str(current).split("-")[0] print new I also have other files in the folder but I do not want to list them. I have tried the below code but I haven't got it working yet either. for directories in os.path.isdir(os.listdir(os.getcwd())): Can anyone see where I am going wrong? Thanks

    Read the article

  • etree.findall: 'OR'-lookup?

    - by piquadrat
    I want to find all stylesheet definitions in a XHTML file with lxml.etree.findall. This could be as simple as elems = tree.findall('link[@rel="stylesheet"]') + tree.findall('style') But the problem with CSS style definitions is that the order matters, e.g. <link rel="stylesheet" type="text/css" href="/media/css/first.css" /> <style>body:{font-size: 10px;}</style> <link rel="stylesheet" type="text/css" href="/media/css/second.css" /> if the contents of the style tag is applied after the rules in the two link tags, the result may be completely different from the one where the rules are applied in order of definition. So, how would I do a lookup that inlcudes both link[@rel="stylesheet"] and style?

    Read the article

  • PyParsing: Not all tokens passed to setParseAction()

    - by Rosarch
    I'm parsing sentences like "CS 2110 or INFO 3300". I would like to output a format like: [[("CS" 2110)], [("INFO", 3300)]] To do this, I thought I could use setParseAction(). However, the print statements in statementParse() suggest that only the last tokens are actually passed: >>> statement.parseString("CS 2110 or INFO 3300") Match [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] at loc 7(1,8) string CS 2110 or INFO 3300 loc: 7 tokens: ['INFO', 3300] Matched [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] -> ['INFO', 3300] (['CS', 2110, 'INFO', 3300], {'Course': [(2110, 1), (3300, 3)], 'DeptCode': [('CS', 0), ('INFO', 2)]}) I expected all the tokens to be passed, but it's only ['INFO', 3300]. Am I doing something wrong? Or is there another way that I can produce the desired output? Here is the pyparsing code: from pyparsing import * def statementParse(str, location, tokens): print "string %s" % str print "loc: %s " % location print "tokens: %s" % tokens DEPT_CODE = Regex(r'[A-Z]{2,}').setResultsName("DeptCode") COURSE_NUMBER = Regex(r'[0-9]{4}').setResultsName("CourseNumber") OR_CONJ = Suppress("or") COURSE_NUMBER.setParseAction(lambda s, l, toks : int(toks[0])) course = DEPT_CODE + COURSE_NUMBER.setResultsName("Course") statement = course + Optional(OR_CONJ + course).setParseAction(statementParse).setDebug()

    Read the article

  • Attribute Error in django

    - by itsandy
    Hi all, I am having an attribute error while working with django-registration it says 'NoneType' object has no attribute 'strip' I dropped my db table and created again but the error doesnt go..can anyone help..

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Auto filling polymorphic table on save or on delete in django

    - by Mo J. Mughrabi
    Hi, Am working on an project in which I made an app "core" it will contain some of the reused models across my projects, most of those are polymorphic models (Generic content types) and will be linked to different models. Example below am trying to create audit model and will be linked to several models which may require auditing. This is the polls/models.py from django.db import models from django.contrib.auth.models import User from core.models import * from django.contrib.contenttypes import generic class Poll(models.Model): ## TODO: Document question = models.CharField(max_length=300) question_slug=models.SlugField(editable=False) start_poll_at = models.DateTimeField(null=True) end_poll_at = models.DateTimeField(null=True) is_active = models.BooleanField(default=True) audit_obj=generic.GenericRelation(Audit) def __unicode__(self): return self.question class Choice(models.Model): ## TODO: Document choice = models.CharField(max_length=200) poll=models.ForeignKey(Poll) audit_obj=generic.GenericRelation(Audit) class Vote(models.Model): ## TODO: Document choice=models.ForeignKey(Choice) Ip_Address=models.IPAddressField(editable=False) vote_at=models.DateTimeField("Vote at", editable=False) here is the core/modes.py from django.db import models from django.contrib.auth.models import User from django.contrib.contenttypes.models import ContentType from django.contrib.contenttypes import generic class Audit(models.Model): ## TODO: Document # Polymorphic model using generic relation through DJANGO content type created_at = models.DateTimeField("Created at", auto_now_add=True) created_by = models.ForeignKey(User, db_column="created_by", related_name="%(app_label)s_%(class)s_y+") updated_at = models.DateTimeField("Updated at", auto_now=True) updated_by = models.ForeignKey(User, db_column="updated_by", null=True, blank=True, related_name="%(app_label)s_%(class)s_y+") content_type = models.ForeignKey(ContentType) object_id = models.PositiveIntegerField(unique=True) content_object = generic.GenericForeignKey('content_type', 'object_id') and here is polls/admin.py from django.core.context_processors import request from polls.models import Poll, Choice from core.models import * from django.contrib import admin class ChoiceInline(admin.StackedInline): model = Choice extra = 3 class PollAdmin(admin.ModelAdmin): inlines = [ChoiceInline] admin.site.register(Poll, PollAdmin) Am quite new to django, what am trying to do here, insert a record in audit when a record is inserted in polls and then update that same record when a record is updated in polls.

    Read the article

  • Web2py controllers with parameters?

    - by nickfranceschina
    I am building an app using Web2py framework... I don't want to have to use the request object to get all of the querystring parameters, instead I'd like to build my controller with named parameters and have the router unpack the querystring (or form data) dictionary into the named parameters and call my controller. so instead of a controller method of create_user(): where I would use the global request() object and look through the vars list... I would prefer instead to have create_user(first_name, last_name, email): like I see in other MVC platforms. is this possible in Web2py already? or is there a plugin for it? or do I need to add that myself?

    Read the article

  • How to build a Django form which requires a delay to be re-submitted ?

    - by pierre-guillaume-degans
    Hey, In order to avoid spamming, I would like to add a waiting time to re-submit a form (i.e. the user should wait a few seconds to submit the form, except the first time that this form is submitted). To do that, I added a timestamp to my form (and a security_hash field containing the timestamp plus the settings.SECRET_KEY which ensures that the timestamp is not fiddled with). This look like: class MyForm(forms.Form): timestamp = forms.IntegerField(widget=forms.HiddenInput) security_hash = forms.CharField(min_length=40, max_length=40, widget=forms.HiddenInput) # + some other fields.. # + methods to build the hash and to clean the timestamp... # (it is based on django.contrib.comments.forms.CommentSecurityForm) def clean_timestamp(self): """Make sure the delay is over (5 seconds).""" ts = self.cleaned_data["timestamp"] if not time.time() - ts > 5: raise forms.ValidationError("Timestamp check failed") return ts # etc... This works fine. However there is still an issue: the timestamp is checked the first time the form is submitted by the user, and I need to avoid this. Any idea to fix it ? Thank you ! :-)

    Read the article

  • basic unique ModelForm field for Google App Engine

    - by Alexander Vasiljev
    I do not care about concurrency issues. It is relatively easy to build unique form field: from django import forms class UniqueUserEmailField(forms.CharField): def clean(self, value): self.check_uniqueness(super(UniqueUserEmailField, self).clean(value)) def check_uniqueness(self, value): same_user = users.User.all().filter('email', value).get() if same_user: raise forms.ValidationError('%s already_registered' % value) so one could add users on-the-fly. Editing existing user is tricky. This field would not allow to save user having other user email. At the same time it would not allow to save a user with the same email. What code do you use to put a field with uniqueness check into ModelForm?

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • Fabric methods exceptions

    - by baobee
    I try to make Fabric func, which checks if Apache installed: from fabric.api import * def check_apache(): try: result = local('httpd -v', capture=True) except: print "check_apache exception" But if httpd not installed I get: [root@server-local ~]$ fab check_apache Fatal error: local() encountered an error (return code 127) while executing 'ahttpd -v' Aborting. check_apache exception Done. How can I get correct exception for Fabric local() method ? So I need to get exception and continue executing without any Fabric error messages: [root@server-local ~]$ fab check_apache check_apache exception Done.

    Read the article

< Previous Page | 400 401 402 403 404 405 406 407 408 409 410 411  | Next Page >