Search Results

Search found 12909 results on 517 pages for 'clustered index'.

Page 454/517 | < Previous Page | 450 451 452 453 454 455 456 457 458 459 460 461  | Next Page >

  • Converting "A* Search" code from C++ to Java [on hold]

    - by mr5
    Updated! I get this code from this site It's A* Search Algorithm(finding shortest path with heuristics) I modify most of variable names and some if conditions from the original version to satisfy my syntactic taste. It works in C++ (as I can't see any trouble with it) but fails in Java version. Java Code: String findPath(int startX, int startY, int finishX, int finishY) { @SuppressWarnings("unchecked") LinkedList<Node>[] nodeList = (LinkedList<Node>[]) new LinkedList<?>[2]; nodeList[0] = new LinkedList<Node>(); nodeList[1] = new LinkedList<Node>(); Node n0; Node m0; int nlIndex = 0; // queueList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = new Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[nlIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[nlIndex].isEmpty() ) { LinkedList<Node> pq = nodeList[nlIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = new Node( pq.peek().getX(), pq.peek().getY(), pq.peek().getIterCount(), pq.peek().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[nlIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions String path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; int c = '0' + ( j + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; path = (char)c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < Node.DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!(xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( gridMap.getData( ydy, xdx ) == GridMap.WALKABLE || gridMap.getData( ydy, xdx ) == GridMap.FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = new Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[nlIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; // replace the node // by emptying one queueList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while( !(nodeList[nlIndex].peek().getX() == xdx && nodeList[nlIndex].peek().getY() == ydy ) ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nodeList[nlIndex].pop(); // remove the wanted node // empty the larger size queueList to the smaller one if( nodeList[nlIndex].size() > nodeList[ 1 - nlIndex ].size() ) nlIndex = 1 - nlIndex; while( !nodeList[nlIndex].isEmpty() ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nlIndex = 1 - nlIndex; nodeList[nlIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output1: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Misleading path) Output2: Changing these lines: n0 = new Node( a, b, c, d ); m0 = new Node( e, f, g, h ); to n0.set( a, b, c, d ); m0.set( e, f, g, h ); I get (I'm really confused) C++ Code: std::string A_Star::findPath(int startX, int startY, int finishX, int finishY) { typedef std::queue<Node> List_Container; List_Container nodeList[2]; // list of open (not-yet-tried) nodes Node n0; Node m0; int pqIndex = 0; // nodeList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[pqIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[pqIndex].empty() ) { List_Container &pq = nodeList[pqIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = Node( pq.front().getX(), pq.front().getY(), pq.front().getIterCount(), pq.front().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[pqIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions std::string path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; char c = '0' + ( j + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; path = c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!( xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( pGrid->getData(ydy,xdx) == WALKABLE || pGrid->getData(ydy, xdx) == FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[pqIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; // replace the node // by emptying one nodeList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while ( !( nodeList[pqIndex].front().getX() == xdx && nodeList[pqIndex].front().getY() == ydy ) ) { nodeList[1 - pqIndex].push( nodeList[pqIndex].front() ); nodeList[pqIndex].pop(); } nodeList[pqIndex].pop(); // remove the wanted node // empty the larger size nodeList to the smaller one if( nodeList[pqIndex].size() > nodeList[ 1 - pqIndex ].size() ) pqIndex = 1 - pqIndex; while( !nodeList[pqIndex].empty() ) { nodeList[1-pqIndex].push(nodeList[pqIndex].front()); nodeList[pqIndex].pop(); } pqIndex = 1 - pqIndex; nodeList[pqIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Just right) From what I read about Java's documentation, I came up with the conclusion: C++'s std::queue<T>::front() == Java's LinkedList<T>.peek() Java's LinkedList<T>.pop() == C++'s std::queue<T>::front() + std::queue<T>::pop() What might I be missing in my Java version? In what way does it became different algorithmically from the C++ version?

    Read the article

  • Have something loaded only when JList item is visibile

    - by elvencode
    Hello, i'm implementing a Jlist populated with a lot of elements. Each element corresponds to a image so i'd like to show a resized preview of them inside each row of the list. I've implemented a custom ImageCellRenderer extending the Jlabel and on getListCellRendererComponent i create the thumbnail if there'snt any for that element. Each row corresponds to a Page class where i store the path of the image and the icon applied to the JLabel. Each Page object is put inside a DefaultListModel to populate the JList. The render code is something like this: public Component getListCellRendererComponent( JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { Page page = (Page) value; if (page.getImgIcon() == null) { System.out.println(String.format("Creating thumbnail of %s", page.getImgFilename())); ImageIcon icon = new ImageIcon(page.getImgFilename()); int thumb_width = icon.getIconWidth() > icon.getIconHeight() ? 128 : ((icon.getIconWidth() * 128) / icon.getIconHeight()); int thumb_height = icon.getIconHeight() > icon.getIconWidth() ? 128 : ((icon.getIconHeight() * 128) / icon.getIconWidth()); icon.setImage(getScaledImage(icon.getImage(), thumb_width, thumb_height)); page.setImgIcon(icon); } setIcon(page.getImgIcon()); } I was thinking that only a certain item is visibile in the List the cell renderer is called but i'm seeing that all the thumnails are created when i add the Page object to the list model. I've tried to load the items and after set the model in the JList or set the model first and after starting appending the items but the results are the same. Is there any way to load the data only when necessary or do i need to create a custom control like a JScrollPanel with stacked items inside where i check myself the visibility of each elements? Thanks

    Read the article

  • "Function object is unsubscriptable" in basic integer to string mapping function

    - by IanWhalen
    I'm trying to write a function to return the word string of any number less than 1000. Everytime I run my code at the interactive prompt it appears to work without issue but when I try to import wordify and run it with a test number higher than 20 it fails as "TypeError: 'function' object is unsubscriptable". Based on the error message, it seems the issue is when it tries to index numString (for example trying to extract the number 4 out of the test case of n = 24) and the compiler thinks numString is a function instead of a string. since the first line of the function is me defining numString as a string of the variable n, I'm not really sure why that is. Any help in getting around this error, or even just help in explaining why I'm seeing it, would be awesome. def wordify(n): # Convert n to a string to parse out ones, tens and hundreds later. numString = str(n) # N less than 20 is hard-coded. if n < 21: return numToWordMap(n) # N between 21 and 99 parses ones and tens then concatenates. elif n < 100: onesNum = numString[-1] ones = numToWordMap(int(onesNum)) tensNum = numString[-2] tens = numToWordMap(int(tensNum)*10) return tens+ones else: # TODO pass def numToWordMap(num): mapping = { 0:"", 1:"one", 2:"two", 3:"three", 4:"four", 5:"five", 6:"six", 7:"seven", 8:"eight", 9:"nine", 10:"ten", 11:"eleven", 12:"twelve", 13:"thirteen", 14:"fourteen", 15:"fifteen", 16:"sixteen", 17:"seventeen", 18:"eighteen", 19:"nineteen", 20:"twenty", 30:"thirty", 40:"fourty", 50:"fifty", 60:"sixty", 70:"seventy", 80:"eighty", 90:"ninety", 100:"onehundred", 200:"twohundred", 300:"threehundred", 400:"fourhundred", 500:"fivehundred", 600:"sixhundred", 700:"sevenhundred", 800:"eighthundred", 900:"ninehundred", } return mapping[num] if __name__ == '__main__': pass

    Read the article

  • CSS "Cover" - No scroll bars?

    - by Lynda
    I am using the cover property to create a background image that fills the background and resizes with the browser. But I run into one issue, the page has a lot of content and no scroll bars appear for me to scroll down! Here is the code I am using: body{ background: url(path.jpg) no-repeat center center fixed; -webkit-background-size: cover; -moz-background-size: cover; -o-background-size: cover; /* Cover for IE 7/8 */ filter: progid:DXImageTransform.Microsoft.AlphaImageLoader(src='path.jpg', sizingMethod='scale'); -ms-filter: progid:DXImageTransform.Microsoft.AlphaImageLoader(src='path.jpg', sizingMethod='scale'); /* End Cover for IE 7/8 */ background-size: cover; background-color: transparent !important; position:fixed; top: 0; left: 0; width: 100%; height:100%; max-width:2500px; max-height:1500px; z-index:1; } If I remove position:fixed; I get the scroll bars back but the background image disappears. What is the best way to tackle this and have both scroll bars and the background cover image? Note: I am using jQuery and would use a JS answer if it works (though I prefer a CSS only answer.)

    Read the article

  • Is there a better way to change user password in cakephp using Auth?

    - by sipiatti
    Hi, I am learning cakephp by myself. I tried to create a user controller with a changepassword function. It works, but I am not sure if this is the best way, and I could not googled up useful tutorials on this. Here is my code: class UsersController extends AppController { var $name = 'Users'; function login() { } function logout() { $this->redirect($this->Auth->logout()); } function changepassword() { $session=$this->Session->read(); $id=$session['Auth']['User']['id']; $user=$this->User->find('first',array('conditions' => array('id' => $id))); $this->set('user',$user); if (!empty($this->data)) { if ($this->Auth->password($this->data['User']['password'])==$user['User']['password']) { if ($this->data['User']['passwordn']==$this->data['User']['password2']) { // Passwords match, continue processing $data=$this->data; $this->data=$user; $this->data['User']['password']=$this->Auth->password($data['User']['passwordn']); $this->User->id=$id; $this->User->save($this->data); $this->Session->setFlash('Password changed.'); $this->redirect(array('controller'=>'Toners','action' => 'index')); } else { $this->Session->setFlash('New passwords differ.'); } } else { $this->Session->setFlash('Typed passwords did not match.'); } } } } password is the old password, passwordn is the new one, password2 is the new one retyped. Is there any other, more coomon way to do it in cake?

    Read the article

  • Why doesn't this PHP execute?

    - by cam
    I copied the code from this site exactly: http://davidwalsh.name/web-service-php-mysql-xml-json as follows, /* require the user as the parameter */ if(isset($_GET['user']) && intval($_GET['user'])) { /* soak in the passed variable or set our own */ $number_of_posts = isset($_GET['num']) ? intval($_GET['num']) : 10; //10 is the default $format = strtolower($_GET['format']) == 'json' ? 'json' : 'xml'; //xml is the default $user_id = intval($_GET['user']); //no default /* connect to the db */ $link = mysql_connect('localhost','username','password') or die('Cannot connect to the DB'); mysql_select_db('db_name',$link) or die('Cannot select the DB'); /* grab the posts from the db */ $query = "SELECT post_title, guid FROM wp_posts WHERE post_author = $user_id AND post_status = 'publish' ORDER BY ID DESC LIMIT $number_of_posts"; $result = mysql_query($query,$link) or die('Errant query: '.$query); /* create one master array of the records */ $posts = array(); if(mysql_num_rows($result)) { while($post = mysql_fetch_assoc($result)) { $posts[] = array('post'=>$post); } } /* output in necessary format */ if($format == 'json') { header('Content-type: application/json'); echo json_encode(array('posts'=>$posts)); } else { header('Content-type: text/xml'); echo '<posts>'; foreach($posts as $index => $post) { if(is_array($post)) { foreach($post as $key => $value) { echo '<',$key,'>'; if(is_array($value)) { foreach($value as $tag => $val) { echo '<',$tag,'>',htmlentities($val),'</',$tag,'>'; } } echo '</',$key,'>'; } } } echo '</posts>'; } /* disconnect from the db */ @mysql_close($link); } And the php doesn't execute, it just displays as plain text. What's the dealio? The host supports PHP, I use it to run a Wordpress blog and other things.

    Read the article

  • A little confused about MVC and where to put a database query

    - by jax
    OK, so my Joomla app is in MVC format. I am still a little confused about where to put certain operations, in the Controller or in the Model. This function below is in the controller, it gets called when &task=remove. Should the database stuff be in the Model? It does not seem to fit there because I have two models editapp (display a single application) and allapps (display all the applications), now which one would I put the delete operation in? /** * Delete an application */ function remove() { global $mainframe; $cid = JRequest::getVar( 'cid', array(), '', 'array' ); $db =& JFactory::getDBO(); //if there are items to delete if(count($cid)){ $cids = implode( ',', $cid ); $query = "DELETE FROM #__myapp_apps WHERE id IN ( $cids )"; $db->setQuery( $query ); if (!$db->query()){ echo "<script> alert('".$db->getErrorMsg()."');window.history.go(-1); </script>\n"; } } $mainframe->redirect( 'index.php?option=' . $option . '&c=apps'); } I am also confused about how the flow works. For example, there is a display() function in the controller that gets called by default. If I pass a task, does the display() function still run or does it go directly to the function name passed by $task?

    Read the article

  • Codeigniter only loads the default controller

    - by fh47331
    I am very new to CodeIgniter, but have been programming PHP for ages. I'm writing some software at the moment and using CI for the first time with it. The default controller is set to the first controller I want to action call 'login' (the controller is login.php, the view is login.php. When the form is submitted it calls the 'authenticate' controller. This executes fine, process the login data correctly and then does a redirect command (without any output to the screen prior) to the next page in this case 'newspage'. The problem is that the redirect, never reaches 'newspage' but the default controller runs again. It doesn't matter what I put ... ht tp://domain.name/anything ... (yes im using .htaccess to remove the index.php) the anything never gets called, just the default controller. I have left the standard 'welcome.php' controller and 'welcome_message.php' in the folders and even putting ht tp://domain.name/welcome all I get is the login screen! (Obviously there shouldn't be a space between the http - thats just done so it does not show as a hyperlink!) Can anyone tell me what i've done wrong!

    Read the article

  • odp.net SQL query retrieve set of rows from two input arrays.

    - by Karl Trumstedt
    I have a table with a primary key consisting of two columns. I want to retrieve a set of rows based on two input arrays, each corresponding to one primary key column. select pkt1.id, pkt1.id2, ... from PrimaryKeyTable pkt1, table(:1) t1, table(:2) t2 where pkt1.id = t1.column_value and pkt1.id2 = t2.column_value I then bind the values with two int[] in odp.net. This returns all different combinations of my resulting rows. So if I am expecting 13 rows I receive 169 rows (13*13). The problem is that each value in t1 and t2 should be linked. Value t1[4] should be used with t2[4] and not all the different values in t2. Using distinct solves my problem, but I'm wondering if my approach is wrong. Anyone have any pointers on how to solve this the best way? One way might be to use a for-loop accessing each index in t1 and t2 sequentially, but I wonder what will be more efficient. Edit: actually distinct won't solve my problem, it just did it based on my input-values (all values in t2 = 0)

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • grails question (sample 1 of Grails To Action book) problem with Controller and Service

    - by fegloff
    Hi, I'm doing Grails To Action sample for chapter one. Every was just fine until I started to work with Services. When I run the app I have the following error: groovy.lang.MissingPropertyException: No such property: quoteService for class: qotd.QuoteController at qotd.QuoteController$_closure3.doCall(QuoteController.groovy:14) at qotd.QuoteController$_closure3.doCall(QuoteController.groovy) at java.lang.Thread.run(Thread.java:619) Here is my groovie QuoteService class, which has an error within the definition of GetStaticQuote (ERROR: Groovy:unable to resolve class Quote) package qotd class QuoteService { boolean transactional = false def getRandomQuote() { def allQuotes = Quote.list() def randomQuote = null if (allQuotes.size() > 0) { def randomIdx = new Random().nextInt(allQuotes.size()) randomQuote = allQuotes[randomIdx] } else { randomQuote = getStaticQuote() } return randomQuote } def getStaticQuote() { return new Quote(author: "Anonymous",content: "Real Programmers Don't eat quiche") } } Controller groovie class package qotd class QuoteController { def index = { redirect(action: random) } def home = { render "<h1>Real Programmers do not each quiche!</h1>" } def random = { def randomQuote = quoteService.getRandomQuote() [ quote : randomQuote ] } def ajaxRandom = { def randomQuote = quoteService.getRandomQuote() render "<q>${randomQuote.content}</q>" + "<p>${randomQuote.author}</p>" } } Quote Class: package qotd class Quote { String content String author Date created = new Date() static constraints = { author(blank:false) content(maxSize:1000, blank:false) } } I'm doing the samples using Eclipse with grails addin. Any advice? Regards, Francisco

    Read the article

  • Show iPad keyboard on select, focus or always (jQuery)

    - by Ryan
    I have a web app that is using jQuery to replace the RETURN key with TAB so that when I user presses return the form is not submitted but rather the cursor moves to the next text field. This works in all browsers but only 1/2 works on the iPad. On the iPad the next field is highlighted but the keyboard is hidden. How can I keep the keyboard visible or force it somehow? Here's my code (thanks to http://thinksimply.com/blog/jquery-enter-tab): function checkForEnter (event) { if (event.keyCode == 13) { currentBoxNumber = textboxes.index(this); if (textboxes[currentBoxNumber + 1] != null) { nextBox = textboxes[currentBoxNumber + 1] nextBox.focus(); nextBox.select(); event.preventDefault(); return false; } } } Drupal.behaviors.formFields = function(context) { $('input[type="text"]').focus(function() { $(this).removeClass("idleField").addClass("focusField"); }); $('input[type="text"]').blur(function() { $(this).removeClass("focusField").addClass("idleField"); }); // replaces the enter/return key function with tab textboxes = $("input.form-text"); if ($.browser.mozilla) { $(textboxes).keypress (checkForEnter); } else { $(textboxes).keydown (checkForEnter); } };

    Read the article

  • How do I call +class methods in Objective C without referencing the class?

    - by TimM
    I have a series of "policy" objects which I thought would be convenient to implement as class methods on a set of policy classes. I have specified a protocol for this, and created classes to conform to (just one shown below) @protocol Counter +(NSInteger) countFor: (Model *)model; @end @interface CurrentListCounter : NSObject <Counter> +(NSInteger) countFor: (Model *)model; @end I then have an array of the classes that conform to this protocol (like CurrentListCounter does) +(NSArray *) availableCounters { return [[[NSArray alloc] initWithObjects: [CurrentListCounter class],[AllListsCounter class], nil] autorelease]; } Notice how I am using the classes like objects (and this might be my problem - in Smalltalk classes are objects like everything else - I'm not sure if they are in Objective-C?) My exact problem is when I want to call the method when I take one of the policy objects out of the array: id<Counter> counter = [[MyModel availableCounters] objectAtIndex: self.index]; return [counter countFor: self]; I get a warning on the return statement - it says -countFor: not found in protocol (so its assuming its an instance method where I want to call a class method). However as the objects in my array are instances of class, they are now like instance methods (or conceptually they should be). Is there a magic way to call class methods? Or is this just a bad idea and I should just create instances of my policy objects (and not use class methods)?

    Read the article

  • Geohashing - recursively find neighbors of neighbors

    - by itsme
    I am now looking for an elegant algorithm to recursively find neighbors of neighbors with the geohashing algorithm (http://www.geohash.org). Basically take a central geohash, and then get the first 'ring' of same-size hashes around it (8 elements), then, in the next step, get the next ring around the first etc. etc. Have you heard of an elegant way to do so? Brute force could be to take each neighbor and get their neighbors simply ignoring the massive overlap. Neighbors around one central geohash has been solved many times (here e.g. in Ruby: http://github.com/masuidrive/pr_geohash/blob/master/lib/pr_geohash.rb) Edit for clarification: Current solution, with passing in a center key and a direction, like this (with corresponding lookup-tables): def adjacent(geohash, dir) base, lastChr = geohash[0..-2], geohash[-1,1] type = (geohash.length % 2)==1 ? :odd : :even if BORDERS[dir][type].include?(lastChr) base = adjacent(base, dir) end base + BASE32[NEIGHBORS[dir][type].index(lastChr),1] end (extract from Yuichiro MASUI's lib) I say this approach will get ugly soon, because directions gets ugly once we are in ring two or three. The algorithm would ideally simply take two parameters, the center area and the distance from 0 being the center geohash only (["u0m"] and 1 being the first ring made of 8 geohashes of the same size around it (= [["u0t", "u0w"], ["u0q", "u0n"], ["u0j", "u0h"], ["u0k", "u0s"]]). two being the second ring with 16 areas around the first ring etc. Do you see any way to deduce the 'rings' from the bits in an elegant way?

    Read the article

  • OCaml delimiters and scopes

    - by Jack
    Hello! I'm learning OCaml and although I have years of experience with imperative programming languages (C, C++, Java) I'm getting some problems with delimiters between declarations or expressions in OCaml syntax. Basically I understood that I have to use ; to concatenate expressions and the value returned by the sequence will be the one of last expression used, so for example if I have exp1; exp2; exp3 it will be considered as an expression that returns the value of exp3. Starting from this I could use let t = something in exp1; exp2; exp3 and it should be ok, right? When am I supposed to use the double semicol ;;? What does it exactly mean? Are there other delimiters that I must use to avoid syntax errors? I'll give you an example: let rec satisfy dtmc state pformula = match (state, pformula) with (state, `Next sformula) -> let s = satisfy_each dtmc sformula and adder a state = let p = 0.; for i = 0 to dtmc.matrix.rows do p <- p +. get dtmc.matrix i state.index done; a +. p in List.fold_left adder 0. s | _ -> [] It gives me syntax error on | but I don't get why.. what am I missing? This is a problem that occurs often and I have to try many different solutions until it suddently works :/ A side question: declaring with let instead that let .. in will define a var binding that lasts whenever after it has been defined? What I basically ask is: what are the delimiters I have to use and when I have to use them. In addition are there differences I should consider while using the interpreter ocaml instead that the compiler ocamlc? Thanks in advance!

    Read the article

  • Magento products will not show in category

    - by Aaron
    I've recently been tasked with the build and deployment of a large Ecommerce site. In the past we've had to use the clients legacy X-cart installation for redevelopment (too far integrated with their existing work flow). We'd heard good things about Magento, so I've set up a test install to get to grips with it. After a couple of initial issues, there is a live development site which displays categories on the default theme. The problem we've hit now is that products don't display..! After a lot more in-depth research into this, all I've been able to discover is that quite a number of developers endorse using other solutions entirely, with the other 50% saying after the steep learning curve the platform is as wonderful as we'd initially been led to believe. Now, my test category is showing, so I know this is configured properly. I've set up three test products and associated them with this (all done following the Magento user guide), checked double checked and thrice checked the products are enabled and visible individually, yet still the front end says the category has no products in it. I've cleared the cache repeatedly, reset everything possible many times in index management - no products show up. I have to make a call tomorrow morning on whether we're going ahead with Magento. If I can't even get it to show products I'm going to have to go with something with a more established track record and more community support available. Can anybody advise what could possibly be wrong here?

    Read the article

  • Find Pythagorean triplet for which a + b + c = 1000

    - by Rahul
    A Pythagorean triplet is a set of three natural numbers, a < b < c, for which, a^(2) + b^(2) = c^(2) For example, 3^(2) + 4^(2) = 9 + 16 = 25 = 5^(2). There exists exactly one Pythagorean triplet for which a + b + c = 1000. Find the product abc. Source: http://projecteuler.net/index.php?section=problems&id=9 I tried but didn't know where my code went wrong. Here's my code in C: #include <stdio.h> void main() { int a, b, c; for (a = 0; a<=1000; a++) { for (b = 0; b<=1000; b++) { for (c = 0; c<=1000; c++) { if (((a^(2) + b^(2) == c^(2)) && ((a+b+c) ==1000))) printf("a=%d, b=%d, c=%d",a,b,c); } } } return 0; }

    Read the article

  • [LaTeX] positions of page numbers, position of chapter headings, chapters AND Table of Contents, Ref

    - by kaikanmonaco
    I am writing my PhD thesis (120+ pages) in latex, the deadline is approaching and I am struggling with layout problems. I am using the documentstyle book. I am posting both problems in this one thread because I am not sure if the solution might be related to both problems or not. Problems are: 1.) The page numbers are mostly located on the top-right of each page (this is correct and where I want them to be). However, only on the first page of chapters and on the first page of what I call "special chapters", the page number is located bottom-centered. With "special chapters" I mean: List of Contents, List of Figures, List of Tables, References, Index. My university will not accept the thesis like this. The page number must ALWAYS be top-right one each page, even if the page is the first page of a chapter or the first page of something like the List of Contents. How can I fix this? 2.) On the first page of chapters and "special chapters" (List of Contents...), the chapter title is located far too low on the page. This is the standard layout of LaTeX with documentstyle book I think. However, the chapter title must start at the very top of the page! I.e. the same height as the normal text on the pages that follow. I mean the chapter title, not the header. I.e., if there is a chapter called "Chapter 1 Dynamics of foobar under mechanical stress" then that text has to start from the top the page, but right now it starts several centimeters below the top. How can I fix this? Have tried all kinds of things to no effect, I'd be very thankful for a solution! Thanks.

    Read the article

  • Why does my floating div push around other divs?

    - by Meke
    I have a div which has a table which has a google map. I want to place a info box within the google map external to the map, just floating on top But I can't seem to get it right, the info div just pushes around the google map despite being on top of the map... CSS .google_map { height: 270px; width: 100%; } #flightMapInfo { position: relative; float: left; z-index: 100; color: #FFFFFF; top: 30px; left: 50px; background:#5a85a5; padding: 5px; -moz-border-radius: 10px; -webkit-border-radius: 10px; } div.tabContent { border: 1px solid #c9c3ba; padding: 0.5em; background-color: #f1f0ee; min-height: 300px; } .tableLeft { width: 75%; float: left; border-right: dotted 2px black; } HTML <div class="mapBlock tabContent"> <div id="flightMapInfo">WHARGL</div> <table class="tableLeft"> <tr><td><div id="flightMap" class="google_map"></div> </table></td></tr></div>

    Read the article

  • Error when trying to overwrite an image (it succeeds the first time after iis reset )

    - by Omu
    First time (after iis reset) I succeed to overwrite the image, but if I try again it gives me that GDI error this is my code: [HttpPost] public ActionResult Change() { var file = Request.Files["fileUpload"]; if (file.ContentLength > 0) { var filePath = @ConfigurationManager.AppSettings["storagePath"] + @"\Temp\" + User.Identity.Name + ".jpg"; using (var image = Image.FromStream(file.InputStream)) { var size = ResizeImage(image, filePath, 600, 480, true); return RedirectToAction("Crop", new CropDisplay {ImageWidth = size[0], ImageHeight = size[1]}); } } return RedirectToAction("Index"); } private int[] ResizeImage(Image image, string newFilePath, int newWidth, int maxHeight, bool onlyResizeIfWider) { ... using (var thumbnail = new Bitmap(newWidth, newHeight)) { using (var graphic = Graphics.FromImage(thumbnail)) { graphic.InterpolationMode = InterpolationMode.HighQualityBicubic; graphic.SmoothingMode = SmoothingMode.HighQuality; graphic.PixelOffsetMode = PixelOffsetMode.HighQuality; graphic.CompositingQuality = CompositingQuality.HighQuality; graphic.DrawImage(image, 0, 0, newWidth, newHeight); var info = ImageCodecInfo.GetImageEncoders(); var encoderParameters = new EncoderParameters(1); encoderParameters.Param[0] = new EncoderParameter(Encoder.Quality, 100L); //this is where I get the GDI error thumbnail.Save(newFilePath, info[1], encoderParameters); return new[] { newWidth, newHeight }; } } }

    Read the article

  • Added CAGradientLayer, getting this in my UIView dealloc: [CALayer release]: message sent to deallocated instance

    - by developerdoug
    Here there, I have a custom UIView. This view acts as a activity indicator but as label above the UIActivityIndicatorView. In the init, I add a CAGradientLayer. I allocate and initialize it and insert it at index 0 as a sublayer of the UIView layer property. In my dealloc method was called, I received a message in the console: - [CALayer release]: message sent to deallocated instance. My code: @interface LabelActivityIndicatorView () { UILabel *_label; UIActivityIndicatorView *_activityIndicatorView; CAGradientLayer *_gradientLayer; } @end @implementation LabelActivityIndicatorView //dealloc - (void) dealloc { [_label release]; [_activityIndicatorView release]; //even tried to remove the layer [_gradientLayer removeFromSuperLayer]; [_gradientLayer release]; [super dealloc]; } // init - (id) initWithFrame:(CGRect)frame { if ( (self = [super initWithFrame:frame]) ) { // init the label // init the gradient layer _gradientLayer = [[CAGradientLayer alloc] init]; [_gradientLayer setBounds:[self bounds]]; [_gradientLayer setPosition:CGPointMake(frame.size.width/2, frame.size.height/2)]; [[self layer] insertSublayer:_gradientLayer atIndex:0]; [[self layer] setNeedsDisplay]; } return self; } @end Anyone have any ideas. Since I'm allocating and initializing the gradient layer I'm responsible for releasing it. I should be able to alloc and init and assign to some ivar. Perhaps I should create a property with retain on it. Thanks,

    Read the article

  • one-to-many with criteria question

    - by brnzn
    enter code hereI want to apply restrictions on the list of items, so only items from a given dates will be retrieved. Here are my mappings: <class name="MyClass" table="MyTable" mutable="false" > <cache usage="read-only"/> <id name="myId" column="myId" type="integer"/> <property name="myProp" type="string" column="prop"/> <list name="items" inverse="true" cascade="none"> <key column="myId"/> <list-index column="itemVersion"/> <one-to-many class="Item"/> </list> </class> <class name="Item" table="Items" mutable="false" > <cache usage="read-only"/> <id name="myId" column="myId" type="integer"/> <property name="itemVersion" type="string" column="version"/> <property name="startDate" type="date" column="startDate"/> </class> I tried this code: Criteria crit = session.createCriteria(MyClass.class); crit.add( Restrictions.eq("myId", new Integer(1))); crit = crit.createCriteria("items").add( Restrictions.le("startDate", new Date()) ); which result the following quires: select ... from MyTable this_ inner join Items items1_ on this_.myId=items1_.myId where this_.myId=? and items1_.startDate<=? followed by select ... from Items items0_ where items0_.myId=? But what I need is something like: select ... from MyTable this_ where this_.myId=? followed by select ... from Items items0_ where items0_.myId=? and items0_.startDate<=? Any idea how I can apply a criteria on the list of items?

    Read the article

  • No event is firing when placing a custom data bound control in DataRepeater control in Windows forms

    - by Remo
    Hi, Custom events in a custom data bound control are not firing in DataRepeater control. When I debug it I found that the DataRepeater Control recreates the control using Activator.CreateInstance and Copies the Properties and Events. In my case copying events doesn't copy the custom events that I hooked in. For example public class MyClass : Control { public event EventHandler MyEvent; protected virtual void OnMyEvent() { if(this.MyEvent != null) { this.MyEvent(this,EventArgs.Empty); } } private int selectedIndex= -1; public int SelectedIndex { get { return this.selectedIndex; } set { if(this.selectedIndex != value) { this.selectedIndex = value; this.OnMyEvent(); } } } // // DataBinding stuff goes here // } public Form1() { InitialiseComponent(); ArrayList list = new ArrayList(); list.Add("one"); this.dataRepeater1.DataSource = list; // One Repeater MyClass test = new Myclass(); test.DataSource = GetDataTable(); this.dataRepeater1.ItemTemplate.Controls.Add(test); test.MyEvent +=new EventHandler(test_MyEvent); } // This Event should fire when selected index of Datatable is changed and is firing when placed directly in the form and not firing when place in DataRepeater control/////////////////////// private void test_MyEvent(object sender, EventArgss e) { // This event is not fired/////////////////////// } private DataTable GetDataTable() { ..// Create a data Table and return } Any help Appreciated. Thanks,

    Read the article

  • get path of Array (PHP)

    - by Kawah Grafis
    i have an array input like this .. Array ( [0] => Array ( [0] => 42 ) [**42**] => Array ( [0] => 12 [1] => 14 ) [**14**] => Array ( [0] => 317 ) [317] => Array ( [0] => 319 ) [**12**] => Array ( [0] => 306 [1] => 307 ) [307] => Array ( [0] => 311 ) [306] => Array ( [0] => 309 ) ) and i want to get result array like bellow : $paths[]=array(42,12,306,309); $paths[]=array(42,12,307,311); $paths[]=array(42,14,317,319); see array input root in array input = 42 (index of array 0) 42 have child = 12, 14 12 have child = 306, 307 14 have child = 317 306 have child = 309 307 have child = 311 317 have child = 319 like this.. and output array insert into $paths $paths[0]=array(42,12,306,309); $paths[1]=array(42,12,307,311); $paths[2]=array(42,14,317,319);

    Read the article

  • Rails routing of a controller's functions query

    - by Jty.tan
    So I've got a Users controller, and it has (amongst others) a function called details. The idea is that a user can go to localhost:3000/user/:user_id/details and be able to view the details of :user_id. For example, I have a user called "tester". When I go to the uri: http://localhost:3000/users/tester/details I'd want the details function to be called up, to render the details view, and to display the information for the user tester. But instead I get an error saying that No action responded to tester. Actions: change_password, create, current_user, details, forgot_password, index, login_required, new, redirect_to_stored, show, and update_attributes And I understand that to basically mean that if I wanted to access details, I should really be using http://localhost:3000/users/details Except that that isn't really working either... .< That is instead bringing me to http://localhost:3000/users/details/registries (which is the default path that I'd stipulated for anybody trying to view users/:user_id, so again, that's working the way I wanted it to) Point is: Can anybody help and tell me how I can go about getting users/:user_id/details to work the way I want it to and display the details of :user_id? Thanks!

    Read the article

< Previous Page | 450 451 452 453 454 455 456 457 458 459 460 461  | Next Page >