Search Results

Search found 18238 results on 730 pages for 'python gui'.

Page 424/730 | < Previous Page | 420 421 422 423 424 425 426 427 428 429 430 431  | Next Page >

  • How to get bit rotation function to accept any bit size?

    - by calccrypto
    i have these 2 functions i got from some other code def ROR(x, n): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (32 - n)) def ROL(x, n): return ROR(x, 32 - n) and i wanted to use them in a program, where 16 bit rotations are required. however, there are also other functions that require 32 bit rotations, so i wanted to leave the 32 in the equation, so i got: def ROR(x, n, bits = 32): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (bits - n)) def ROL(x, n, bits = 32): return ROR(x, bits - n) however, the answers came out wrong when i tested this set out. yet, the values came out correctly when the code is def ROR(x, n): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (16 - n)) def ROL(x, n,bits): return ROR(x, 16 - n) what is going on and how do i fix this?

    Read the article

  • Trouble with encoding and urllib

    - by Ockonal
    Hello, I'm loading web-page using urllib. Ther eis russian symbols, but page encoding is 'utf-8' 1 pageData = unicode(requestHandler.read()).decode('utf-8') UnicodeDecodeError: 'ascii' codec can't decode byte 0xd0 in position 262: ordinal not in range(128) 2 pageData = requestHandler.read() soupHandler = BeautifulSoup(pageData) print soupHandler.findAll(...) UnicodeEncodeError: 'ascii' codec can't encode characters in position 340-345: ordinal not in range(128)

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Dynamically setting the queryset of a ModelMultipleChoiceField to a custom recordset

    - by Daniel Quinn
    I've seen all the howtos about how you can set a ModelMultipleChoiceField to use a custom queryset and I've tried them and they work. However, they all use the same paradigm: the queryset is just a filtered list of the same objects. In my case, I'm trying to get the admin to draw a multiselect form that instead of using usernames as the text portion of the , I'd like to use the name field from my account class. Here's a breakdown of what I've got: # models.py class Account(models.Model): name = models.CharField(max_length=128,help_text="A display name that people understand") user = models.ForeignKey(User, unique=True) # Tied to the User class in settings.py class Organisation(models.Model): administrators = models.ManyToManyField(User) # admin.py from django.forms import ModelMultipleChoiceField from django.contrib.auth.models import User class OrganisationAdminForm(forms.ModelForm): def __init__(self, *args, **kwargs): from ethico.accounts.models import Account self.base_fields["administrators"] = ModelMultipleChoiceField( queryset=User.objects.all(), required=False ) super(OrganisationAdminForm, self).__init__(*args, **kwargs) class Meta: model = Organisation This works, however, I want queryset above to draw a selectbox with the Account.name property and the User.id property. This didn't work: queryset=Account.objects.all().order_by("name").values_list("user","name") It failed with this error: 'tuple' object has no attribute 'pk' I figured that this would be easy, but it's turned into hours of dead-ends. Anyone care to shed some light?

    Read the article

  • A graph-based tuple merge?

    - by user1644030
    I have paired values in tuples that are related matches (and technically still in CSV files). Neither of the paired values are necessarily unique. tupleAB = (A####, B###), (A###, B###), (A###, B###)... tupleBC = (B####, C###), (B###, C###), (B###, C###)... tupleAC = (A####, C###), (A###, C###), (A###, C###)... My ideal output would be a dictionary with a unique ID and a list of "reinforced" matches. The way I try to think about it is in a graph-based context. For example, if: tupleAB[x] = (A0001, B0012) tupleBC[y] = (B0012, C0230) tupleAC[z] = (A0001, C0230) This would produce: output = {uniquekey0001, [A0001, B0012, C0230]} Ideally, this would also be able to scale up to more than three tuples (for example, adding a "D" match that would result in an additional three tuples - AD, BD, and CD - and lists of four items long; and so forth). In regards to scaling up to more tuples, I am open to having "graphs" that aren't necessarily fully connected, i.e., every node connected to every other node. My hunch is that I could easily filter based on the list lengths. I am open to any suggestions. I think, with a few cups of coffee, I could work out a brute force solution, but I thought I'd ask the community if anyone was aware of a more elegant solution. Thanks for any feedback.

    Read the article

  • How can I draw a log-normalized imshow plot with a colorbar representing the raw data in matplotlib

    - by Adam Fraser
    I'm using matplotlib to plot log-normalized images but I would like the original raw image data to be represented in the colorbar rather than the [0-1] interval. I get the feeling there's a more matplotlib'y way of doing this by using some sort of normalization object and not transforming the data beforehand... in any case, there could be negative values in the raw image. import matplotlib.pyplot as plt import numpy as np def log_transform(im): '''returns log(image) scaled to the interval [0,1]''' try: (min, max) = (im[im > 0].min(), im.max()) if (max > min) and (max > 0): return (np.log(im.clip(min, max)) - np.log(min)) / (np.log(max) - np.log(min)) except: pass return im a = np.ones((100,100)) for i in range(100): a[i] = i f = plt.figure() ax = f.add_subplot(111) res = ax.imshow(log_transform(a)) # the colorbar drawn shows [0-1], but I want to see [0-99] cb = f.colorbar(res) I've tried using cb.set_array, but that didn't appear to do anything, and cb.set_clim, but that rescales the colors completely. Thanks in advance for any help :)

    Read the article

  • How to set the size of a wx.aui.AuiManager Pane that is centered?

    - by aF
    Hello, I have three panes with the InfoPane center option. I want to know how to set their size. Using this code: import wx import wx.aui class MyFrame(wx.Frame): def __init__(self, parent, id=-1, title='wx.aui Test', pos=wx.DefaultPosition, size=(800, 600), style=wx.DEFAULT_FRAME_STYLE): wx.Frame.__init__(self, parent, id, title, pos, size, style) self._mgr = wx.aui.AuiManager(self) # create several text controls text1 = wx.TextCtrl(self, -1, 'Pane 1 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text2 = wx.TextCtrl(self, -1, 'Pane 2 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text3 = wx.TextCtrl(self, -1, 'Main content window', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) # add the panes to the manager self._mgr.AddPane(text1, wx.CENTER) self._mgr.AddPane(text2, wx.CENTER) self._mgr.AddPane(text3, wx.CENTER) # tell the manager to 'commit' all the changes just made self._mgr.Update() self.Bind(wx.EVT_CLOSE, self.OnClose) def OnClose(self, event): # deinitialize the frame manager self._mgr.UnInit() # delete the frame self.Destroy() app = wx.App() frame = MyFrame(None) frame.Show() app.MainLoop() I want to know what is called when we change the size of the panes. If you tell me that, I can do the rest by myself :)

    Read the article

  • Dynamically add items to Tkinter Canvas

    - by nick369
    I'm attempting to learn Tkinter with the goal of being able to create a 'real-time' scope to plot data. As a test, I'm trying to draw a polygon on the canvas every time the 'draw' button is pressed. The triangle position is randomized. I have two problems: There is a triangle on the canvas as soon as the program starts, why and how do I fix this? It doesn't draw any triangles when I press the button, at least none that I can see. CODE from Tkinter import * from random import randint class App: def __init__(self,master): #frame = Frame(master) #frame.pack(side = LEFT) self.plotspc = Canvas(master,height = 100, width = 200, bg = "white") self.plotspc.grid(row=0,column = 2, rowspan = 5) self.button = Button(master, text = "Quit", fg = "red", \ command = master.quit) self.button.grid(row=0,column=0) self.drawbutton = Button(master, text = "Draw", command = \ self.pt([50,50])) self.drawbutton.grid(row = 0, column = 1) def pt(self, coords): coords[0] = coords[0] + randint(-20,20) coords[1] = coords[1] + randint(-20,20) x = (0,5,10) y = (0,10,0) xp = [coords[0] + xv for xv in x] yp = [coords[1] + yv for yv in y] ptf = zip(xp,yp) self.plotspc.create_polygon(*ptf) if _name_ == "_main_": root = Tk() app = App(root) root.mainloop() The code is formatting strangely within the code tags, I have no idea how to fix this.

    Read the article

  • Django says the "id may not be NULL" but why is it?

    - by Oli
    I'm going crazy today. I just tried to insert a new record and it threw back a "post_blogpost.id may not be NULL" error. Here's my model: class BlogPost(models.Model): title = models.CharField(max_length=100) slug = models.SlugField(max_length=100) who = models.ForeignKey(User, default=1) when = models.DateTimeField() intro = models.TextField(blank=True, null=True) content = models.TextField(blank=True, null=True) counter = models.PositiveIntegerField(default=0) published = models.BooleanField(default=False) css = models.TextField(blank=True, null=True) class Meta: ordering = ('-when', 'id') There are a number of functions beneath the model too but I won't include them in full here. Their names are: content_cache_key, clear_cache, __unicode__, reads, read, processed_content. I'm adding through the admin... And I'm running out of hair.

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • twisted reactor stops too early

    - by pygabriel
    I'm doing a batch script to connect to a tcp server and then exiting. My problem is that I can't stop the reactor, for example: cmd = raw_input("Command: ") # custom factory, the protocol just send a line reactor.connectTCP(HOST,PORT, CommandClientFactory(cmd) d = defer.Deferred() d.addCallback(lambda x: reactor.stop()) reactor.callWhenRunning(d.callback,None) reactor.run() In this code the reactor stops before that the tcp connection is done and the cmd is passed. How can I stop the reactor after that all the operation are finished?

    Read the article

  • Not able to pass multiple override parameters using nose-testconfig 0.6 plugin in nosetests

    - by Jaikit
    Hi, I am able to override multiple config parameters using nose-testconfig plugin only if i pass the overriding parameters on commandline. e.g. nosetests -c nose.cfg -s --tc=jack.env1:asl --tc=server2.env2:abc But when I define the same thing inside nose.cfg, than only the value for last parameter is modified. e.g. tc = server2.env2:abc tc = jack.env1:asl I checked the plugin code. It looks fine to me. I am pasting the part of plugin code below: parser.add_option( "--tc", action="append", dest="overrides", default = [], help="Option:Value specific overrides.") configure: if options.overrides: self.overrides = [] overrides = tolist(options.overrides) for override in overrides: keys, val = override.split(":") if options.exact: config[keys] = val else: ns = ''.join(['["%s"]' % i for i in keys.split(".") ]) # BUG: Breaks if the config value you're overriding is not # defined in the configuration file already. TBD exec('config%s = "%s"' % (ns, val)) Let me know if any one has any clue.

    Read the article

  • SQLAlchemy returns tuple not dictionary

    - by Ivan
    Hi everyone, I've updated SQLAlchemy to 0.6 but it broke everything. I've noticed it returns tuple not a dictionary anymore. Here's a sample query: query = session.query(User.id, User.username, User.email).filter(and_(User.id == id, User.username == username)).limit(1) result = session.execute(query).fetchone() This piece of code used to return a dictionary in 0.5. My question is how can I return a dictionary?

    Read the article

  • SQLAlchemy - SQLite for testing and Postgresql for devlopment - How to port?

    - by StackUnderflow
    I want to use sqlite memory database for all my testing and Postgresql for my development/production server. But the SQL syntax is not same in both dbs. for ex: SQLite has autoincrement, and Postgresql has serial Is it easy to port the SQL script from sqlite to postgresql... what are your solutions? If you want me to use standard SQL, how should I go about generating primary key in both the databases?

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • CherryPy and RESTful web api

    - by hyperboreean
    What's the best approach of creating a RESTful web api in CherryPy? I've been looking around for a few days now and nothing seems great. For Django it seems that are lots of tools to do this, but not for CherryPy or I am not aware of them

    Read the article

  • Problem with anchor tags in Django after using lighttpd + fastcgi

    - by Drew A
    I just started using lighttpd and fastcgi for my django site, but I've noticed my anchor links are no longer working. I used the anchor links for sorting links on the page, for example I use an anchor to sort links by the number of points (or votes) they have received. For example: the code in the html template: ... {% load sorting_tags %} ... {% ifequal sort_order "points" %} {% trans "total points" %} {% trans "or" %} {% anchor "date" "date posted" %} {% order_by_votes links request.direction %} {% else %} {% anchor "points" "total points" %} {% trans "or" %} {% trans "date posted" %} ... The anchor link on "www.mysite.com/my_app/" for total points will be directed to "my_app/?sort=points" But the correct URL should be "www.mysite.com/my_app/?sort=points" All my other links work, the problem is specific to anchor links. The {% anchor %} tag is taken from django-sorting, the code can be found at http://github.com/directeur/django-sorting Specifically in django-sorting/templatetags/sorting_tags.py Thanks in advance.

    Read the article

  • How small is *too small* for an opensource project?

    - by Adam Lewis
    I have a fair number of smaller projects / libraries that I have been using over the past 2 years. I am thinking about moving them to Google Code to make it easier to share with co-workers and easier to import them into new projects on my own environments. The are things like a simple FSMs, CAN (Controller Area Network) drivers, and GPIB drivers. Most of them are small (less than 500 lines), so it makes me wonder are these types of things too small for a stand alone open-source project? Note that I would like to make it opensource because it does not give me, or my company, any real advantage.

    Read the article

  • How can I lookup an attribute in any scope by name?

    - by Wai Yip Tung
    How can I lookup an attribute in any scope by name? My first trial is to use globals() and locals(). e.g. >>> def foo(name): ... a=1 ... print globals().get(name), locals().get(name) ... >>> foo('a') None 1 >>> b=1 >>> foo('b') 1 None >>> foo('foo') <function foo at 0x014744B0> None So far so good. However it fails to lookup any built-in names. >>> range <built-in function range> >>> foo('range') None None >>> int <type 'int'> >>> foo('int') None None Any idea on how to lookup built-in attributes?

    Read the article

  • How to make scipy.interpolate give a an extrapolated result beyond the input range?

    - by Salim Fadhley
    I'm trying to port a program which uses a hand-rolled interpolator (developed by a mathematitian colleage) over to use the interpolators provided by scipy. I'd like to use or wrap the scipy interpolator so that it has as close as possible behavior to the old interpolator. A key difference between the two functions is that in our original interpolator - if the input value is above or below the input range, our original interpolator will extrapolate the result. If you try this with the scipy interpolator it raises a ValueError. Consider this program as an example: import numpy as np from scipy import interpolate x = np.arange(0,10) y = np.exp(-x/3.0) f = interpolate.interp1d(x, y) print f(9) print f(11) # Causes ValueError, because it's greater than max(x) Is there a sensible way to make it so that instead of crashing, the final line will simply do a linear extrapolate, continuing the gradients defined by the first and last two pouints to infinity. Note, that in the real software I'm not actually using the exp function - that's here for illustration only!

    Read the article

< Previous Page | 420 421 422 423 424 425 426 427 428 429 430 431  | Next Page >