Search Results

Search found 31994 results on 1280 pages for 'input output'.

Page 432/1280 | < Previous Page | 428 429 430 431 432 433 434 435 436 437 438 439  | Next Page >

  • Why does the compiler complain "while expected" when I try to add more code?

    - by user1893578
    Write a program with a word containing @ character as an input. If the word doesn't contain @, it should prompt the user for a word with @. Once a word with @ is read, it should output the word then terminate. This is what I have done so far: public class find { public static void main(String[] args) { System.out.println(" Please enter a word with @ "); Scanner scan = new Scanner(System.in); String bad = "@"; String word = scan.next(); do if (!word.contains(bad)) System.out.println(" Please try again "); else System.out.println(" " + word); while (!word.contains(bad)); } } I can get it to terminate after a word containing "@" is given as input, but if I try to add a Scanner to the line after "please try again", it says while expected.

    Read the article

  • PHP setcookie warning

    - by Ranking
    Hello guys, I have a problem with 'setcookie' in PHP and I can't solve it. so I receive this error "Warning: Cannot modify header information - headers already sent by (output started at C:\Program Files\VertrigoServ\www\vote.php:14) in C:\Program Files\VertrigoServ\www\vote.php on line 86" and here is the file.. line 86 is setcookie ($cookie_name, 1, time()+86400, '/', '', 0); is there any other way to do this ?? <html> <head> <title>Ranking</title> <link href="style.css" rel="stylesheet" type="text/css"> </head> <body bgcolor="#EEF0FF"> <div align="center"> <br/> <div align="center"><div id="header"></div></div> <br/> <table width="800" border="0" align="center" cellpadding="5" cellspacing="0" class="mid-table"> <tr><td height="5"> <center> <table border="0" cellpadding="0" cellspacing="0" align="center" style="padding-top:5px;"> <tr> <td align="center" valign="top"><img src="images/ads/top_banner.png"></td> </tr> </table> </center> </td></tr> <tr><td height="5"></td></tr> </table> <br/> <?php include "conf.php"; $id = $_GET['id']; if (!isset($_POST['submitted'])) { if (isset($_GET['id']) && is_numeric($_GET['id'])) { $id = mysql_real_escape_string($_GET['id']); $query = mysql_query("SELECT SQL_CACHE id, name FROM s_servers WHERE id = $id"); $row = mysql_fetch_assoc($query); ?> <form action="" method="POST"> <table width="800" height="106" border="0" align="center" cellpadding="3" cellspacing="0" class="mid-table"> <tr><td><div align="center"> <p>Code: <input type="text" name="kod" class="port" /><img src="img.php" id="captcha2" alt="" /><a href="javascript:void(0);" onclick="document.getElementById('captcha2').src = document.getElementById('captcha2').src + '?' + (new Date()).getMilliseconds()">Refresh</a></p><br /> <p><input type="submit" class="vote-button" name="vote" value="Vote for <?php echo $row['name']; ?>" /></p> <input type="hidden" name="submitted" value="TRUE" /> <input type="hidden" name="id" value="<?php echo $row['id']; ?>" /> </div></td></tr> <tr><td align="center" valign="top"><img src="images/ads/top_banner.png"></td></tr> </table> </form> <?php } else { echo '<font color="red">You must select a valid server to vote for it!</font>'; } } else { $kod=$_POST['kod']; if($kod!=$_COOKIE[imgcodepage]) { echo "The code does not match"; } else { $id = mysql_real_escape_string($_POST['id']); $query = "SELECT SQL_CACHE id, votes FROM s_servers WHERE id = $id"; $result = mysql_query($query) OR die(mysql_error()); $row = mysql_fetch_array($result, MYSQL_ASSOC); $votes = $row['votes']; $id = $row['id']; $cookie_name = 'vote_'.$id; $ip = $_SERVER['REMOTE_ADDR']; $ltime = mysql_fetch_assoc(mysql_query("SELECT SQL_CACHE `time` FROM `s_votes` WHERE `sid`='$id' AND `ip`='$ip'")); $ltime = $ltime['time'] + 86400; $time = time(); if (isset($_COOKIE['vote_'.$id]) OR $ltime > $time) { echo 'You have already voted in last 24 hours! Your vote is not recorded.'; } else { $votes++; $query = "UPDATE s_servers SET votes = $votes WHERE id = $id"; $time = time(); $query2 = mysql_query("INSERT INTO `s_votes` (`ip`, `time`, `sid`) VALUES ('$ip', '$time', '$id')"); $result = mysql_query($query) OR die(mysql_error()); setcookie ($cookie_name, 1, time()+86400, '/', '', 0); } } } ?> <p><a href="index.php">[Click here if you don't want to vote]</a></p><br/> <p><a href="index.php">Ranking.net</a> &copy; 2010-2011<br> </p> </div> </body> </html> Thanks a lot!

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • PHP: Remove all fcn not acting as expected, Code Inside

    - by Josh K
    I made this simple function (remove all $elem from $array): function remall($array, $elem) { for($i=0; $i < count($array); $i++) if($array[$i] == $elem) unset($array[$i]); $newarray = array_values($array); return $newarray; } But it isn't working perfectly, here are some inputs and outputs $u = array(1, 7, 2, 7, 3, 7, 4, 7, 5, 7, 6, 7); $r = remall($u, 7); Output of $r: 12345767 $n = array(7, 7, 1, 7, 3, 4, 6, 7, 2, 3, 1, -3, 10, 11, 7, 7, 7, 2, 7); $r = remall($n, 7); Output of $r: 1346231-30117727 Notice how there are still 7s in my outputs. Also, My function will only be removing numbers from an array. Let me know if you spot something, thanks.

    Read the article

  • removeClass doesn't work on the second DIV tag

    - by kwokwai
    Hi all, I am learning JQuery and writing a simple data validation for the two fields in a HTML form: <FORM name="addpost" id="addpost" method="post" action="/add"> <TABLE BORDER=0 width="100%"> <TR> <TD>Topic</TD> <TD> <DIV ID="topic"> <INPUT type=text name="topic" id="topic" size="72" maxlength="108"/> </DIV> </TD> </TR> <TR> <TD>Comments</TD> <TD> <DIV ID="topiccontent"> <TEXTAREA rows="12" cols="48" name="content" ID="content"> </TEXTAREA> </DIV> </TD> </TR> <TR> <TD> <INPUT type="submit" value="Send"> </TD> </TR> </TABLE> </FORM> Here is the JQuery script for checking the data input from the form above: $('#addpost').submit(function(){ if($('#topic').val()==""){ $('#topic').addClass('hierror'); return false;} else{$('#topic').removeClass('hierror');} if($('#topiccontent').val()==""){ $('#topiccontent').addClass('hierror'); return false;} else{$('#topiccontent').removeClass('hierror');} }); Here is the CSS for the hierror class: .hierror{border-style:solid; border-width:12px; border-color:#FF0000;} ('#topic').removeClass('hierror') works but ('#topiccontent').removeClass('hierror') doesn't. Could you help me please?

    Read the article

  • Unable to center text in IE but works in firefox

    - by greenpool
    Can somebody point out where I'm going wrong with the following code. Text inside td elements need to be centered except for Summary and Experience. This only appears to work in Firefox/chrome. In IE8 all td text are displayed as left-justified. No matter what I try it doesn't center it. Any particular reason why this would happen? Thanks. css #viewAll { font-family:"Trebuchet MS", Arial, Helvetica, sans-serif; width:100%; border-collapse:collapse; margin-left:10px; table-layout: fixed; } #viewAll td, #viewAll th { font-size:1.1em; border:1px solid #98bf21; word-wrap:break-word; text-align:center; overflow:hidden; } #viewAll tbody td{ padding:2px; } #viewAll th { font-size:1.1em; padding-top:5px; padding-bottom:4px; background-color:#A7C942; color:#ffffff; } table <?php echo '<table id="viewAll" class="tablesorter">'; echo '<thead>'; echo '<tr align="center">'; echo '<th style="width:70px;">Product</th>'; echo '<th style="width:105px;">Prob</th>'; echo '<th style="width:105px;">I</th>'; echo '<th style="width:60px;">Status</th>'; echo '<th style="width:120px;">Experience</th>'; echo '<th style="width:200px;">Technical Summary</th>'; echo '<th style="width:80px;">Record Created</th>'; echo '<th style="width:80px;">Record Updated</th>'; echo '<th style="width:50px;">Open</th>'; echo '</tr>'; echo '</thead>'; echo '<tbody>'; while ($data=mysqli_fetch_array($result)){ #limiting the summary text displayed in the table $limited_summary = (strlen($data['summary']) > 300) ? substr(($data['summary']),0,300) . '...' : $data['summary']; $limited_exp = (strlen($data['exp']) > 300) ? substr(($data['exp']),0,300) . '...' : $data['exp']; echo '<tr align="center"> <td style="width:70px; text-align:center;">'.$data['product'].'</td>'; //if value is '-' do not display as link if ($data['prob'] != '-'){ echo '<td style="width:105px;">'.$data['prob'].'</a></td>'; } else{ echo '<td style="width:105px; ">'.$data['prob'].'</td>'; } if ($data['i'] != '-'){ echo '<td style="width:105px; ">'.$data['i'].'</a></td>'; } else{ echo '<td style="width:105px; ">'.$data['i'].'</td>'; } echo'<td style="width:40px; " >'.$data['status'].'</td> <td style="width:120px; text-align:left;">'.$limited_cust_exp.'</td> <td style="width:200px; text-align:left;">'.$limited_summary.'</td> <td style="width:80px; ">'.$data['created'].'</td> <td style="width:80px; ">'.$data['updated'].'</td>'; if (isset($_SESSION['username'])){ echo '<td style="width:50px; "> <form action="displayRecord.php" method="get">'.' <input type="hidden" name="id" value="'. $data['id'].'" style="text-decoration: none" /><input type="submit" value="Open" /></form></td>'; }else{ echo '<td style="width:50px; "> <form action="displayRecord.php" method="get">'.' <input type="hidden" name="id" value="'. $data['id'].'" style="text-decoration: none" /><input type="submit" value="View" /></form></td>'; } echo '</tr>'; }#end of while echo '</tbody>'; echo '</table>'; ?>

    Read the article

  • Best use of Jquery sliders and PHP

    - by Coronier
    Hello there, I have two questions: What's the best way to send sliders' values to a PHP page ? I'm associating each slider (several per page) with an hidden form so far, but I wonder if there's a "cleaner" way to do this. Related to the 1st question; I've some trouble with the script: var score = $(this).slider( "option", "value" ); $(this).closest("input[type=='hidden']").val(score); It doesn't set the value of the hidden input. Can somebody tells me what's wrong ? Thanks

    Read the article

  • Unable to recieve file contents on server during upload

    - by Khushal
    Hello, I have a JSP page in which I have a file input field from which I browse a csv file and then upload it on server. I am using method = "POST" and ENCTYPE='multipart/form-data' in the form in which this file input field is present. On the servlet side(in the application's servlet) I am making use of apache's commom file upload API-ServletFileUpload API. After getting the FileItem list from the method parseRequest(request) of this API I am unable to get the file name and its content by using the methods getName(), getString() of FileItem API. Needed to know what am I doing wrong or any modifications in my approach that will make my application to work. Any pointers regarding this will be helpful. Thanks in advance!!

    Read the article

  • Self Modifying Python? How can I redirect all print statements within a function without touching sys.stdout?

    - by Fake Name
    I have a situation where I am attempting to port some big, complex python routines to a threaded environment. I want to be able to, on a per-call basis, redirect the output from the function's print statement somewhere else (a logging.Logger to be specific). I really don't want to modify the source for the code I am compiling, because I need to maintain backwards compatibility with other software that calls these modules (which is single threaded, and captures output by simply grabbing everything written to sys.stdout). I know the best option is to do some rewriting, but I really don't have a choice here. Edit - Alternatively, is there any way I can override the local definition of print to point to a different function? I could then define the local print = system print unless overwritten by a kwarg, and would only involve modify a few lines at the beginning of each routine.

    Read the article

  • beforeSave() returned some error

    - by kwokwai
    Hi all, I got a simple input text field in a HTML form: <input type="text" name="data[User][pswd]" id="data[User][pswd]"> The scripts for the Controller's action that captured the data is as follows: function register(){ $temp = $this->data; if(strlen($temp['User']['pswd'])>6) { if ($this->User->save($this->data)) { $this->Session->setFlash('Data was Saved'); } } } // this script works And in the Model controller, I got these lines of codes: function beforeSave() { $raw = $this->data; if(strlen($raw['User']['pswd'])>6){ md5($raw['User']['pswd']); } return true; } // this script failed to work The data was stored into the Database successfully but it was not undergone any MD5 encryption. I think that there must be some errors in the Model's script because I saw some errors flashed after the data was saved, but the screen that showed the errors immediately refreshed in a second after the data was saved successfully and I couldn't see the detail of the errors that caused the problem. Could you help me out please?

    Read the article

  • Form validation in JAvascript with Regexp

    - by Nikita Barsukov
    I have a webpage with an input field where only digits are allowed. The input field has an onkeyup event that starts this validating function: function validate() { var uah_amount = document.getElementById("UAH").value; var allowed = /^\d+$/; document.getElementById("error").innerHTML = document.getElementById("UAH").value; if (!allowed.test(uah_amount)) { document.getElementById("error").style.backgroundColor = "red"; } } Everything works as I expect until I hit Backspace button to remove some characters. In this case function always behaves as if I entered letters. How to correct this?

    Read the article

  • finding the value of radio button with jquery

    - by oo
    i have this code below to show different divs when i choose certain radio buttons: if ($("input[@name='exerciseRB']:checked").val() == 'New') { $("#newExercise").show(); $("#existingExercise").hide(); } else { $("#newExercise").hide(); $("#existingExercise").show(); } at first, i just had two radio buttons (both named exerciseRB and everything works fine. Now, later in my web page i added two new radio buttons (with the name lessonRB). The issue is that once i added these other new radio buttons when i look up this in firebug: $("input[@name='exerciseRB']:checked") i actually get an array back with both the exerciseRB item as well as the lessonRB item. Its almost as if the @name='exerciseRB' is being ignored. any ideas here?

    Read the article

  • Database that accesses a website.?

    - by Alec
    Hi Guys What application should I use that is able to automatically access a website to gather information? Basically I have a database that completes calculations for me; however I have to manually gather the parameters from a website and input these into my database. What I would like is have an application that will take my input say the name of a product, access the website, add this name into a search box on a website, complete the search and then extract the desired information from the web page returning the results to my application to complete the calculation thus presenting me with the result. This is a little out of my depth but I’m willing to learn no matter how complicated the software. Cheers for your help.

    Read the article

  • Is it possible to block a certain character or group of characters from entering into text box or an

    - by Param-Ganak
    Hello friends! I have a text input field like text box or text area. I want to prevent the user from entering certain character or a group of characters. That is for example if I dont want # * @ and numbers from 0-9 these characters. So Whenever user press any of the above character key then that character should not appear in to an input field. It means directly blocking that character. Is this possible in Jquery? Please give me some guidelines to achive it. Thank You

    Read the article

  • Writing out to a file in scheme

    - by Ceelos
    The goal of this is to check if the character taken into account is a number or operand and then output it into a list which will be written out to a txt file. I'm wondering which process would be more efficient, whether to do it as I stated above (writing it to a list and then writing that list out into a file) or being writing out into a txt file right from the procedure. I'm new with scheme so I apologize if I am not using the correct terminology (define input '("3" "+" "4")) (define check (if (number? (car input)) (write this out to a list or directly to a file) (check the rest of file))) Another question I had in mind, how can I make it so that the check process is recursive? I know it's a lot of asking but I've getting a little frustrated with checking out the methods that I have found on other sites. I really appreciate the help!

    Read the article

  • javascript - Google Chrome cluttering Array generated from .split()

    - by patrick
    Given the following string: var str = "one,two,three"; If I split the string on the commas, I normally get an array, as expected: var arr = str.split(/\s*,\s*/); Trouble is that in Google Chrome (for Mac), it appends extra properties to the array. Output from Chrome's debugger: arr: Array 0: one 1: two 2: three constructor: function Array() index: undefined input: undefined length: 3 So if I iterate over the array with a for/in loop, it iterates over the new properties. Specifically the input and index properties. Using hasOwnProperty doesn't seem to help. A fix would be to do a for loop based on the length of the Array. Still I'm wondering if anyone has insight into why Chrome behaves this way. Firefox and Safari don't have this issue.

    Read the article

  • Pointers in C with binary file

    - by darkie15
    Hi All, I am reading the contents of the file using fread into an char array. But I am not sure why it is not getting printed in the output. Here is the code: void getInfo(FILE* inputFile) { char chunk[4]; int liIndex; for (liIndex = 0 ; liIndex < 4 ; liIndex++) { fread(chunk, sizeof(char), 4, inputFile); } printf("\n chunk %s", chunk); } Output prints nothing at all. Where am I going wrong? Regards , darkie

    Read the article

  • How to roeder the rows of one matrix with respect to the other matrix?

    - by user2806363
    I have two big matrices A and B with diffrent dimensions.I want to order the rows of matrix B with respect to rows of the matrix A. and add the rows with values 0 to matrix B, if that row is not exist in B but in A Here is the reproduceable example and expected output: A<-matrix(c(1:40), ncol=8) rownames(A)<-c("B", "A", "C", "D", "E") > A [,1] [,2] [,3] [,4] [,5] [,6] [,7] [,8] B 1 6 11 16 21 26 31 36 A 2 7 12 17 22 27 32 37 C 3 8 13 18 23 28 33 38 D 4 9 14 19 24 29 34 39 E 5 10 15 20 25 30 35 40 > B<-matrix(c(100:108),ncol=3) rownames(B)<-c("A", "E", "C") > B [,1] [,2] [,3] A 100 103 106 E 101 104 107 C 102 105 108 Here is the Expected output : >B [,1] [,2] [,3] B 0 0 0 A 100 103 106 C 102 105 108 D 0 0 0 E 101 104 107 > Would someone help me to implement this in R ?

    Read the article

  • Datepicker (1.8rc3) not transferring date in IE6

    - by brianjcohen
    Using jquery-1.4.2 and jquery-UI 1.8rc3, I instantiated a datepicker on a text input with showOn: 'focus'. The datepicker appears correctly. However when I click on a date, the datepicker doesn't disappear and the dateStr doesn't get transferred to the text input. I tried adding an onClose: handler that calls alert(dateStr). The event fires but no dateStr has been set. Everything works fine in Firefox. I have Microsoft Script Debugger installed but no script errors were detected. I did report this as a potential problem at the jQuery UI forums but my message has been sitting there awaiting moderation for hours and I figured someone here might have a suggestion. $().ready(function() { $(".date").datepicker({ showOn: 'focus', onClose: function(dateText) { alert(dateText); } }); });

    Read the article

  • Javascript Getting specific element (of parent) by name

    - by Fluidbyte
    I'm using custom tags to define sections in an application, so I have something like this: <mysection> <form> <input name="myfield"> </form> </mysection> I'm using the following and able to get the tag (printed to console, everything is groovy) var parent = document.getElementsByTagName('mysection'); The issue I'm having is finding the child field by name: var myfield = parent.getElementsByName("myfield"); ...as I don't want to pick up on any other 'sections' that might have an input with the name 'myfield'. EDIT: var parent = document.getElementsByTagName('mysection')[0]; was suggested and returns to console the section contents, however, getElementsByName throws an error: Uncaught TypeError: Object #<NodeList> has no method 'getElementsByName'

    Read the article

  • WMF image data validation?

    - by deostroll
    There is an image capturing device which gives its output in wmf. This output is stored in the database directly. We have cases where at times some of these images do not appear on a web page in IE. But if we right click on the page we are able to save the image on to the hard disk; meaning the image does exist on the page, but does not appear visible. I think this is because of some file corruption issue, but I don't know how to resolve it. We are however able to view such files using MS Picture Viewer (desktop app). Is there anyway we can detect such problematic files?

    Read the article

  • "Teach" a computer how to do addition?

    - by ffar
    The problem is to learn computer to do addition. Computer have as input a knowladge of a numbers: he "knows" that after 1 goes 2, after 2 goes 3 and so on... Having that data computer can easyly get next number. Next, computer have knowlandge as input that x+0=x and x+(y+1)=(x+1)+y. This axioms let computer to do addition. For example, to add 5 and 3, computer makes following: 5+3 = 5+(2+1) = (5+1)+2 = 6+2 = 6+(1+1) = (6+1)+1 = 7+1 = 8. But this is too long to add numbers in such way. The problem is to develop program which can improve this way of addition using the rules of mathemetics and logic. The goal addition must executed in O(log(N)) time, not O(N) time, N is magnitude of added numbers. Have this program any science value? Is any program can do such things?

    Read the article

  • Help me with Php session vs Header redirect?

    - by python
    I have the following pages: *page1.php <?php if (isset($_GET['link'])) { session_start(); $_session['myvariable'] = 'Hello World'; header('Location: http://' . $_SERVER['SERVER_NAME'] . dirname($_SERVER['REQUEST_URI']) . '/page2.php'); exit; } ?> <a href="<?php print $_SERVER['REQUEST_URI'] . '?link=yes';?>">Click Here</a> *page2.php <?php print 'Here is page two, and my session variable: '; session_start(); print $_session['myvariable']; //This line could not output. exit; ?> When I try output $_session['myvariable'] I did not get the result hello world message. I could not find out the solution to fix it .?

    Read the article

< Previous Page | 428 429 430 431 432 433 434 435 436 437 438 439  | Next Page >