Search Results

Search found 12909 results on 517 pages for 'clustered index'.

Page 452/517 | < Previous Page | 448 449 450 451 452 453 454 455 456 457 458 459  | Next Page >

  • How to DRY on CRUD parts of my Rails app?

    - by kolrie
    I am writing an app which - similarly to many apps out there - is 90% regular CRUD things and 10% "juice", where we need nasty business logic and more flexibility and customization. Regarding this 90%, I was trying to stick to the DRY principle as much as I can. As long as controllers go, I have found resource_controller to really work, and I could get rid of all the controllers on that area, replacing them with a generic one. Now I'd like to know how to get the same with the views. On this app I have an overall, application.html.erb layout and then I must have another layout layer, common for all CRUD views and finally a "core" part: On index.html.erb all I need to generate a simple table with the fields and labels I indicate. For new and edit, also generic form edition, indicating labels and fields (with a possibility of providing custom fields if needed). I am not sure I will need show, but if I do it would be the same as new and edit. What plugins and tools (or even articles and general pointer) would help me to get that done? Thanks, Felipe.

    Read the article

  • string auto splitting in each loop - jquery

    - by sluggerdog
    I have the following jquery code that is looping through the returned json data, for some reason is it splitting the suburb by a space when being assigned as the value but not as the text, I cannot work out why this is happening. MY CODE $.each(data , function( index, obj ) { $.each(obj, function( key, value ) { var suburb = $.trim(value['mcdl01']); var number = $.trim(value['mcmcu']); $("#FeedbackBranchName").append("<option value=" + suburb + ">" + suburb + " (" + number + ")</option>"); }); }); SAMPLE RETURNED RESULTS <option **value="AIRLIE" beach=""**>AIRLIE BEACH (4440)</option> <option value="ASHMORE">ASHMORE (4431)</option> <option **value="BANYO" commercial=""**>BANYO COMMERCIAL (4432)</option> <option value="BEENLEIGH">BEENLEIGH (4413)</option> <option value="BERRIMAH">BERRIMAH (4453)</option> <option **value="BOWEN" hills=""**>BOWEN HILLS (4433)</option> Notice how for AIRLEE BEACH, BANYO COMMERICAL AND BOWN HILLS the second word has been separated out from the value attribute but it's fine at the text level. Anyone have any idea why this might happen? Thanks

    Read the article

  • Recursive code Sorting in VB

    - by Peter
    Ages old question: You have 2 hypothetical eggs, and a 100 story building to drop them from. The goal is to have the least number of guaranteed drops that will ensure you can find what floor the eggs break from the fall. You can only break 2 eggs. Using a 14 drop minimum method, I need help writing code that will allow me to calculate the following: Start with first drop attempt on 14th floor. If egg breaks then drop floors 1-13 to find the floor that causes break. ElseIf egg does not break then move up 13 floors to floor number 27 and drop again. If egg breaks then drop floors 15-26 starting on 15 working up to find the floor egg breaks on. ElseIf egg does not break then move up 12 floors to floor number 39 and drop again. etc. etc. The way this increases is as follows 14+13+12+11+10+9+8+7+6+5+4+3+2+1 So always adding to the previous value, by one less. I have never written a sorting algorithm before, and was curious how I might go about setting this up in a much more efficient way than a mile long of if then statements. My original idea was to store values for the floors in an array, and pull from that, using the index to move up or down and subtract or add to the variables. The most elegant solution would be a recursive function that handled this for any selected floor, 1-100, and ran the math, with an output that shows how many drops were needed in order to find that floor. Maximum is always 14, but some can be done in less.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Magento products will not show in category

    - by Aaron
    I've recently been tasked with the build and deployment of a large Ecommerce site. In the past we've had to use the clients legacy X-cart installation for redevelopment (too far integrated with their existing work flow). We'd heard good things about Magento, so I've set up a test install to get to grips with it. After a couple of initial issues, there is a live development site which displays categories on the default theme. The problem we've hit now is that products don't display..! After a lot more in-depth research into this, all I've been able to discover is that quite a number of developers endorse using other solutions entirely, with the other 50% saying after the steep learning curve the platform is as wonderful as we'd initially been led to believe. Now, my test category is showing, so I know this is configured properly. I've set up three test products and associated them with this (all done following the Magento user guide), checked double checked and thrice checked the products are enabled and visible individually, yet still the front end says the category has no products in it. I've cleared the cache repeatedly, reset everything possible many times in index management - no products show up. I have to make a call tomorrow morning on whether we're going ahead with Magento. If I can't even get it to show products I'm going to have to go with something with a more established track record and more community support available. Can anybody advise what could possibly be wrong here?

    Read the article

  • how to redirect user depending on user type at time of login (codeignitor)

    - by Anam Tahir
    im facing problem while redirecting my user according to its type. how can do it here's my code plz suggest how to do it. <?php if ( ! defined('BASEPATH')) exit('No direct script access allowed'); class VerifyLogin extends CI_Controller { function __construct() { parent::__construct(); } function index() { $this->load->model('user','',TRUE); //This method will have the credentials validation $this->load->library('form_validation'); $this->load->library('session'); $this->form_validation->set_rules('username', 'Username','trim|required|xss_clean'); $this->form_validation->set_rules('password', 'Password' 'trim|required|xss_clean|callback_check_database'); if($this->form_validation->run() == FALSE) { //Field validation failed.&nbsp; User redirected to login page validation_errors(); $this->load->view('error'); } else { //Go to private area basically here i want to redirect if user is admin then redirect to admin page else redirect to home how can i do this ??? redirect('home', 'refresh'); } } function check_database($password) { //Field validation succeeded.&nbsp; Validate against database $username = $this->input->post('username'); //query the database $result = $this->user->login($username, $password); if($result) { $sess_array = array(); foreach($result as $row) { $sess_array = array( 'id' => $row->id, 'username' => $row->username ); $this->session->set_userdata('logged_in', $sess_array); } return TRUE; } else { $this->form_validation->set_message('check_database', 'Invalid username or password'); return false; } } } ?>

    Read the article

  • How can I call `update_attribute` for a list item in rails then actually update the html using jquery?

    - by Patrick Connor
    I want my users to be able to mark one or more items from an index view as "Active" or "Inactive" using a link. The text for the link should be state aware - so it might default to "Mark as Active" if the corresponding attribute was false or null, and "Mark as Inactive" if true. Once the user clicks the link and the attribute is updated in the controller, the link-text should update based on the new state. I am WAY off here, but this is a small sample of the code I have been trying... CONTROLLER ... respond_to :html, :js ... def update @item = Item.find(params[:id]) if @item.update_attributes(params[:item]) #Not sure of how to respond to .js here end end ... update.js.erb #how do I identify which element to update? $('#item[13456]').html("State aware text for link_to") VIEW - for item in @items = item.name = link_to "Mark as Active", item_path(item), :method => :put, :remote => true. :id => "item[#{item.id}]" I am happy to read any APIs, blogs, tutorials, etc. I just can't seem to get my hands/mind around this task. Any help or guidance is greatly appreciated!

    Read the article

  • Have something loaded only when JList item is visibile

    - by elvencode
    Hello, i'm implementing a Jlist populated with a lot of elements. Each element corresponds to a image so i'd like to show a resized preview of them inside each row of the list. I've implemented a custom ImageCellRenderer extending the Jlabel and on getListCellRendererComponent i create the thumbnail if there'snt any for that element. Each row corresponds to a Page class where i store the path of the image and the icon applied to the JLabel. Each Page object is put inside a DefaultListModel to populate the JList. The render code is something like this: public Component getListCellRendererComponent( JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { Page page = (Page) value; if (page.getImgIcon() == null) { System.out.println(String.format("Creating thumbnail of %s", page.getImgFilename())); ImageIcon icon = new ImageIcon(page.getImgFilename()); int thumb_width = icon.getIconWidth() > icon.getIconHeight() ? 128 : ((icon.getIconWidth() * 128) / icon.getIconHeight()); int thumb_height = icon.getIconHeight() > icon.getIconWidth() ? 128 : ((icon.getIconHeight() * 128) / icon.getIconWidth()); icon.setImage(getScaledImage(icon.getImage(), thumb_width, thumb_height)); page.setImgIcon(icon); } setIcon(page.getImgIcon()); } I was thinking that only a certain item is visibile in the List the cell renderer is called but i'm seeing that all the thumnails are created when i add the Page object to the list model. I've tried to load the items and after set the model in the JList or set the model first and after starting appending the items but the results are the same. Is there any way to load the data only when necessary or do i need to create a custom control like a JScrollPanel with stacked items inside where i check myself the visibility of each elements? Thanks

    Read the article

  • Is there a better way to change user password in cakephp using Auth?

    - by sipiatti
    Hi, I am learning cakephp by myself. I tried to create a user controller with a changepassword function. It works, but I am not sure if this is the best way, and I could not googled up useful tutorials on this. Here is my code: class UsersController extends AppController { var $name = 'Users'; function login() { } function logout() { $this->redirect($this->Auth->logout()); } function changepassword() { $session=$this->Session->read(); $id=$session['Auth']['User']['id']; $user=$this->User->find('first',array('conditions' => array('id' => $id))); $this->set('user',$user); if (!empty($this->data)) { if ($this->Auth->password($this->data['User']['password'])==$user['User']['password']) { if ($this->data['User']['passwordn']==$this->data['User']['password2']) { // Passwords match, continue processing $data=$this->data; $this->data=$user; $this->data['User']['password']=$this->Auth->password($data['User']['passwordn']); $this->User->id=$id; $this->User->save($this->data); $this->Session->setFlash('Password changed.'); $this->redirect(array('controller'=>'Toners','action' => 'index')); } else { $this->Session->setFlash('New passwords differ.'); } } else { $this->Session->setFlash('Typed passwords did not match.'); } } } } password is the old password, passwordn is the new one, password2 is the new one retyped. Is there any other, more coomon way to do it in cake?

    Read the article

  • declarative_authorization permissions on roles

    - by William
    Hey all, I'm trying to add authorization to a rather large app that already exists, but I have to obfuscate the details a bit. Here's the background: In our app we have a number or roles that are hierarchical, roughly like this: BasicUser -> SuperUser -> Admin -> SuperAdmin For authorization each User model instance has an attribute 'role' which corresponds to the above. We have a RESTful controller "Users" that is namespaced under Backoffice. So in short it's Backoffice::UsersController. class Backoffice::UsersController < ApplicationController filter_access_to :all #... RESTful actions + some others end So here's the problem: We want users to be able to give permissions for users to edit users but ONLY if they have a 'smaller' role than they currently have. I've created the following in authorization_rules.rb authorization do role :basic_user do has_permission_on :backoffice_users, :to => :index end role :super_user do includes :basic_user has_permission_on :backoffice_users, :to => :edit do if_attribute :role => is_in { %w(basic_user) } end end role :admin do includes :super_user end role :super_admin do includes :admin end end And unfortunately that's as far as I got, the rule doesn't seem to get applied. If I comment the rule out, nobody can edit If I leave the rule in you can edit everybody I've also tried a couple of variations on the if_attribute: if_attribute :role => is { 'basic_user' } if_attribute :role => 'basic_user' and they get the same effect. Does anybody have any suggestions?

    Read the article

  • mongoose updating a field in a MongoDB not working

    - by Masiar
    I have this code var UserSchema = new Schema({ Username: {type: String, index: true}, Password: String, Email: String, Points: {type: Number, default: 0} }); [...] var User = db.model('User'); /* * Function to save the points in the user's account */ function savePoints(name, points){ if(name != "unregistered user"){ User.find({Username: name}, function(err, users){ var oldPoints = users[0].Points; var newPoints = oldPoints + points; User.update({name: name}, { $inc: {Points: newPoints}}, function(err){ if(err){ console.log("some error happened when update"); } else{ console.log("update successfull! with name = " + name); User.find({Username: name}, function(err, users) { console.log("updated : " + users[0].Points); }); } }); }); } } savePoints("Masiar", 666); I would like to update my user (by finding it with its name) by updating his/her points. I'm sure oldPoints and points contain a value, but still my user keep being at zero points. The console prints "update successful". What am I doing wrong? Sorry for the stupid / noob question. Masiar

    Read the article

  • Pointing to array element

    - by regular
    What I'm trying to achieve is say i have an array, i want to be able to modify a specific array element throughout my code, by pointing at it. for example in C++ i can do this int main(){ int arr [5]= {1,2,3,4,5}; int *c = &arr[3]; cout << arr[3] <<endl; *c = 0; cout << arr[3]<<endl; } I did some googling and there seems to be a way to do it through 'unsafe', but i don't really want to go that route. I guess i could create a variable to store the indexes, but I'm actually dealing with slightly more complexity (a list within a list. so having two index variables seems to add complexity to the code.) C# has a databinding class, so what I'm currently doing is binding the array element to a textbox (that i have hidden) and modifying that textbox whenever i want to modify the specific array element, but that's also not a good solution (since i have a textbox that's not being used for its intended purpose - a bit misleading).

    Read the article

  • grails question (sample 1 of Grails To Action book) problem with Controller and Service

    - by fegloff
    Hi, I'm doing Grails To Action sample for chapter one. Every was just fine until I started to work with Services. When I run the app I have the following error: groovy.lang.MissingPropertyException: No such property: quoteService for class: qotd.QuoteController at qotd.QuoteController$_closure3.doCall(QuoteController.groovy:14) at qotd.QuoteController$_closure3.doCall(QuoteController.groovy) at java.lang.Thread.run(Thread.java:619) Here is my groovie QuoteService class, which has an error within the definition of GetStaticQuote (ERROR: Groovy:unable to resolve class Quote) package qotd class QuoteService { boolean transactional = false def getRandomQuote() { def allQuotes = Quote.list() def randomQuote = null if (allQuotes.size() > 0) { def randomIdx = new Random().nextInt(allQuotes.size()) randomQuote = allQuotes[randomIdx] } else { randomQuote = getStaticQuote() } return randomQuote } def getStaticQuote() { return new Quote(author: "Anonymous",content: "Real Programmers Don't eat quiche") } } Controller groovie class package qotd class QuoteController { def index = { redirect(action: random) } def home = { render "<h1>Real Programmers do not each quiche!</h1>" } def random = { def randomQuote = quoteService.getRandomQuote() [ quote : randomQuote ] } def ajaxRandom = { def randomQuote = quoteService.getRandomQuote() render "<q>${randomQuote.content}</q>" + "<p>${randomQuote.author}</p>" } } Quote Class: package qotd class Quote { String content String author Date created = new Date() static constraints = { author(blank:false) content(maxSize:1000, blank:false) } } I'm doing the samples using Eclipse with grails addin. Any advice? Regards, Francisco

    Read the article

  • AJAX: Permission denied to access property in iframe

    - by Muhammad Sajid
    Hi I created an php website which uses for AJAX post and was live at http://sprook.com.au/ but my client change it's domain to http://www.sprookit.net/ from his service provider Godaddy and now the firebug says: Permission denied to access property 'stopAjax' here stopAjax is my method name. script is there: <div class="post_area"> <form action="post.php" method="post" id="addVideo" enctype="multipart/form-data" target="post" onsubmit="return startAjax(this);"> <iframe id="post" name="post" src="#" style="width:0;height:0;border:0px solid #fff;"></iframe> <table width="860" border="0" cellspacing="0" cellpadding="0"> <tr> <td width="435">POST YOUR AD FREE<br /> <em>Paste embed code from YouTube</em></td> <td width="322"><input type="text" id="videoLink" name="videoLink" class="input_textbox" /> </td> <td width="95"><input type="submit" name="set_video_link" id="set_video_link" value="" class="submt_post" /> </td> </tr> <tr> <td>&nbsp;</td> <td><div id="process"> Connecting please wait <img src="images/loading.gif" /><br/> </div></td> </tr> </table> </form> </div> And all content comes from old domain i removed index file and it stoped working, therefore it is cleared that scripts run from old domain.

    Read the article

  • Problem in UITableViewDelegate - RowSelected gives wrong NSIndexPath

    - by vlad259
    I have a UITableViewSource which I have subclassed. I'm overriding GetCell and using my own subclassed cells, like so: public override UITableViewCell GetCell(UITableView tableView, NSIndexPath indexPath) { MarketItem item=_tableItems[indexPath.Section].Items[indexPath.Row]; MarketCell cell=tableView.DequeueReusableCell(_cellIdentifier) as MarketCell; if (cell==null) { cell=new MarketCell(UITableViewCellStyle.Subtitle,_cellIdentifier,item); } // decorate the cell // ... return cell; } This works but when I get events in my UITableViewDelegate, the index path gets me the wrong cell (events like AccessoryButtonTapped, WillSelectRow etc). The Section and Row numbers look correct but when I do a tableView.CellAt(indexPath) I get the wrong cell. (The row and section numbers again look correct.) Things to note: The table is constantly being updated - items arrive in a different thread which are then InvokeOnMainThread'd Although the table is constantly updated, rows and sections are only added - nothing is re-ordered or deleted If I pause the updates when I get a 'WillSelectRow', it doesn't help Most interestingly (but not a shippable solution) if I make a new cell each time rather than doing DequeueReusableCell, it works correctly. I can't help thinking it's a stupid bug of my own making but can't find it. Any help would be most gratefully received!

    Read the article

  • jQuery preventing RedirectToAction from working?

    - by DaveDev
    I'm trying to redirect the user if they login successfully but the code I have on my page seems to be preventing the redirection from working. If I remove the jQuery below the redirection works. Can somebody tell me tell me if there's something I'm doing wrong? Thanks I have the following Action: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Login(User user) { var myErrors = new Dictionary<string, string>(); try { if (ModelState.IsValid) { if (userRepository.ValidUser(user)) { return RedirectToAction("Index", "Group", new {page = (int?)null}); } else { return Json("Username or password seems to be incorrect"); } } else { foreach (KeyValuePair<string, ModelState> keyValuePair in ViewData.ModelState) { if (keyValuePair.Value.Errors.Count > 0) { List<string> errors = new List<string>(); myErrors.Add(keyValuePair.Key, keyValuePair.Value.Errors[0].ErrorMessage); } } return Json(myErrors); } } catch (Exception) { return Json("Invalid"); } } and the following code on my page: <script language="javascript" type="text/javascript"> $(document).ready(function() { $("#SaveSuccess").hide(); $("#btnLogin").click(function() { $("form").submit(function(event) { var formData = $(this).serialize(); $.post($(this).attr("action"), formData, function(res) { ShowErrors(res); if (res == true) { $("#SaveSuccess").text("Saved"); } else { $("#divError").html(res); } $("#SaveSuccess").fadeIn(100); }, "json"); return false; }); }); }); </script>

    Read the article

  • How to handle duplicate values in d3.js

    - by Mario
    First I'm a d3.js noob :) How you can see from the title I've got a problem with duplicated data and aggregate the values is no option, because the name represent different bus stops. In this example maybe the stops are on the fron side and the back side of a building. And of course I like to show the names on the x-axis. If i created an example and the result is a bloody mess, see jsFiddel. x = index name = bus stop name n = value I've got a json e.g.: [{ "x": 0, "name": "Corniche St / Abu Dhabi Police GHQ", "n": 113 }, { "x": 1, "name": "Corniche St / Nation Towers", "n": 116 }, { "x": 2, "name": "Zayed 1st St / Al Khalidiya Public Garden", "n": 146 }, ... { "x": 49, "name": "Hamdan St / Tariq Bin Zeyad Mosque", "n": 55 }] The problem: It is possible that the name could appear more then once e.g. { "x": 1, "name": "Corniche St / Nation Towers", "n": 116 } and { "x": 4, "name": "Corniche St / Nation Towers", "n": 105 } I like to know is there a way to tell d3.js not to use distinct names and instead just show all names in sequence with their values. Any ideas or suggestions are very welcome :) If you need more information let me know. Thanks in advanced Mario

    Read the article

  • Can't unwrap Optional.None tableviewcell

    - by Mathew Padley
    I've a table view that has a custom table view cell in it. My problem is that when i try and assign a value to a variable in the custom table view cell I get the stated error. Now, I think its because the said variable is not initialised, but its got me completely stumped. This is the custom table cell: import Foundation import UIKit class LocationGeographyTableViewCell: UITableViewCell { //@IBOutlet var Map : MKMapView; @IBOutlet var AddressLine1 : UILabel; @IBOutlet var AddressLine2 : UILabel; @IBOutlet var County : UILabel; @IBOutlet var Postcode : UILabel; @IBOutlet var Telephone : UILabel; var location = VisitedLocation(); func Build(location:VisitedLocation) -> Void { self.location = location; AddressLine1.text = "test"; } } My cell for row at index path is: override func tableView(tableView: UITableView!, cellForRowAtIndexPath indexPath: NSIndexPath!) -> UITableViewCell! { var addressCell = tableView.dequeueReusableCellWithIdentifier("ContactDetail") as? LocationGeographyTableViewCell; if !addressCell { addressCell = LocationGeographyTableViewCell(style: UITableViewCellStyle.Value1, reuseIdentifier: "ContactDetail"); } addressCell!.Build(Location); return addressCell; } As I say I'm completely baffled, the Build function calls the correct function in the tableviewcell. Any help will be gratefully appreciated. Ta

    Read the article

  • What is the purpose of the Html "no-js" class?

    - by Swader
    I notice that in a lot of template engines, in the HTML5 Boilerplate, in various frameworks and in plain php sites there is the no-js class added onto the html element. Why is this done? Is there some sort of default browser behavior that reacts to this class? Why include it always? Does that not render the class itself obsolete, if there is no no-"no-js" case and html can be addressed directly? Here is an example from the HTML5 Boilerplate index.html: <!--[if lt IE 7 ]> <html lang="en" class="no-js ie6"> <![endif]--> <!--[if IE 7 ]> <html lang="en" class="no-js ie7"> <![endif]--> <!--[if IE 8 ]> <html lang="en" class="no-js ie8"> <![endif]--> <!--[if IE 9 ]> <html lang="en" class="no-js ie9"> <![endif]--> <!--[if (gt IE 9)|!(IE)]><!--> <html lang="en" class="no-js"> <!--<![endif]--> As you can see, the html element will always have this class. Can someone explain why this is done so often?

    Read the article

  • javascript watching for variable change via a timer

    - by DA
    I have a slide show where every 10 seconds the next image loads. Once an image loads, it waits 10 seconds (setTimeout) and then calls a function which fades it out, then calls the function again to fade in the next image. It repeats indefinitely. This works. However, at times, I'm going to want to over-ride this "function1 call - pause - function2 call - function1 call" loop outside of this function (for instance, I may click on a slide # and want to jump directly to that slide and cancel the current pause). One solution seems to be to set up a variable, allow other events to change that variable and then in my original function chain, check for any changes before continuing the loop. I have this set up: var ping = 500; var pausetime = 10000; for(i=0; i<=pausetime; i=i+ping){ setTimeout(function(){ console.log(gocheckthevariable()); console.log(i); pseudoIf('the variable is true AND the timer is done then...do the next thing') },i) } The idea is that I'd like to pause for 10 seconds. During this pause, every half second I'll check to see if this should be stopped. The above will write out to the console the following every half second: true 10000 true 10000 true 10000 etc... But what I want/need is this: true 0 true 500 true 1000 etc... The basic problem is that the for loop executes before each of the set timeouts. While I can check the value of the variable every half second, I can't match that against the current loop index. I'm sure this is a common issue, but I'm at a loss what I should actually be searching for.

    Read the article

  • Dice Emulation - ImageView

    - by Michelle Harris
    I am trying to emulate dice using ImageView. When I click the button, nothing seems to happen. I have hard coded this example to replace the image with imageView4 for debugging purposes (I was making sure the random wasn't fail). Can anyone point out what I am doing wrong? I am new to Java, Eclipse and Android so I'm sure I've probably made more than one mistake. Java: import java.util.Random; import android.app.Activity; import android.os.Bundle; import android.view.View; import android.widget.ArrayAdapter; import android.widget.ImageView; import android.widget.Spinner; import android.widget.Toast; public class Yahtzee4Activity extends Activity { /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); Spinner s = (Spinner) findViewById(R.id.spinner); ArrayAdapter adapter = ArrayAdapter.createFromResource( this, R.array.score_types, android.R.layout.simple_spinner_dropdown_item); adapter.setDropDownViewResource(android.R.layout.simple_spinner_dropdown_item); s.setAdapter(adapter); } public void onMyButtonClick(View view) { ImageView imageView1 = new ImageView(this); Random rand = new Random(); int rndInt = 4; //rand.nextInt(6) + 1; // n = the number of images, that start at index 1 String imgName = "die" + rndInt; int id = getResources().getIdentifier(imgName, "drawable", getPackageName()); imageView1.setImageResource(id); } } XML for the button: <Button android:id="@+id/button_roll" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/roll" android:onClick="onMyButtonClick" />

    Read the article

  • Dynamically loading external HTML in a div using Java Script

    - by user354051
    I have prepared some demo examples for the topic. There is page name "changelog.html" here: http://pantheon-studios.in/test/jquery/changelog.html This is working fine if loaded directly. I am trying to load this page dynamically into: http://pantheon-studios.in/test/jquery/index.html Here changelog.html doesn't behaving as expected. I think the init script on changelog.html is not getting executed or something else is happening when loading it dynamically. Like wise I do have couple of other pages using various jQuery and other java scripts plugins. Some of those needs initialization like animatedcollapse.js in the above example, and couple of them doesn't need initialization, you can directly call the script and go. I also gave a try using: jQuery.getScript("anim.js") after dynamically loading "changelog.html" but doesn't work. The "anim.js" contains animatedcollapse.addDiv('cat', 'fade=0,speed=400,group=pets,hide=1'); animatedcollapse.addDiv('dog', 'fade=0,speed=400,group=pets,hide=1'); animatedcollapse.addDiv('rabbit', 'fade=0,speed=400,group=pets,hide=1'); animatedcollapse.init(); I would really appreciate is some one point me out the right direction. I am completely new to web programming so please have some patience with me. Thanks

    Read the article

  • div with absolute position behind the normal flow

    - by vasion
    i am trying to get a div to be my background and am using absolute positioning to achieve it. everything works fine except for the fact that it appears above anything in the normal flow and fiddling with z-indexes does absolutely nothing. <div id="blind"> <div id="blindbackground"></div> <div id="blindcontainer"><div class="loader"><img class='loader' src="/img/loader.gif"/></div></div> <div id="blindclosecontainer"><img id='blindclose' src="/img/close.gif"/></div> </div> and this is the css: #blind{ position :absolute; width:100%; z-index: 2; border-bottom: 1px silver solid; } #blindclosecontainer{ text-align: right; } #blindbackground{ position:absolute; top:0; width:100%; height:100%; background-color: white; filter:alpha(opacity=60); opacity:0.6; } #blindcontainer{ margin:auto; width:500px; background-color: white; padding:10px; } .loader{ margin: auto; width:18px; margin-top:10px; margin-bottom: 5px; }

    Read the article

  • Cleaning up PHP Code

    - by Michael
    Hi, I've noticed I am a very sloppy coder and do things out of the ordinary. Can you take a look at my code and give me some tips on how to code more efficiently? What can I do to improve? session_start(); /check if the token is correct/ if ($_SESSION['token'] == $_GET['custom1']){ /*connect to db*/ mysql_connect('localhost','x','x') or die(mysql_error()); mysql_select_db('x'); /*get data*/ $orderid = mysql_real_escape_string($_GET['order_id']); $amount = mysql_real_escape_string($_GET['amount']); $product = mysql_real_escape_string($_GET['product1Name']); $cc = mysql_real_escape_string($_GET['Credit_Card_Number']); $length = strlen($cc); $last = 4; $start = $length - $last; $last4 = substr($cc, $start, $last); $ipaddress = mysql_real_escape_string($_GET['ipAddress']); $accountid = $_SESSION['user_id']; $credits = mysql_real_escape_string($_GET['custom3']); /*insert history into db*/ mysql_query("INSERT into billinghistory (orderid, price, description, credits, last4, orderip, accountid) VALUES ('$orderid', '$amount', '$product', '$credits', '$last4', '$ipaddress', '$accountid')"); /*add the credits to the users account*/ mysql_query("UPDATE accounts SET credits = credits + $credits WHERE user_id = '$accountid'"); /*redirect is successful*/ header("location: index.php?x=1"); }else{ /*something messed up*/ header("location: error.php"); }

    Read the article

  • in Rails, with check_box_tag, how do I keep the checkboxes checked after submitting query?

    - by Sebastien Paquet
    Ok, I know this is for the Saas course and people have been asking questions related to that as well but i've spent a lot of time trying and reading and I'm stuck. First of all, When you have a model called Movie, is it better to use Ratings as a model and associate them or just keep Ratings in an array floating in space(!). Second, here's what I have now in my controller: def index @movies = Movie.where(params[:ratings].present? ? {:rating => (params[:ratings].keys)} : {}).order(params[:sort]) @sort = params[:sort] @ratings = Ratings.all end Now, I decided to create a Ratings model since I thought It would be better. Here's my view: = form_tag movies_path, :method => :get do Include: - @ratings.each do |rating| = rating.rating = check_box_tag "ratings[#{rating.rating}]" = submit_tag "Refresh" I tried everything that is related to using a conditional ternary inside the checkbox tag ending with " .include?(rating) ? true : "" I tried everything that's supposed to work but it doesn't. I don't want the exact answer, I just need guidance.Thanks in advance!

    Read the article

< Previous Page | 448 449 450 451 452 453 454 455 456 457 458 459  | Next Page >