Search Results

Search found 12857 results on 515 pages for 'spatial index'.

Page 452/515 | < Previous Page | 448 449 450 451 452 453 454 455 456 457 458 459  | Next Page >

  • OCaml delimiters and scopes

    - by Jack
    Hello! I'm learning OCaml and although I have years of experience with imperative programming languages (C, C++, Java) I'm getting some problems with delimiters between declarations or expressions in OCaml syntax. Basically I understood that I have to use ; to concatenate expressions and the value returned by the sequence will be the one of last expression used, so for example if I have exp1; exp2; exp3 it will be considered as an expression that returns the value of exp3. Starting from this I could use let t = something in exp1; exp2; exp3 and it should be ok, right? When am I supposed to use the double semicol ;;? What does it exactly mean? Are there other delimiters that I must use to avoid syntax errors? I'll give you an example: let rec satisfy dtmc state pformula = match (state, pformula) with (state, `Next sformula) -> let s = satisfy_each dtmc sformula and adder a state = let p = 0.; for i = 0 to dtmc.matrix.rows do p <- p +. get dtmc.matrix i state.index done; a +. p in List.fold_left adder 0. s | _ -> [] It gives me syntax error on | but I don't get why.. what am I missing? This is a problem that occurs often and I have to try many different solutions until it suddently works :/ A side question: declaring with let instead that let .. in will define a var binding that lasts whenever after it has been defined? What I basically ask is: what are the delimiters I have to use and when I have to use them. In addition are there differences I should consider while using the interpreter ocaml instead that the compiler ocamlc? Thanks in advance!

    Read the article

  • using facelet1.1.15 (external facelet) in JSF2

    - by Odelya
    Hi! I have upgrated to JSF2 but still running with facelet1.1.15. I have these parameters in web.xml: <context-param> <param-name>org.ajax4jsf.VIEW_HANDLERS</param-name> <param-value>com.sun.facelets.FaceletViewHandler</param-value> </context-param> <context-param> <param-name>javax.faces.DISABLE_FACELET_JSF_VIEWHANDLER</param-name> <param-value>true</param-value> </context-param> I am trying to create my own componet step by step of this example : http://www.ibm.com/developerworks/java/library/j-jsf2fu2/index.html#tip3 everything looks fine but i get an error that it doesn't recognize the tag. Has it got to do with the facelet 1.1.15? and it works only with VDL? it there a way to use 1.1.15 and custom components in JSF2? As well - I use tomcat 6

    Read the article

  • get path of Array (PHP)

    - by Kawah Grafis
    i have an array input like this .. Array ( [0] => Array ( [0] => 42 ) [**42**] => Array ( [0] => 12 [1] => 14 ) [**14**] => Array ( [0] => 317 ) [317] => Array ( [0] => 319 ) [**12**] => Array ( [0] => 306 [1] => 307 ) [307] => Array ( [0] => 311 ) [306] => Array ( [0] => 309 ) ) and i want to get result array like bellow : $paths[]=array(42,12,306,309); $paths[]=array(42,12,307,311); $paths[]=array(42,14,317,319); see array input root in array input = 42 (index of array 0) 42 have child = 12, 14 12 have child = 306, 307 14 have child = 317 306 have child = 309 307 have child = 311 317 have child = 319 like this.. and output array insert into $paths $paths[0]=array(42,12,306,309); $paths[1]=array(42,12,307,311); $paths[2]=array(42,14,317,319);

    Read the article

  • Converting "A* Search" code from C++ to Java [on hold]

    - by mr5
    Updated! I get this code from this site It's A* Search Algorithm(finding shortest path with heuristics) I modify most of variable names and some if conditions from the original version to satisfy my syntactic taste. It works in C++ (as I can't see any trouble with it) but fails in Java version. Java Code: String findPath(int startX, int startY, int finishX, int finishY) { @SuppressWarnings("unchecked") LinkedList<Node>[] nodeList = (LinkedList<Node>[]) new LinkedList<?>[2]; nodeList[0] = new LinkedList<Node>(); nodeList[1] = new LinkedList<Node>(); Node n0; Node m0; int nlIndex = 0; // queueList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = new Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[nlIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[nlIndex].isEmpty() ) { LinkedList<Node> pq = nodeList[nlIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = new Node( pq.peek().getX(), pq.peek().getY(), pq.peek().getIterCount(), pq.peek().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[nlIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions String path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; int c = '0' + ( j + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; path = (char)c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < Node.DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!(xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( gridMap.getData( ydy, xdx ) == GridMap.WALKABLE || gridMap.getData( ydy, xdx ) == GridMap.FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = new Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[nlIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; // replace the node // by emptying one queueList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while( !(nodeList[nlIndex].peek().getX() == xdx && nodeList[nlIndex].peek().getY() == ydy ) ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nodeList[nlIndex].pop(); // remove the wanted node // empty the larger size queueList to the smaller one if( nodeList[nlIndex].size() > nodeList[ 1 - nlIndex ].size() ) nlIndex = 1 - nlIndex; while( !nodeList[nlIndex].isEmpty() ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nlIndex = 1 - nlIndex; nodeList[nlIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output1: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Misleading path) Output2: Changing these lines: n0 = new Node( a, b, c, d ); m0 = new Node( e, f, g, h ); to n0.set( a, b, c, d ); m0.set( e, f, g, h ); I get (I'm really confused) C++ Code: std::string A_Star::findPath(int startX, int startY, int finishX, int finishY) { typedef std::queue<Node> List_Container; List_Container nodeList[2]; // list of open (not-yet-tried) nodes Node n0; Node m0; int pqIndex = 0; // nodeList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[pqIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[pqIndex].empty() ) { List_Container &pq = nodeList[pqIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = Node( pq.front().getX(), pq.front().getY(), pq.front().getIterCount(), pq.front().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[pqIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions std::string path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; char c = '0' + ( j + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; path = c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!( xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( pGrid->getData(ydy,xdx) == WALKABLE || pGrid->getData(ydy, xdx) == FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[pqIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; // replace the node // by emptying one nodeList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while ( !( nodeList[pqIndex].front().getX() == xdx && nodeList[pqIndex].front().getY() == ydy ) ) { nodeList[1 - pqIndex].push( nodeList[pqIndex].front() ); nodeList[pqIndex].pop(); } nodeList[pqIndex].pop(); // remove the wanted node // empty the larger size nodeList to the smaller one if( nodeList[pqIndex].size() > nodeList[ 1 - pqIndex ].size() ) pqIndex = 1 - pqIndex; while( !nodeList[pqIndex].empty() ) { nodeList[1-pqIndex].push(nodeList[pqIndex].front()); nodeList[pqIndex].pop(); } pqIndex = 1 - pqIndex; nodeList[pqIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Just right) From what I read about Java's documentation, I came up with the conclusion: C++'s std::queue<T>::front() == Java's LinkedList<T>.peek() Java's LinkedList<T>.pop() == C++'s std::queue<T>::front() + std::queue<T>::pop() What might I be missing in my Java version? In what way does it became different algorithmically from the C++ version?

    Read the article

  • No event is firing when placing a custom data bound control in DataRepeater control in Windows forms

    - by Remo
    Hi, Custom events in a custom data bound control are not firing in DataRepeater control. When I debug it I found that the DataRepeater Control recreates the control using Activator.CreateInstance and Copies the Properties and Events. In my case copying events doesn't copy the custom events that I hooked in. For example public class MyClass : Control { public event EventHandler MyEvent; protected virtual void OnMyEvent() { if(this.MyEvent != null) { this.MyEvent(this,EventArgs.Empty); } } private int selectedIndex= -1; public int SelectedIndex { get { return this.selectedIndex; } set { if(this.selectedIndex != value) { this.selectedIndex = value; this.OnMyEvent(); } } } // // DataBinding stuff goes here // } public Form1() { InitialiseComponent(); ArrayList list = new ArrayList(); list.Add("one"); this.dataRepeater1.DataSource = list; // One Repeater MyClass test = new Myclass(); test.DataSource = GetDataTable(); this.dataRepeater1.ItemTemplate.Controls.Add(test); test.MyEvent +=new EventHandler(test_MyEvent); } // This Event should fire when selected index of Datatable is changed and is firing when placed directly in the form and not firing when place in DataRepeater control/////////////////////// private void test_MyEvent(object sender, EventArgss e) { // This event is not fired/////////////////////// } private DataTable GetDataTable() { ..// Create a data Table and return } Any help Appreciated. Thanks,

    Read the article

  • How to start matching and saving matched from exact point in a text

    - by yuliya
    I have a text and I write a parser for it using regular expressions and perl. I can match what I need with two empty lines (I use regexp), because there is a pattern that allows recognize blocks of text after two empty lines. But the problem is that the whole text has Introduction part and some text in the end I do not need. Here is a code which matches text when it finds two empty lines #!/usr/bin/perl use strict; use warnings; my $file = 'first'; open(my $fh, '<', $file); my $empty = 0; my $block_num = 1; open(OUT, '>', $block_num . '.txt'); while (my $line = <$fh>) { chomp ($line); if ($line =~ /^\s*$/) { $empty++; } elsif ($empty == 2) { close(OUT); open(OUT, '>', ++$block_num . '.txt'); $empty = 0; } else { $empty = 0;} print OUT "$line\n"; } close(OUT); This is example of the text I need (it's really small :)) this is file example I think that I need to iterate over the text till the moment it will find the word LOREM IPSUM with regexps this kind "/^LOREM IPSUM/", because it is the point from which needed text starts(and save the text in one file when i reach the word). And I need to finish iterating over the text when INDEX word is fount or save the text in separate file. How could I implement it. Should I use next function to proceed with lines or what? BR, Yuliya

    Read the article

  • Why does my floating div push around other divs?

    - by Meke
    I have a div which has a table which has a google map. I want to place a info box within the google map external to the map, just floating on top But I can't seem to get it right, the info div just pushes around the google map despite being on top of the map... CSS .google_map { height: 270px; width: 100%; } #flightMapInfo { position: relative; float: left; z-index: 100; color: #FFFFFF; top: 30px; left: 50px; background:#5a85a5; padding: 5px; -moz-border-radius: 10px; -webkit-border-radius: 10px; } div.tabContent { border: 1px solid #c9c3ba; padding: 0.5em; background-color: #f1f0ee; min-height: 300px; } .tableLeft { width: 75%; float: left; border-right: dotted 2px black; } HTML <div class="mapBlock tabContent"> <div id="flightMapInfo">WHARGL</div> <table class="tableLeft"> <tr><td><div id="flightMap" class="google_map"></div> </table></td></tr></div>

    Read the article

  • Echoing users by group name in PHP

    - by BobSapp
    What I want to do is click a name of a group(every group what I create other than poweruser and admin groups) and that will echo all of the users in that group from the database. I have figured out the code so far but now my problem is how will I print it all out when clicking the name of the group? My code so far is: <h3>Groups</h3> <?php include('db.php'); if (isset($_GET["groupID"])) { $sql="SELECT `group`.*, `user`.* FROM `user` inner join `group` on group.groupID=user.groupID where group.groupID= " . mysql_real_escape_string($_GET["groupID"]) ; } else { $sql="SELECT * FROM `group` WHERE groupName <> 'admin' AND groupName <> 'poweruser'" ; } $result=mysql_query($sql,$connection); while($line=mysql_fetch_array($result)){ echo "<a href='index.php?page=groups&group=".$line['groupID']."'>".$line['groupName'].'</a><br />'; } mysql_free_result($result); mysql_close($connection); ?>

    Read the article

  • datepicker not working in chrome

    - by DotnetSparrow
    I have a Jquery UI datepicker control in my asp.net MVC application and it works fine in IE and Firefox but it doens't work in chrome when I click the datepicker button. Here is my Index view: $(function() { $('#datepicker').datepicker({ changeMonth: true, dateFormat: "dd M yy", changeYear: true, showButtonPanel: true, autoSize: true, altField: "input#txtDate", onSelect: function(dateText, inst) { $.ajax({ type: "POST", url: "/LiveGame/Partial3?gameDate=" + dateText, dataType: "html", success: function(result) { var domElement = $(result); $("#dvGames").html(domElement); } }); } }); $("#txtDate").val($.format.date(new Date(), 'dd MMM yyyy')); $('#dvGames').load( '<%= Url.Action("Partial3", "LiveGame") %>', { gameDate: $("#txtDate").val() } ); }); Here is my partial: public ActionResult Partial3(string gameDate) { return PartialView("Partial3", gameDate); } <div id="dvGames" class="cornerdate1"> <%= Url.Action("LiveGame","Partial3") %> </div> <input type="text" id="txtDate" name="txtDate" readonly="readonly" class="cornerdate" /> <input id="datepicker" class="cornerimage" type="image" src="../../Content/images/calendar.gif" alt="date" /> </div>

    Read the article

  • jquery tabbed interface breaks when using images

    - by Steve
    hello all, using jquery to create a tabbed interface. coding is quite typical: html: <div id="tabbed-interface"> <ul> <li><a href="#option1">Option1</a></li> <li><a href="#option2">Option2</a></li> <li><a href="#option3">Option3</a></li> </ul> </div> jquery: $(document).ready(function(){ $('#tabbed-interface li:first').addClass('active'); $('#tabbed-interface div').not(':first').hide(); $('#tabbed-interface>ul>li>a').click(function(event){ $('#tabbed-interface>ul>li').removeClass('active'); $(event.target).parent().addClass('active'); $('#tabbed-interface>div').fadeOut().filter(this.hash).fadeIn(250); return false;});}); css: ul li {background: #232323; list-style: none; border: 1px solid #616161; } ul li.active {background: none; list-style: none; border: 1px solid: #616161; border-bottom: 1px solid #121212; z-index: 1; } as you can see, all this does is add the class 'active' to the li that is clicked, and this corresponds to whether a background is shown or not. this works perfectly with text, but i am required to use non standard fonts. when i try to side step the issue using transparent .png images, it is unreliable. For instance, changing the HTML to: <div id="tabbed-interface"> <ul> <li><a href="#option1"><img src="option1.png" /></a></li>

    Read the article

  • Issue with transparent texture on 3D primitive, XNA 4.0

    - by Bevin
    I need to draw a large set of cubes, all with (possibly) unique textures on each side. Some of the textures also have parts of transparency. The cubes that are behind ones with transparent textures should show through the transparent texture. However, it seems that the order in which I draw the cubes decides if the transparency works or not, which is something I want to avoid. Look here: cubeEffect.CurrentTechnique = cubeEffect.Techniques["Textured"]; Block[] cubes = new Block[4]; cubes[0] = new Block(BlockType.leaves, new Vector3(0, 0, 3)); cubes[1] = new Block(BlockType.dirt, new Vector3(0, 1, 3)); cubes[2] = new Block(BlockType.log, new Vector3(0, 0, 4)); cubes[3] = new Block(BlockType.gold, new Vector3(0, 1, 4)); foreach(Block b in cubes) { b.shape.RenderShape(GraphicsDevice, cubeEffect); } This is the code in the Draw method. It produces this result: As you can see, the textures behind the leaf cube are not visible on the other side. When i reverse index 3 and 0 on in the array, I get this: It is clear that the order of drawing is affecting the cubes. I suspect it may have to do with the blend mode, but I have no idea where to start with that.

    Read the article

  • one-to-many with criteria question

    - by brnzn
    enter code hereI want to apply restrictions on the list of items, so only items from a given dates will be retrieved. Here are my mappings: <class name="MyClass" table="MyTable" mutable="false" > <cache usage="read-only"/> <id name="myId" column="myId" type="integer"/> <property name="myProp" type="string" column="prop"/> <list name="items" inverse="true" cascade="none"> <key column="myId"/> <list-index column="itemVersion"/> <one-to-many class="Item"/> </list> </class> <class name="Item" table="Items" mutable="false" > <cache usage="read-only"/> <id name="myId" column="myId" type="integer"/> <property name="itemVersion" type="string" column="version"/> <property name="startDate" type="date" column="startDate"/> </class> I tried this code: Criteria crit = session.createCriteria(MyClass.class); crit.add( Restrictions.eq("myId", new Integer(1))); crit = crit.createCriteria("items").add( Restrictions.le("startDate", new Date()) ); which result the following quires: select ... from MyTable this_ inner join Items items1_ on this_.myId=items1_.myId where this_.myId=? and items1_.startDate<=? followed by select ... from Items items0_ where items0_.myId=? But what I need is something like: select ... from MyTable this_ where this_.myId=? followed by select ... from Items items0_ where items0_.myId=? and items0_.startDate<=? Any idea how I can apply a criteria on the list of items?

    Read the article

  • Javascript/Jquery pop-up window in Asp.Net MVC4

    - by Mark
    Below I have a "button" (just a span with an icon) that creates a pop-up view of a div in my application to allow users to compare information in seperate windows. However, I get and Asp.Net Error as follows: **Server Error in '/' Application. The resource cannot be found. Requested URL: /Home/[object Object]** Does anyone have an Idea of why this is happending? Below is my code: <div class="module_actions"> <div class="actions"> <span class="icon-expand2 pop-out"></span> </div> </div> <script> $(document).ajaxSuccess(function () { var Clone = $(".pop-out").click(function () { $(this).parents(".module").clone().appendTo("#NewWindow"); }); $(".pop-out").click(function popitup(url) { LeftPosition = (screen.width) ? (screen.width - 400) / 1 : 0; TopPosition = (screen.height) ? (screen.height - 700) / 1 : 0; var sheight = (screen.height) * 0.5; var swidth = (screen.width) * 0.5; settings = 'height=' + sheight + ',width=' + swidth + ',top=' + TopPosition + ',left=' + LeftPosition + ',scrollbars=yes,resizable=yes,toolbar=no,status=no,menu=no, directories=no,titlebar=no,location=no,addressbar=no' newwindow = window.open(url, '/Index', settings); if (window.focus) { newwindow.focus() } return false; }); });

    Read the article

  • Why cant Git merge file changes with a modified parent/master.

    - by Andy
    I have a file with one line in it. I create a branch and add a second line to the same file. Save and commit to the branch. I switch back to the master. And add a different, second line to the file. Save and commit to the master. So there's now 3 unique lines in total. If I now try and merge the branch back to the master, it suffers a merge conflict. Why cant Git simple merge each line, one after the other? My attempt at merge behaves something like this: PS D:\dev\testing\test1> git merge newbranch Auto-merging hello.txt CONFLICT (content): Merge conflict in hello.txt Automatic merge failed; fix conflicts and then commit the result. PS D:\dev\testing\test1> git diff diff --cc hello.txt index 726eeaf,e48d31a..0000000 --- a/hello.txt +++ b/hello.txt @@@ -1,2 -1,2 +1,6 @@@ This is the first line. - New line added by master. -Added a line in newbranch. ++<<<<<<< HEAD ++New line added by master. ++======= ++Added a line in newbranch. ++>>>>>>> newbranch Is there a way to make it slot lines in automatically, one after the other?

    Read the article

  • qTip pop ups come in from top left of screen (on first load)

    - by franko75
    Hi, not sure if i'm set things up incorrectly - I don't seem to see anyone else with this problem, but my qTip popups (all ajax loaded content) are loading quite erratically, in that they are often animating in from off screen before appearing in the correct position. Is there a simple solution to this which I may have missed? Thanks again for your help. HTML markup: <span class="formInfo"> <a href="http://localhost/httpdocs/index.php/help/kc_dob" class="jTip" name="" id="dob_help">?</a> </span> qTip initialisation.. //set up for qtip function initQtip() { $('a.jTip').each(function() { $(this).qtip( { content: { // Set the text to an image HTML string with the correct src URL to the loading image you want to use text: '<img src="/media/images/wait.gif" alt="Loading..." />', url: $(this).attr('href') // Use the rel attribute of each element for the url to load }, position: { adjust: { screen: true // Keep the tooltip on-screen at all times } }, show: { when: 'click', solo: true // Only show one tooltip at a time }, hide: 'unfocus', style: { tip: true, // Apply a speech bubble tip to the tooltip at the designated tooltip corner border: { width: 10, radius: 10 }, width: { min: 200, max: 500 }, name: 'light' // Use the default light style } }); //prevent default event on click }).bind('click', function(event){ event.preventDefault(); return false; }); }

    Read the article

  • Why doesn't this PHP execute?

    - by cam
    I copied the code from this site exactly: http://davidwalsh.name/web-service-php-mysql-xml-json as follows, /* require the user as the parameter */ if(isset($_GET['user']) && intval($_GET['user'])) { /* soak in the passed variable or set our own */ $number_of_posts = isset($_GET['num']) ? intval($_GET['num']) : 10; //10 is the default $format = strtolower($_GET['format']) == 'json' ? 'json' : 'xml'; //xml is the default $user_id = intval($_GET['user']); //no default /* connect to the db */ $link = mysql_connect('localhost','username','password') or die('Cannot connect to the DB'); mysql_select_db('db_name',$link) or die('Cannot select the DB'); /* grab the posts from the db */ $query = "SELECT post_title, guid FROM wp_posts WHERE post_author = $user_id AND post_status = 'publish' ORDER BY ID DESC LIMIT $number_of_posts"; $result = mysql_query($query,$link) or die('Errant query: '.$query); /* create one master array of the records */ $posts = array(); if(mysql_num_rows($result)) { while($post = mysql_fetch_assoc($result)) { $posts[] = array('post'=>$post); } } /* output in necessary format */ if($format == 'json') { header('Content-type: application/json'); echo json_encode(array('posts'=>$posts)); } else { header('Content-type: text/xml'); echo '<posts>'; foreach($posts as $index => $post) { if(is_array($post)) { foreach($post as $key => $value) { echo '<',$key,'>'; if(is_array($value)) { foreach($value as $tag => $val) { echo '<',$tag,'>',htmlentities($val),'</',$tag,'>'; } } echo '</',$key,'>'; } } } echo '</posts>'; } /* disconnect from the db */ @mysql_close($link); } And the php doesn't execute, it just displays as plain text. What's the dealio? The host supports PHP, I use it to run a Wordpress blog and other things.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Show iPad keyboard on select, focus or always (jQuery)

    - by Ryan
    I have a web app that is using jQuery to replace the RETURN key with TAB so that when I user presses return the form is not submitted but rather the cursor moves to the next text field. This works in all browsers but only 1/2 works on the iPad. On the iPad the next field is highlighted but the keyboard is hidden. How can I keep the keyboard visible or force it somehow? Here's my code (thanks to http://thinksimply.com/blog/jquery-enter-tab): function checkForEnter (event) { if (event.keyCode == 13) { currentBoxNumber = textboxes.index(this); if (textboxes[currentBoxNumber + 1] != null) { nextBox = textboxes[currentBoxNumber + 1] nextBox.focus(); nextBox.select(); event.preventDefault(); return false; } } } Drupal.behaviors.formFields = function(context) { $('input[type="text"]').focus(function() { $(this).removeClass("idleField").addClass("focusField"); }); $('input[type="text"]').blur(function() { $(this).removeClass("focusField").addClass("idleField"); }); // replaces the enter/return key function with tab textboxes = $("input.form-text"); if ($.browser.mozilla) { $(textboxes).keypress (checkForEnter); } else { $(textboxes).keydown (checkForEnter); } };

    Read the article

  • grails question (sample 1 of Grails To Action book) problem with Controller and Service

    - by fegloff
    Hi, I'm doing Grails To Action sample for chapter one. Every was just fine until I started to work with Services. When I run the app I have the following error: groovy.lang.MissingPropertyException: No such property: quoteService for class: qotd.QuoteController at qotd.QuoteController$_closure3.doCall(QuoteController.groovy:14) at qotd.QuoteController$_closure3.doCall(QuoteController.groovy) at java.lang.Thread.run(Thread.java:619) Here is my groovie QuoteService class, which has an error within the definition of GetStaticQuote (ERROR: Groovy:unable to resolve class Quote) package qotd class QuoteService { boolean transactional = false def getRandomQuote() { def allQuotes = Quote.list() def randomQuote = null if (allQuotes.size() > 0) { def randomIdx = new Random().nextInt(allQuotes.size()) randomQuote = allQuotes[randomIdx] } else { randomQuote = getStaticQuote() } return randomQuote } def getStaticQuote() { return new Quote(author: "Anonymous",content: "Real Programmers Don't eat quiche") } } Controller groovie class package qotd class QuoteController { def index = { redirect(action: random) } def home = { render "<h1>Real Programmers do not each quiche!</h1>" } def random = { def randomQuote = quoteService.getRandomQuote() [ quote : randomQuote ] } def ajaxRandom = { def randomQuote = quoteService.getRandomQuote() render "<q>${randomQuote.content}</q>" + "<p>${randomQuote.author}</p>" } } Quote Class: package qotd class Quote { String content String author Date created = new Date() static constraints = { author(blank:false) content(maxSize:1000, blank:false) } } I'm doing the samples using Eclipse with grails addin. Any advice? Regards, Francisco

    Read the article

  • cannot enter text in query popup input field

    - by raja
    i am unable to enter text in jquery popup text field...... i am using following plugins my html code </head> <body onmousedown="return false;"> <div id="container"></div> <div id="divMenu"></div> </body> </html> i am appending popup tags as function setupCalibration(){ $('#container').append(' <div data-role="popup" id="calibratePopup" data-transition="flip" data-theme="e" data-overlay-theme="a" class="ui-content" style=" width:300px;height: 200px; z-index:1; display:none;"><label for="name">Text Input:</label><input type="text" name="name" id="name" value="" /></div>'); } and this is how i am invoking popup on click of divmenu button document.getElementById('divMenu').addEventListener('click', function() { $( '#calibratePopup' ).popup({display:block}); $( '#calibratePopup' ).show(); $( '#calibratePopup' ).popup( "open"); }, false); i am able to show popup,but input field is not responding

    Read the article

  • Have something loaded only when JList item is visibile

    - by elvencode
    Hello, i'm implementing a Jlist populated with a lot of elements. Each element corresponds to a image so i'd like to show a resized preview of them inside each row of the list. I've implemented a custom ImageCellRenderer extending the Jlabel and on getListCellRendererComponent i create the thumbnail if there'snt any for that element. Each row corresponds to a Page class where i store the path of the image and the icon applied to the JLabel. Each Page object is put inside a DefaultListModel to populate the JList. The render code is something like this: public Component getListCellRendererComponent( JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { Page page = (Page) value; if (page.getImgIcon() == null) { System.out.println(String.format("Creating thumbnail of %s", page.getImgFilename())); ImageIcon icon = new ImageIcon(page.getImgFilename()); int thumb_width = icon.getIconWidth() > icon.getIconHeight() ? 128 : ((icon.getIconWidth() * 128) / icon.getIconHeight()); int thumb_height = icon.getIconHeight() > icon.getIconWidth() ? 128 : ((icon.getIconHeight() * 128) / icon.getIconWidth()); icon.setImage(getScaledImage(icon.getImage(), thumb_width, thumb_height)); page.setImgIcon(icon); } setIcon(page.getImgIcon()); } I was thinking that only a certain item is visibile in the List the cell renderer is called but i'm seeing that all the thumnails are created when i add the Page object to the list model. I've tried to load the items and after set the model in the JList or set the model first and after starting appending the items but the results are the same. Is there any way to load the data only when necessary or do i need to create a custom control like a JScrollPanel with stacked items inside where i check myself the visibility of each elements? Thanks

    Read the article

  • Android 2.1 How to get Phone Numbers of contacts.

    - by Brandon Delany
    Hi, I am new to Android and have been working on an app that needs to get all of the user's contact's phone numbers. Apparently the code I have does not work with the 2.1 SDK. So far here is the code I am using: String[] projection = new String[] { Phone.NUMBER }; Cursor c = managedQuery( Phone.CONTENT_URI, projection, null, null, null ); int colIndex = -1; try { colIndex = c.getColumnIndexOrThrow( Phone.NUMBER ); } catch( Exception e ) { print( e.getMessage() ); } print( "Column Index = " + colIndex ); //count is equal to 3 for( int i = 0; i < count; i++ ){ try { print( c.getString( 2 ) ); //the 2 used to be colIndex } catch ( Exception e ) { print( e.getMessage() ); } } It seems that no matter what I pass into c.getString() it keeps telling me that I passed in -1. But I even hardcoded the 2, and it says the same thing. Any help would be much appreciated.

    Read the article

  • "Function object is unsubscriptable" in basic integer to string mapping function

    - by IanWhalen
    I'm trying to write a function to return the word string of any number less than 1000. Everytime I run my code at the interactive prompt it appears to work without issue but when I try to import wordify and run it with a test number higher than 20 it fails as "TypeError: 'function' object is unsubscriptable". Based on the error message, it seems the issue is when it tries to index numString (for example trying to extract the number 4 out of the test case of n = 24) and the compiler thinks numString is a function instead of a string. since the first line of the function is me defining numString as a string of the variable n, I'm not really sure why that is. Any help in getting around this error, or even just help in explaining why I'm seeing it, would be awesome. def wordify(n): # Convert n to a string to parse out ones, tens and hundreds later. numString = str(n) # N less than 20 is hard-coded. if n < 21: return numToWordMap(n) # N between 21 and 99 parses ones and tens then concatenates. elif n < 100: onesNum = numString[-1] ones = numToWordMap(int(onesNum)) tensNum = numString[-2] tens = numToWordMap(int(tensNum)*10) return tens+ones else: # TODO pass def numToWordMap(num): mapping = { 0:"", 1:"one", 2:"two", 3:"three", 4:"four", 5:"five", 6:"six", 7:"seven", 8:"eight", 9:"nine", 10:"ten", 11:"eleven", 12:"twelve", 13:"thirteen", 14:"fourteen", 15:"fifteen", 16:"sixteen", 17:"seventeen", 18:"eighteen", 19:"nineteen", 20:"twenty", 30:"thirty", 40:"fourty", 50:"fifty", 60:"sixty", 70:"seventy", 80:"eighty", 90:"ninety", 100:"onehundred", 200:"twohundred", 300:"threehundred", 400:"fourhundred", 500:"fivehundred", 600:"sixhundred", 700:"sevenhundred", 800:"eighthundred", 900:"ninehundred", } return mapping[num] if __name__ == '__main__': pass

    Read the article

  • Get Browser to send both If-None-Match and If-Modified-Since

    - by Glen
    My Browser isn't sending back an If-Modified-Since Header for PHP generated Content on the first request my script sends: (Status-Line) HTTP/1.1 200 OK Date Thu, 21 Jan 2010 08:55:25 GMT Server Apache/2.2.11 (Win32) PHP/5.2.9-1 X-Powered-By PHP/5.2.9-1 Pragma no-cache x-ua-compatible IE=8;FF=3;OtherUA=4 Last-Modfied Sat, 02 Jan 2010 02:02:20 GMT Content-Length 28453 Etag b98e0795b509be20146f58e06fbb624f Keep-Alive timeout=5, max=90 Connection Keep-Alive Content-Type image/png it on the second request it sends: (Request-Line) GET /kincumberunitingchurch/banner_image.php?id=1 HTTP/1.1 Host localhost User-Agent Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US; rv:1.9.0.17) Gecko/2009122116 Firefox/3.0.17 Accept image/png,image/*;q=0.8,*/*;q=0.5 Accept-Language en-us,en;q=0.5 Accept-Encoding gzip,deflate Accept-Charset ISO-8859-1,utf-8;q=0.7,*;q=0.7 Keep-Alive 300 Connection keep-alive Referer http://localhost/kincumberunitingchurch/index.php?sid=tgl9jq3f71nau3cj9vps6pna03 Cookie sid=tgl9jq3f71nau3cj9vps6pna03; PHPSESSID=m0jvven6d7l65pl6odm9ecfnt4 If-None-Match b98e0795b509be20146f58e06fbb624f Cache-Control max-age=0 for other files the sever sends first: (Status-Line) HTTP/1.1 200 OK Date Thu, 21 Jan 2010 08:55:25 GMT Server Apache/2.2.11 (Win32) PHP/5.2.9-1 Last-Modified Wed, 30 Dec 2009 02:40:58 GMT Etag "1000000013d35-40d9-47be9117f6280" Accept-Ranges bytes Content-Length 16601 Keep-Alive timeout=5, max=84 Connection Keep-Alive Content-Type image/png and my browser send the following on the next request: (Request-Line) GET /kincumberunitingchurch/img/cbuttons.png HTTP/1.1 Host localhost User-Agent Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US; rv:1.9.0.17) Gecko/2009122116 Firefox/3.0.17 Accept image/png,image/*;q=0.8,*/*;q=0.5 Accept-Language en-us,en;q=0.5 Accept-Encoding gzip,deflate Accept-Charset ISO-8859-1,utf-8;q=0.7,*;q=0.7 Keep-Alive 300 Connection keep-alive Referer http://localhost/kincumberunitingchurch/mystyle.css Cookie sid=tgl9jq3f71nau3cj9vps6pna03; PHPSESSID=m0jvven6d7l65pl6odm9ecfnt4 If-Modified-Since Wed, 30 Dec 2009 02:40:58 GMT If-None-Match "1000000013d35-40d9-47be9117f6280" Cache-Control max-age=0 why would it send the If-Modified-Since header

    Read the article

  • A little confused about MVC and where to put a database query

    - by jax
    OK, so my Joomla app is in MVC format. I am still a little confused about where to put certain operations, in the Controller or in the Model. This function below is in the controller, it gets called when &task=remove. Should the database stuff be in the Model? It does not seem to fit there because I have two models editapp (display a single application) and allapps (display all the applications), now which one would I put the delete operation in? /** * Delete an application */ function remove() { global $mainframe; $cid = JRequest::getVar( 'cid', array(), '', 'array' ); $db =& JFactory::getDBO(); //if there are items to delete if(count($cid)){ $cids = implode( ',', $cid ); $query = "DELETE FROM #__myapp_apps WHERE id IN ( $cids )"; $db->setQuery( $query ); if (!$db->query()){ echo "<script> alert('".$db->getErrorMsg()."');window.history.go(-1); </script>\n"; } } $mainframe->redirect( 'index.php?option=' . $option . '&c=apps'); } I am also confused about how the flow works. For example, there is a display() function in the controller that gets called by default. If I pass a task, does the display() function still run or does it go directly to the function name passed by $task?

    Read the article

< Previous Page | 448 449 450 451 452 453 454 455 456 457 458 459  | Next Page >