Search Results

Search found 31994 results on 1280 pages for 'input output'.

Page 430/1280 | < Previous Page | 426 427 428 429 430 431 432 433 434 435 436 437  | Next Page >

  • Is apparent NULL pointer dereference in C actually pointer arithmetic?

    - by karthik A
    hey ive got this piece of code. It dereferences a null pointer here. But then there is an and with unsigned int. I really dont understand the whole part. Can someone explain the output.?? struct hi { long a; int b; long c; }; int main() { struct hi ob={3,4,5}; struct hi *ptr=&ob; int num= (unsigned int) & (((struct hi *)0)->b); printf("%d",num); printf("%d",*(int *)((char *)ptr + (unsigned int) & (((struct hi *)0)->b))); } The output I get is 44. But how does it work?

    Read the article

  • Passing Values from a View to itself with parameters getting null values ?

    - by vsj
    Hi all, I am trying to get values from a view which i have the code below and I am taking the start date value from the view input text box and posting it back but I am still getting null except for the apikey and userkey.Here are the two views.. public ActionResult View1(string apiKey, string userId) { StartGoalViewModel vm = new StartGoalViewModel(); vm.ApiKey = apiKey; vm.UserId = userId; vm.GoalTypeId =1; vm.StartDate = null; return View(vm); } VIEW1.ASPX <% Html.BeginForm(); %> <%= Html.TextBox("name", Model.StartDate) %> <input type="submit" value="Start" /> <% Html.EndForm(); %> [HttpPost] public ActionResult VIEW1 (StartGoalViewModel fm) { // I get StartDate null... }

    Read the article

  • Getting Null value with JSON from MySQL, how to retrive data from MySQL to JSON correctly?

    - by sky
    I'm using following code but cannot return data from MySQL. This is the output: <script type="text/javascript"> var somethings= [null,null,null]; </script> It does have three post, but I couldn't get the title(message) output. EDIT: this is the code I'm using: <?php $session = mysql_connect('localhost','name','pass'); mysql_select_db('dbname', $session); $result= mysql_query('SELECT * FROM posts', $session); $somethings= array(); while ($row= mysql_fetch_assoc($result)) { $somethings[]= $row['something']; } ?> <script type="text/javascript"> var somethings= <?php echo json_encode($somethings); ?>; </script> This is the table: message Try iPhone post! Welcome to Yo~ :) ??!

    Read the article

  • JavaScript: Can I declare a variable by querying which function is called? (Newbie)

    - by belle3WA
    I'm working with an existing JavaScript-powered cart module that I am trying to modify. I do not know JS and for various reasons need to work with what is already in place. The text that appears for my quantity box is defined within an existing function: function writeitems() { var i; for (i=0; i<items.length; i++) { var item=items[i]; var placeholder=document.getElementById("itembuttons" + i); var s="<p>"; // options, if any if (item.options) { s=s+"<select id='options"+i+"'>"; var j; for (j=0; j<item.options.length; j++) { s=s+"<option value='"+item.options[j].name+"'>"+item.options[j].name+"</option>"; } s=s+"</select>&nbsp;&nbsp;&nbsp;"; } // add to cart s=s+method+"Quantity: <input id='quantity"+i+"' value='1' size='3'/> "; s=s+"<input type='submit' value='Add to Cart' onclick='addtocart("+i+"); return false;'/></p>"; } placeholder.innerHTML=s; } refreshcart(false); } I have two different types of quantity input boxes; one (donations) needs to be prefaced with a dollar sign, and one (items) should be blank. I've taken the existing additem function, copied it, and renamed it so that there are two identical functions, one for items and one for donations. The additem function is below: function additem(name,cost,quantityincrement) { if (!quantityincrement) quantityincrement=1; var index=items.length; items[index]=new Object; items[index].name=name; items[index].cost=cost; items[index].quantityincrement=quantityincrement; document.write("<span id='itembuttons" + index + "'></span>"); return index; } Is there a way to declare a global variable based on which function (additem or adddonation) is called so that I can add that into the writeitems function so display or hide the dollar sign as needed? Or is there a better solution? I can't use HTML in the body of the cart page because of the way it is currently coded, so I'm depending on the JS to take care of it. Any help for a newbie is welcome. Thanks!

    Read the article

  • two scp and ssh processes with single authentication

    - by Tomek Wyderka
    I need to scp and then ssh to the same host. Is it possible to authenticate just one time? Is it possible to input password once, then scp file, then ssh on that host and work interactively? Update I get HOSTNAME and SSH_PASSWORD. I never log in on that machine before. I need to send some files (probably using scp) and then log in using ssh and work on that HOST interactively. I want to save time and input password just once. I have lots of such hosts...

    Read the article

  • Python: How to use code.InteractiveConsole?

    - by Rosarch
    I'm trying to use InteractiveConsole to create a new front-end for a Python interpreter. These code fragments are from me playing around with InteractiveConsole in IDLE: >>> ses = code.InteractiveConsole() >>> ses.runsource("def foo():") True >>> ses.runsource(" return 2") File "<input>", line 1 SyntaxError: 'return' outside function (<input>, line 1) False Why does it raise a syntax error? How else can I finish writing the function? Also, for something like this: >>> ses.runsource("x = 1") False >>> ses.runsource("x") 1 False How can I capture the 1 value from above? False is the return value, but 1 is written to some stream.

    Read the article

  • Why is Drupal writing to root and not sites/default/files?

    - by Candland
    I'm using Drupal 6.14 on Win7. Everything seems to work except files that should be written to sites/default/files are trying to be written to /. The site was moved from a linux installation, which is writing the files correctly. I have setup a web.config w/ the rewrite rules for drupal. Not sure what or where else I should check. Thanks for any help. <rule name="Drupal Clean URLs" stopProcessing="true"> <match url="^(.*)$" /> <conditions> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php?q={R:1}" appendQueryString="true" /> </rule>

    Read the article

  • Form validation in JAvascript with Regexp

    - by Nikita Barsukov
    I have a webpage with an input field where only digits are allowed. The input field has an onkeyup event that starts this validating function: function validate() { var uah_amount = document.getElementById("UAH").value; var allowed = /^\d+$/; document.getElementById("error").innerHTML = document.getElementById("UAH").value; if (!allowed.test(uah_amount)) { document.getElementById("error").style.backgroundColor = "red"; } } Everything works as I expect until I hit Backspace button to remove some characters. In this case function always behaves as if I entered letters. How to correct this?

    Read the article

  • php random image file name

    - by bush man
    Okay im using a snippet I found on google to take a users uploaded image and put it in my directory under Content But Im worried about duplicates so I was going have it upload the image as a Random number well here is my code you can probably understand what im going for through it anyways <label for="file">Profile Pic:</label> <input type="file" name="ProfilePic" id="ProfilePic" /><br /> <input type="submit" name="submit" value="Submit" /> $ProfilePicName = $_FILES["ProfilePic"]["name"]; $ProfilePicType = $_FILES["ProfilePic"]["type"]; $ProfilePicSize = $_FILES["ProfilePic"]["size"]; $ProfilePicTemp = $_FILES["ProfilePic"]["tmp_name"]; $ProfilePicError = $_FILES["ProfilePic"]["error"]; $RandomAccountNumber = mt_rand(1, 99999); echo $RandomAccountNumber; move_uploaded_file($ProfilePicTemp, "Content/".$RandomAccountNumber.$ProfilePicType); And then basicly after all this Im going try to get it to put that random number in my database

    Read the article

  • How to empty a socket in python?

    - by luc
    I need to empty the data on a socket (making sure that there is nothing to receive). Unfortunately, there is no function for this in the python socket module. I've implemented something this way: def empty_socket(sock): """remove the data present on the socket""" input = [sock] while 1: inputready, o, e = select.select(input,[],[], 0.0) if len(inputready)==0: break for s in inputready: s.recv(1) What do you think? Is there a better way to do that? Update: I don't want to change the socket timeout. What's why i prefer a select to a read. Update: The original question was using the 'flush' term. It seems that 'empty' is a better term. Update - 2010-02-27 : I've noticed a bug after when the pair has closed. The inputready is always filled with the sockets. I fixed that by adding a maximum number of loops. Is there a better fix?

    Read the article

  • Getting the dynamic value of a checkbox in repeating region loop with Jquery

    - by John
    How do I get the values of a check box that is in a repeating region with its values dynamically generated from a recordset from the database.I want to retrieve the value when it is checked and after I click on a link.The problem is that it is retrieving only the first value of the recordset which is 1.This is the code: //jQuery $(document).ready(function(){ $("#clickbtn").click(function(){ $("input[type=checkbox][checked]").each(function(){ var value=$("#checkid").attr('value'); $("#textfield").attr('value',value); }); return false; }); }); //html <td width="22"><form id="form1" name="form1" method="post" action=""> <input type="checkbox" name="checkid" id="checkid" value="<?php echo $row_people['NameID']; ?>" /> </form></td> I would appreciate the help.

    Read the article

  • WMF image data validation?

    - by deostroll
    There is an image capturing device which gives its output in wmf. This output is stored in the database directly. We have cases where at times some of these images do not appear on a web page in IE. But if we right click on the page we are able to save the image on to the hard disk; meaning the image does exist on the page, but does not appear visible. I think this is because of some file corruption issue, but I don't know how to resolve it. We are however able to view such files using MS Picture Viewer (desktop app). Is there anyway we can detect such problematic files?

    Read the article

  • Windows Service is not Working.

    - by prateeksaluja20
    I had made a windows service in visual studio 2008 in C#.inside the service i had written only single line code try { System.Diagnostics.Process.Start(@"E:\Users\Sk\Desktop\category.txt"); } catch { } then i add the project insatller & change the serviceProcessInstaller1 Account proerty as local system Also change the serviceInstaller1 start type proerty as Automatic. then i build the project.it was succesfull. after that i add another project that was setup project.i had added pprimary project output & i had added the custom action as "Primary output from DemoWindowsService (Active)".then buil the setup.setup was build sucessfully.then i install the setup & then went to services start the service.service stated properly butit was not performing the task. i had checked the path is correct & also i tried to do System.Diagnostics.Process.Start(@"E:\Windows\system32\notepad.exe") but still result is same.i tried alot but not getting the ans soleasse help me to solve this problem.

    Read the article

  • inputMismatchException Java reading doubles from plain text file

    - by user939287
    Using double variable = inputFile.nextDouble(); Gives the mismatch error and I can't figure out why... Anyone know what's up? The input file is just a bunch of doubles like 5.0... Okay here is the code snippet String fileName; Scanner scanner = new Scanner(System.in); System.out.println("\nEnter file name that contains the matrix and vector: "); fileName = scanner.nextLine(); Scanner inputFile = new Scanner(fileName); double a1 = inputFile.nextDouble(); the input file is a plain text document .txt in this format 5.0 4.0 -3.0 4.0 2.0 5.0 6.0 5.0 -2.0 -13.0 4.0 12.0 I don't understand why it wouldn't take those as doubles... As far as what its expecting the format of the file to be... I suppose binary? isn't that the default? I didn't specify in the code...

    Read the article

  • Javascript Function wont submit form..

    - by Josh K
    Here is my function: function processCheck() { var numberClicked = 0; var frm = document.getElementById('form'); for (var i=0; i<form.elements.length; i++) { if (frm.elements[i].checked) numberClicked++; } if(numberClicked != 8) alert('Must choose 8 Teams'); else frm.submit(); } My forms name is 'form', here is my input: echo "<input type='button' name='submit' value='Update' onclick='processCheck()' />"; When i click the button and there is anything but 8 boxes selected it displays the alert, if there is 8 boxes it does nothing (<-- The problem). I have the form action set to another page.

    Read the article

  • How does the stream manipulators work?

    - by Narek
    It is well known that the user can define stream manipulators like this: ostream& tab(ostream & output) { return output<< '\t'; } And this can be used in main() like this: cout<<'a'<<tab<<'b'<<'c'<<endl; Please explain me how does this all work? If operator<< assumes as a second parameter a pointer to the function that takes and returns ostream &, then please explain my why it is necessary? What would be wrong if the function does not take and return ostream & but it was void instead of ostream &? Also it is interesting why “dec”, “hex” manipulators take effect until I don’t change between them, but user defined manipulators should be always used in order to take effect for each streaming?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Problem with Initializing Consts

    - by UdiM
    This code, when compiled in xlC 8.0 (on AIX 6.1), produces the wrong result. It should print 12345, but instead prints 804399880. Removing the const in front of result makes the code work correctly. Where is the bug? #include <stdio.h> #include <stdlib.h> #include <string> long int foo(std::string input) { return strtol(input.c_str(), NULL, 0); } void bar() { const long int result = foo("12345"); printf("%u\n", result); } int main() { bar(); return 0; } Compilation command: /usr/vacpp/bin/xlC example.cpp -g

    Read the article

  • Shell Sort problem

    - by user191603
    Show the result of running Shell Sort on the input 9,8,7,6,5,4,3,2,1 using increments { 1,3,7 }. I have done this part. the result is: 9 8 7 6 5 4 3 2 1 (original) 2 1 7 6 5 4 3 9 8 ( 7-sort ) 2 1 4 3 5 7 6 9 8 ( 3-sort ) 1 2 3 4 5 6 7 8 9 ( 1-sort ) Then the question requires me to determine the running time of Shell Sort using Shell's increments of N/2, N/4, ..., 1 for sorted input. I am not quite sure how to answer the second question as I don't understand the requirement of this question. So, would anyone give some hints to let me finish this question? Thank you for your help first!

    Read the article

  • Using template specialization in C++

    - by user550413
    How can I write a function using template specialization that has 2 different input types and an output type: template <class input1, class input2, class output> and return the sum of the 2 numbers (integers/doubles). However, if I get 2 integers I want to return an integer type but for any other combinations of integer and double I'll always return double. I am trying to do that without using directly the '+' operator but having the next functions instead: double add_double_double(double a, double b) {return (a+b);} double add_int_double(int a, double b) {return ((double)(a)+b);} int add_int_int(int a, int b) {return (a+b);}

    Read the article

  • How do I do Textbox Submit

    - by Newb
    Hello everyone, I have a search box and a buttion. currently a user enter some text and press the search button. But I want to add another feature that instead of clicking the search button people can hit enter to search. How can I do that? Here is my code sample: <form method="post" action=""> <input id="search" name="search" type="text" /> <input id="search_btn" name="search_btn" type="submit" /> </form> Thanks in advance

    Read the article

  • How to make a call to an executable from Python script?

    - by fx
    I need to execute this script from my Python script. Is it possible? The script generate some outputs with some files being written. How do I access these files? I have tried with subprocess call function but without success. fx@fx-ubuntu:~/Documents/projects/foo$ bin/bar -c somefile.xml -d text.txt -r aString -f anotherString >output The application "bar" also references to some libraries, it also creates some files besides the output. How do I get access to these files? Just by using open()? Thank you,

    Read the article

  • Help me with Php session vs Header redirect?

    - by python
    I have the following pages: *page1.php <?php if (isset($_GET['link'])) { session_start(); $_session['myvariable'] = 'Hello World'; header('Location: http://' . $_SERVER['SERVER_NAME'] . dirname($_SERVER['REQUEST_URI']) . '/page2.php'); exit; } ?> <a href="<?php print $_SERVER['REQUEST_URI'] . '?link=yes';?>">Click Here</a> *page2.php <?php print 'Here is page two, and my session variable: '; session_start(); print $_session['myvariable']; //This line could not output. exit; ?> When I try output $_session['myvariable'] I did not get the result hello world message. I could not find out the solution to fix it .?

    Read the article

  • finding the value of radio button with jquery

    - by oo
    i have this code below to show different divs when i choose certain radio buttons: if ($("input[@name='exerciseRB']:checked").val() == 'New') { $("#newExercise").show(); $("#existingExercise").hide(); } else { $("#newExercise").hide(); $("#existingExercise").show(); } at first, i just had two radio buttons (both named exerciseRB and everything works fine. Now, later in my web page i added two new radio buttons (with the name lessonRB). The issue is that once i added these other new radio buttons when i look up this in firebug: $("input[@name='exerciseRB']:checked") i actually get an array back with both the exerciseRB item as well as the lessonRB item. Its almost as if the @name='exerciseRB' is being ignored. any ideas here?

    Read the article

< Previous Page | 426 427 428 429 430 431 432 433 434 435 436 437  | Next Page >