Search Results

Search found 12857 results on 515 pages for 'spatial index'.

Page 452/515 | < Previous Page | 448 449 450 451 452 453 454 455 456 457 458 459  | Next Page >

  • Added CAGradientLayer, getting this in my UIView dealloc: [CALayer release]: message sent to deallocated instance

    - by developerdoug
    Here there, I have a custom UIView. This view acts as a activity indicator but as label above the UIActivityIndicatorView. In the init, I add a CAGradientLayer. I allocate and initialize it and insert it at index 0 as a sublayer of the UIView layer property. In my dealloc method was called, I received a message in the console: - [CALayer release]: message sent to deallocated instance. My code: @interface LabelActivityIndicatorView () { UILabel *_label; UIActivityIndicatorView *_activityIndicatorView; CAGradientLayer *_gradientLayer; } @end @implementation LabelActivityIndicatorView //dealloc - (void) dealloc { [_label release]; [_activityIndicatorView release]; //even tried to remove the layer [_gradientLayer removeFromSuperLayer]; [_gradientLayer release]; [super dealloc]; } // init - (id) initWithFrame:(CGRect)frame { if ( (self = [super initWithFrame:frame]) ) { // init the label // init the gradient layer _gradientLayer = [[CAGradientLayer alloc] init]; [_gradientLayer setBounds:[self bounds]]; [_gradientLayer setPosition:CGPointMake(frame.size.width/2, frame.size.height/2)]; [[self layer] insertSublayer:_gradientLayer atIndex:0]; [[self layer] setNeedsDisplay]; } return self; } @end Anyone have any ideas. Since I'm allocating and initializing the gradient layer I'm responsible for releasing it. I should be able to alloc and init and assign to some ivar. Perhaps I should create a property with retain on it. Thanks,

    Read the article

  • Echoing users by group name in PHP

    - by BobSapp
    What I want to do is click a name of a group(every group what I create other than poweruser and admin groups) and that will echo all of the users in that group from the database. I have figured out the code so far but now my problem is how will I print it all out when clicking the name of the group? My code so far is: <h3>Groups</h3> <?php include('db.php'); if (isset($_GET["groupID"])) { $sql="SELECT `group`.*, `user`.* FROM `user` inner join `group` on group.groupID=user.groupID where group.groupID= " . mysql_real_escape_string($_GET["groupID"]) ; } else { $sql="SELECT * FROM `group` WHERE groupName <> 'admin' AND groupName <> 'poweruser'" ; } $result=mysql_query($sql,$connection); while($line=mysql_fetch_array($result)){ echo "<a href='index.php?page=groups&group=".$line['groupID']."'>".$line['groupName'].'</a><br />'; } mysql_free_result($result); mysql_close($connection); ?>

    Read the article

  • jQuery preventing RedirectToAction from working?

    - by DaveDev
    I'm trying to redirect the user if they login successfully but the code I have on my page seems to be preventing the redirection from working. If I remove the jQuery below the redirection works. Can somebody tell me tell me if there's something I'm doing wrong? Thanks I have the following Action: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Login(User user) { var myErrors = new Dictionary<string, string>(); try { if (ModelState.IsValid) { if (userRepository.ValidUser(user)) { return RedirectToAction("Index", "Group", new {page = (int?)null}); } else { return Json("Username or password seems to be incorrect"); } } else { foreach (KeyValuePair<string, ModelState> keyValuePair in ViewData.ModelState) { if (keyValuePair.Value.Errors.Count > 0) { List<string> errors = new List<string>(); myErrors.Add(keyValuePair.Key, keyValuePair.Value.Errors[0].ErrorMessage); } } return Json(myErrors); } } catch (Exception) { return Json("Invalid"); } } and the following code on my page: <script language="javascript" type="text/javascript"> $(document).ready(function() { $("#SaveSuccess").hide(); $("#btnLogin").click(function() { $("form").submit(function(event) { var formData = $(this).serialize(); $.post($(this).attr("action"), formData, function(res) { ShowErrors(res); if (res == true) { $("#SaveSuccess").text("Saved"); } else { $("#divError").html(res); } $("#SaveSuccess").fadeIn(100); }, "json"); return false; }); }); }); </script>

    Read the article

  • Issue with transparent texture on 3D primitive, XNA 4.0

    - by Bevin
    I need to draw a large set of cubes, all with (possibly) unique textures on each side. Some of the textures also have parts of transparency. The cubes that are behind ones with transparent textures should show through the transparent texture. However, it seems that the order in which I draw the cubes decides if the transparency works or not, which is something I want to avoid. Look here: cubeEffect.CurrentTechnique = cubeEffect.Techniques["Textured"]; Block[] cubes = new Block[4]; cubes[0] = new Block(BlockType.leaves, new Vector3(0, 0, 3)); cubes[1] = new Block(BlockType.dirt, new Vector3(0, 1, 3)); cubes[2] = new Block(BlockType.log, new Vector3(0, 0, 4)); cubes[3] = new Block(BlockType.gold, new Vector3(0, 1, 4)); foreach(Block b in cubes) { b.shape.RenderShape(GraphicsDevice, cubeEffect); } This is the code in the Draw method. It produces this result: As you can see, the textures behind the leaf cube are not visible on the other side. When i reverse index 3 and 0 on in the array, I get this: It is clear that the order of drawing is affecting the cubes. I suspect it may have to do with the blend mode, but I have no idea where to start with that.

    Read the article

  • ASP.NET MVC twitter/myspace style routing

    - by Astrofaes
    Hi guys, This is my first post after being a long-time lurker - so please be gentle :-) I have a website similar to twitter, in that people can sign up and choose a 'friendly url', so on my site they would have something like: mydomain.com/benjones I also have root level static pages such as: mydomain.com/about and of course my homepage: mydomain.com/ I'm new to ASP.NET MVC 2 (in fact I just started today) and I've set up the following routes to try and achieve the above. public static void RegisterRoutes(RouteCollection routes) { routes.IgnoreRoute("{resource}.axd/{*pathInfo}"); routes.IgnoreRoute("content/{*pathInfo}"); routes.IgnoreRoute("images/{*pathInfo}"); routes.MapRoute("About", "about", new { controller = "Common", action = "About" } ); // User profile sits at root level so check for this before displaying the homepage routes.MapRoute("UserProfile", "{url}", new { controller = "User", action = "Profile", url = "" } ); routes.MapRoute("Home", "", new { controller = "Home", action = "Index", id = "" } ); } For the most part this works fine, however, my homepage is not being triggered! Essentially, when you browser to mydomain.com, it seems to trigger the User Profile route with an empty {url} parameter and so the homepage is never reached! Any ideas on how I can show the homepage?

    Read the article

  • Prevent hash navigation url

    - by Koningh
    I have the following problem: I'm using a slider (coda) to let people navigate trough some 'pages'. The slider uses hash links to navigate to the next page/slide. If a user is at page one (#page1), there is a link which will lead the user to page 2 (#page2) and so on. At the top of the slider the numbers of the pages appear as a link, but only when the page is visited. So if there are six pages and the user navigates from the first to the second and then the third one, there are only three links at the top of the slider (to page one, two and three). The problem is that a user can navigate to page five (or any page actually) without first visiting the pages previous to page five by just using the hash URL and typing the whole link in their address bar. For example if I would type www.mydomain.com/slider/index.php#page5 the slider automatically navigates to the fifth slide/page of the slider and thereby skipping the first four. I want to allow users to navigate to #page5 only if they have visited the first four (So by clicking trough the slides). This means that if they would go to #page5 directly by typing the URL in the address bar, I would like them to be send to the first page (#page1). Does anyone have any idea on solving this?

    Read the article

  • "Function object is unsubscriptable" in basic integer to string mapping function

    - by IanWhalen
    I'm trying to write a function to return the word string of any number less than 1000. Everytime I run my code at the interactive prompt it appears to work without issue but when I try to import wordify and run it with a test number higher than 20 it fails as "TypeError: 'function' object is unsubscriptable". Based on the error message, it seems the issue is when it tries to index numString (for example trying to extract the number 4 out of the test case of n = 24) and the compiler thinks numString is a function instead of a string. since the first line of the function is me defining numString as a string of the variable n, I'm not really sure why that is. Any help in getting around this error, or even just help in explaining why I'm seeing it, would be awesome. def wordify(n): # Convert n to a string to parse out ones, tens and hundreds later. numString = str(n) # N less than 20 is hard-coded. if n < 21: return numToWordMap(n) # N between 21 and 99 parses ones and tens then concatenates. elif n < 100: onesNum = numString[-1] ones = numToWordMap(int(onesNum)) tensNum = numString[-2] tens = numToWordMap(int(tensNum)*10) return tens+ones else: # TODO pass def numToWordMap(num): mapping = { 0:"", 1:"one", 2:"two", 3:"three", 4:"four", 5:"five", 6:"six", 7:"seven", 8:"eight", 9:"nine", 10:"ten", 11:"eleven", 12:"twelve", 13:"thirteen", 14:"fourteen", 15:"fifteen", 16:"sixteen", 17:"seventeen", 18:"eighteen", 19:"nineteen", 20:"twenty", 30:"thirty", 40:"fourty", 50:"fifty", 60:"sixty", 70:"seventy", 80:"eighty", 90:"ninety", 100:"onehundred", 200:"twohundred", 300:"threehundred", 400:"fourhundred", 500:"fivehundred", 600:"sixhundred", 700:"sevenhundred", 800:"eighthundred", 900:"ninehundred", } return mapping[num] if __name__ == '__main__': pass

    Read the article

  • Why cant Git merge file changes with a modified parent/master.

    - by Andy
    I have a file with one line in it. I create a branch and add a second line to the same file. Save and commit to the branch. I switch back to the master. And add a different, second line to the file. Save and commit to the master. So there's now 3 unique lines in total. If I now try and merge the branch back to the master, it suffers a merge conflict. Why cant Git simple merge each line, one after the other? My attempt at merge behaves something like this: PS D:\dev\testing\test1> git merge newbranch Auto-merging hello.txt CONFLICT (content): Merge conflict in hello.txt Automatic merge failed; fix conflicts and then commit the result. PS D:\dev\testing\test1> git diff diff --cc hello.txt index 726eeaf,e48d31a..0000000 --- a/hello.txt +++ b/hello.txt @@@ -1,2 -1,2 +1,6 @@@ This is the first line. - New line added by master. -Added a line in newbranch. ++<<<<<<< HEAD ++New line added by master. ++======= ++Added a line in newbranch. ++>>>>>>> newbranch Is there a way to make it slot lines in automatically, one after the other?

    Read the article

  • No event is firing when placing a custom data bound control in DataRepeater control in Windows forms

    - by Remo
    Hi, Custom events in a custom data bound control are not firing in DataRepeater control. When I debug it I found that the DataRepeater Control recreates the control using Activator.CreateInstance and Copies the Properties and Events. In my case copying events doesn't copy the custom events that I hooked in. For example public class MyClass : Control { public event EventHandler MyEvent; protected virtual void OnMyEvent() { if(this.MyEvent != null) { this.MyEvent(this,EventArgs.Empty); } } private int selectedIndex= -1; public int SelectedIndex { get { return this.selectedIndex; } set { if(this.selectedIndex != value) { this.selectedIndex = value; this.OnMyEvent(); } } } // // DataBinding stuff goes here // } public Form1() { InitialiseComponent(); ArrayList list = new ArrayList(); list.Add("one"); this.dataRepeater1.DataSource = list; // One Repeater MyClass test = new Myclass(); test.DataSource = GetDataTable(); this.dataRepeater1.ItemTemplate.Controls.Add(test); test.MyEvent +=new EventHandler(test_MyEvent); } // This Event should fire when selected index of Datatable is changed and is firing when placed directly in the form and not firing when place in DataRepeater control/////////////////////// private void test_MyEvent(object sender, EventArgss e) { // This event is not fired/////////////////////// } private DataTable GetDataTable() { ..// Create a data Table and return } Any help Appreciated. Thanks,

    Read the article

  • C header file won't compile with C, but will with C++.

    - by Leif Andersen
    I have the following chunk of a header file BKE_mesh.h: /* Connectivity data */ typedef struct IndexNode { struct IndexNode *next, *prev; int index; } IndexNode; void create_vert_face_map(ListBase **map, IndexNode **mem, const struct MFace *mface, const int totvert, const int totface); void create_vert_edge_map(ListBase **map, IndexNode **mem, const struct MEdge *medge, const int totvert, const int totedge); Note that the header file was prepared for the possibility of being used in a C++ file, as it had: #ifdef __cplusplus extern "C" { #endif at the top of the file, and the needed finish at the bottom. But the class implementing it was written in C. Next, whenever I try to #include the header file, I get an odd error. If the file has a .cpp extension, it compiles just fine, no complaints whatsoever. However, if I do: #include "BKE_mesh.h" inside of a file with a .c extension, I get the following errors: expected ')' before '*' token for the two last functions, in specific, the variable: ListBase **map in both classes. (Note that earlier in the header file, it declared, but not defined ListBase). So, my question is: why is this valid C++ code, but not C code? Thank you.

    Read the article

  • get path of Array (PHP)

    - by Kawah Grafis
    i have an array input like this .. Array ( [0] => Array ( [0] => 42 ) [**42**] => Array ( [0] => 12 [1] => 14 ) [**14**] => Array ( [0] => 317 ) [317] => Array ( [0] => 319 ) [**12**] => Array ( [0] => 306 [1] => 307 ) [307] => Array ( [0] => 311 ) [306] => Array ( [0] => 309 ) ) and i want to get result array like bellow : $paths[]=array(42,12,306,309); $paths[]=array(42,12,307,311); $paths[]=array(42,14,317,319); see array input root in array input = 42 (index of array 0) 42 have child = 12, 14 12 have child = 306, 307 14 have child = 317 306 have child = 309 307 have child = 311 317 have child = 319 like this.. and output array insert into $paths $paths[0]=array(42,12,306,309); $paths[1]=array(42,12,307,311); $paths[2]=array(42,14,317,319);

    Read the article

  • Codeigniter only loads the default controller

    - by fh47331
    I am very new to CodeIgniter, but have been programming PHP for ages. I'm writing some software at the moment and using CI for the first time with it. The default controller is set to the first controller I want to action call 'login' (the controller is login.php, the view is login.php. When the form is submitted it calls the 'authenticate' controller. This executes fine, process the login data correctly and then does a redirect command (without any output to the screen prior) to the next page in this case 'newspage'. The problem is that the redirect, never reaches 'newspage' but the default controller runs again. It doesn't matter what I put ... ht tp://domain.name/anything ... (yes im using .htaccess to remove the index.php) the anything never gets called, just the default controller. I have left the standard 'welcome.php' controller and 'welcome_message.php' in the folders and even putting ht tp://domain.name/welcome all I get is the login screen! (Obviously there shouldn't be a space between the http - thats just done so it does not show as a hyperlink!) Can anyone tell me what i've done wrong!

    Read the article

  • Converting "A* Search" code from C++ to Java [on hold]

    - by mr5
    Updated! I get this code from this site It's A* Search Algorithm(finding shortest path with heuristics) I modify most of variable names and some if conditions from the original version to satisfy my syntactic taste. It works in C++ (as I can't see any trouble with it) but fails in Java version. Java Code: String findPath(int startX, int startY, int finishX, int finishY) { @SuppressWarnings("unchecked") LinkedList<Node>[] nodeList = (LinkedList<Node>[]) new LinkedList<?>[2]; nodeList[0] = new LinkedList<Node>(); nodeList[1] = new LinkedList<Node>(); Node n0; Node m0; int nlIndex = 0; // queueList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = new Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[nlIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[nlIndex].isEmpty() ) { LinkedList<Node> pq = nodeList[nlIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = new Node( pq.peek().getX(), pq.peek().getY(), pq.peek().getIterCount(), pq.peek().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[nlIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions String path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; int c = '0' + ( j + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; path = (char)c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < Node.DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!(xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( gridMap.getData( ydy, xdx ) == GridMap.WALKABLE || gridMap.getData( ydy, xdx ) == GridMap.FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = new Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[nlIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; // replace the node // by emptying one queueList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while( !(nodeList[nlIndex].peek().getX() == xdx && nodeList[nlIndex].peek().getY() == ydy ) ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nodeList[nlIndex].pop(); // remove the wanted node // empty the larger size queueList to the smaller one if( nodeList[nlIndex].size() > nodeList[ 1 - nlIndex ].size() ) nlIndex = 1 - nlIndex; while( !nodeList[nlIndex].isEmpty() ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nlIndex = 1 - nlIndex; nodeList[nlIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output1: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Misleading path) Output2: Changing these lines: n0 = new Node( a, b, c, d ); m0 = new Node( e, f, g, h ); to n0.set( a, b, c, d ); m0.set( e, f, g, h ); I get (I'm really confused) C++ Code: std::string A_Star::findPath(int startX, int startY, int finishX, int finishY) { typedef std::queue<Node> List_Container; List_Container nodeList[2]; // list of open (not-yet-tried) nodes Node n0; Node m0; int pqIndex = 0; // nodeList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[pqIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[pqIndex].empty() ) { List_Container &pq = nodeList[pqIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = Node( pq.front().getX(), pq.front().getY(), pq.front().getIterCount(), pq.front().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[pqIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions std::string path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; char c = '0' + ( j + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; path = c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!( xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( pGrid->getData(ydy,xdx) == WALKABLE || pGrid->getData(ydy, xdx) == FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[pqIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; // replace the node // by emptying one nodeList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while ( !( nodeList[pqIndex].front().getX() == xdx && nodeList[pqIndex].front().getY() == ydy ) ) { nodeList[1 - pqIndex].push( nodeList[pqIndex].front() ); nodeList[pqIndex].pop(); } nodeList[pqIndex].pop(); // remove the wanted node // empty the larger size nodeList to the smaller one if( nodeList[pqIndex].size() > nodeList[ 1 - pqIndex ].size() ) pqIndex = 1 - pqIndex; while( !nodeList[pqIndex].empty() ) { nodeList[1-pqIndex].push(nodeList[pqIndex].front()); nodeList[pqIndex].pop(); } pqIndex = 1 - pqIndex; nodeList[pqIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Just right) From what I read about Java's documentation, I came up with the conclusion: C++'s std::queue<T>::front() == Java's LinkedList<T>.peek() Java's LinkedList<T>.pop() == C++'s std::queue<T>::front() + std::queue<T>::pop() What might I be missing in my Java version? In what way does it became different algorithmically from the C++ version?

    Read the article

  • A generic error has occurred in GDI+

    - by sysigy
    I know this has been asked a million times but I think I need to make it a million and one. I am getting "A generic error has occurred in GDI+" when trying to save a new bitmap. I have completely stripped down to the most basic lines of code and I still get the error with the following method: public class HomeController : Controller { public ActionResult Index() { return this.View(); } public void CreatePicture() { try { // THIS WORKS System.IO.File.Copy("C:\\copyTest.bmp", "C:\\test folder\\copyTest2.bmp"); // THIS WORKS System.IO.File.Delete("C:\\test folder\\deleteTest.bmp"); using (Bitmap newBitmap = new Bitmap(120, 120)) { // THIS FAILS newBitmap.Save("C:\\test folder\\test.bmp", ImageFormat.Bmp); } } catch (Exception ex) { throw ex; } } } The code is called from an html link on a blank page within an MVC 3.0 website using anonymous login. View: @Html.ActionLink("Create Picture", "CreatePicture", "Home", new { }) I have checked the folder permissions of "test folder" and have given full access to the following: ASPNET NETWORK SERVICE IUSR I still get the error... what have I missed / done wrong ?

    Read the article

  • OCaml delimiters and scopes

    - by Jack
    Hello! I'm learning OCaml and although I have years of experience with imperative programming languages (C, C++, Java) I'm getting some problems with delimiters between declarations or expressions in OCaml syntax. Basically I understood that I have to use ; to concatenate expressions and the value returned by the sequence will be the one of last expression used, so for example if I have exp1; exp2; exp3 it will be considered as an expression that returns the value of exp3. Starting from this I could use let t = something in exp1; exp2; exp3 and it should be ok, right? When am I supposed to use the double semicol ;;? What does it exactly mean? Are there other delimiters that I must use to avoid syntax errors? I'll give you an example: let rec satisfy dtmc state pformula = match (state, pformula) with (state, `Next sformula) -> let s = satisfy_each dtmc sformula and adder a state = let p = 0.; for i = 0 to dtmc.matrix.rows do p <- p +. get dtmc.matrix i state.index done; a +. p in List.fold_left adder 0. s | _ -> [] It gives me syntax error on | but I don't get why.. what am I missing? This is a problem that occurs often and I have to try many different solutions until it suddently works :/ A side question: declaring with let instead that let .. in will define a var binding that lasts whenever after it has been defined? What I basically ask is: what are the delimiters I have to use and when I have to use them. In addition are there differences I should consider while using the interpreter ocaml instead that the compiler ocamlc? Thanks in advance!

    Read the article

  • How to support comparisons for QVariant objects containing a custom type?

    - by Tyler McHenry
    According to the Qt documentation, QVariant::operator== does not work as one might expect if the variant contains a custom type: bool QVariant::operator== ( const QVariant & v ) const Compares this QVariant with v and returns true if they are equal; otherwise returns false. In the case of custom types, their equalness operators are not called. Instead the values' addresses are compared. How are you supposed to get this to behave meaningfully for your custom types? In my case, I'm storing an enumerated value in a QVariant, e.g. In a header: enum MyEnum { Foo, Bar }; Q_DECLARE_METATYPE(MyEnum); Somewhere in a function: QVariant var1 = QVariant::fromValue<MyEnum>(Foo); QVariant var2 = QVariant::fromValue<MyEnum>(Foo); assert(var1 == var2); // Fails! What do I need to do differently in order for this assertion to be true? I understand why it's not working -- each variant is storing a separate copy of the enumerated value, so they have different addresses. I want to know how I can change my approach to storing these values in variants so that either this is not an issue, or so that they do both reference the same underlying variable. It don't think it's possible for me to get around needing equality comparisons to work. The context is that I am using this enumeration as the UserData in items in a QComboBox and I want to be able to use QComboBox::findData to locate the item index corresponding to a particular enumerated value.

    Read the article

  • Out-of-memory algorithms for addressing large arrays

    - by reve_etrange
    I am trying to deal with a very large dataset. I have k = ~4200 matrices (varying sizes) which must be compared combinatorially, skipping non-unique and self comparisons. Each of k(k-1)/2 comparisons produces a matrix, which must be indexed against its parents (i.e. can find out where it came from). The convenient way to do this is to (triangularly) fill a k-by-k cell array with the result of each comparison. These are ~100 X ~100 matrices, on average. Using single precision floats, it works out to 400 GB overall. I need to 1) generate the cell array or pieces of it without trying to place the whole thing in memory and 2) access its elements (and their elements) in like fashion. My attempts have been inefficient due to reliance on MATLAB's eval() as well as save and clear occurring in loops. for i=1:k [~,m] = size(data{i}); cur_var = ['H' int2str(i)]; %# if i == 1; save('FileName'); end; %# If using a single MAT file and need to create it. eval([cur_var ' = cell(1,k-i);']); for j=i+1:k [~,n] = size(data{j}); eval([cur_var '{i,j} = zeros(m,n,''single'');']); eval([cur_var '{i,j} = compare(data{i},data{j});']); end save(cur_var,cur_var); %# Add '-append' when using a single MAT file. clear(cur_var); end The other thing I have done is to perform the split when mod((i+j-1)/2,max(factor(k(k-1)/2))) == 0. This divides the result into the largest number of same-size pieces, which seems logical. The indexing is a little more complicated, but not too bad because a linear index could be used. Does anyone know/see a better way?

    Read the article

  • Why does my floating div push around other divs?

    - by Meke
    I have a div which has a table which has a google map. I want to place a info box within the google map external to the map, just floating on top But I can't seem to get it right, the info div just pushes around the google map despite being on top of the map... CSS .google_map { height: 270px; width: 100%; } #flightMapInfo { position: relative; float: left; z-index: 100; color: #FFFFFF; top: 30px; left: 50px; background:#5a85a5; padding: 5px; -moz-border-radius: 10px; -webkit-border-radius: 10px; } div.tabContent { border: 1px solid #c9c3ba; padding: 0.5em; background-color: #f1f0ee; min-height: 300px; } .tableLeft { width: 75%; float: left; border-right: dotted 2px black; } HTML <div class="mapBlock tabContent"> <div id="flightMapInfo">WHARGL</div> <table class="tableLeft"> <tr><td><div id="flightMap" class="google_map"></div> </table></td></tr></div>

    Read the article

  • Why doesn't this PHP execute?

    - by cam
    I copied the code from this site exactly: http://davidwalsh.name/web-service-php-mysql-xml-json as follows, /* require the user as the parameter */ if(isset($_GET['user']) && intval($_GET['user'])) { /* soak in the passed variable or set our own */ $number_of_posts = isset($_GET['num']) ? intval($_GET['num']) : 10; //10 is the default $format = strtolower($_GET['format']) == 'json' ? 'json' : 'xml'; //xml is the default $user_id = intval($_GET['user']); //no default /* connect to the db */ $link = mysql_connect('localhost','username','password') or die('Cannot connect to the DB'); mysql_select_db('db_name',$link) or die('Cannot select the DB'); /* grab the posts from the db */ $query = "SELECT post_title, guid FROM wp_posts WHERE post_author = $user_id AND post_status = 'publish' ORDER BY ID DESC LIMIT $number_of_posts"; $result = mysql_query($query,$link) or die('Errant query: '.$query); /* create one master array of the records */ $posts = array(); if(mysql_num_rows($result)) { while($post = mysql_fetch_assoc($result)) { $posts[] = array('post'=>$post); } } /* output in necessary format */ if($format == 'json') { header('Content-type: application/json'); echo json_encode(array('posts'=>$posts)); } else { header('Content-type: text/xml'); echo '<posts>'; foreach($posts as $index => $post) { if(is_array($post)) { foreach($post as $key => $value) { echo '<',$key,'>'; if(is_array($value)) { foreach($value as $tag => $val) { echo '<',$tag,'>',htmlentities($val),'</',$tag,'>'; } } echo '</',$key,'>'; } } } echo '</posts>'; } /* disconnect from the db */ @mysql_close($link); } And the php doesn't execute, it just displays as plain text. What's the dealio? The host supports PHP, I use it to run a Wordpress blog and other things.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • A little confused about MVC and where to put a database query

    - by jax
    OK, so my Joomla app is in MVC format. I am still a little confused about where to put certain operations, in the Controller or in the Model. This function below is in the controller, it gets called when &task=remove. Should the database stuff be in the Model? It does not seem to fit there because I have two models editapp (display a single application) and allapps (display all the applications), now which one would I put the delete operation in? /** * Delete an application */ function remove() { global $mainframe; $cid = JRequest::getVar( 'cid', array(), '', 'array' ); $db =& JFactory::getDBO(); //if there are items to delete if(count($cid)){ $cids = implode( ',', $cid ); $query = "DELETE FROM #__myapp_apps WHERE id IN ( $cids )"; $db->setQuery( $query ); if (!$db->query()){ echo "<script> alert('".$db->getErrorMsg()."');window.history.go(-1); </script>\n"; } } $mainframe->redirect( 'index.php?option=' . $option . '&c=apps'); } I am also confused about how the flow works. For example, there is a display() function in the controller that gets called by default. If I pass a task, does the display() function still run or does it go directly to the function name passed by $task?

    Read the article

  • using facelet1.1.15 (external facelet) in JSF2

    - by Odelya
    Hi! I have upgrated to JSF2 but still running with facelet1.1.15. I have these parameters in web.xml: <context-param> <param-name>org.ajax4jsf.VIEW_HANDLERS</param-name> <param-value>com.sun.facelets.FaceletViewHandler</param-value> </context-param> <context-param> <param-name>javax.faces.DISABLE_FACELET_JSF_VIEWHANDLER</param-name> <param-value>true</param-value> </context-param> I am trying to create my own componet step by step of this example : http://www.ibm.com/developerworks/java/library/j-jsf2fu2/index.html#tip3 everything looks fine but i get an error that it doesn't recognize the tag. Has it got to do with the facelet 1.1.15? and it works only with VDL? it there a way to use 1.1.15 and custom components in JSF2? As well - I use tomcat 6

    Read the article

  • MySQL Casting in C#

    - by user798080
    Okay, so I'm attempting to print out the contents of a table in a comma-separated file. using (OdbcCommand com = new OdbcCommand("SELECT * FROM pie_data WHERE Pie_ID = ?", con)) { com.Parameters.AddWithValue("", Request.Form["pie_id"]); com.ExecuteNonQuery(); using (OdbcDataReader reader = com.ExecuteReader()) { string finalstring = ""; while (reader.Read()) { finalstring = reader.GetString(9) + ","; for (int i = 0; i <= 8; i = i + 1) { finalstring = finalstring + reader.GetString(i) + ","; } } } Response.Write(finalstring); noredirect = 1; } My table layout is: CREATE TABLE `rent_data` ( `Pies` INT(10) UNSIGNED NOT NULL, `Name` VARCHAR(85) NOT NULL, `Email` VARCHAR(85) NOT NULL, `Pie_Rent` DATE NOT NULL, `Rent_To` DATE NOT NULL, `Returned_Date` DATE NULL DEFAULT NULL, `Place` VARCHAR(100) NOT NULL, `Purpose` MEDIUMTEXT NOT NULL, `Comments` MEDIUMTEXT NULL, `Pie_ID` SMALLINT(5) UNSIGNED ZEROFILL NOT NULL, INDEX `Pie_ID` (`Equipment_ID`) ) The error I'm getting is this: Exception Details: System.InvalidCastException: Unable to cast object of type 'System.Int64' to type 'System.String'. On the line: finalstring = finalstring + reader.GetString(i) + ",";

    Read the article

  • Programmatically change the icon of the executable

    - by Dennis Delimarsky
    I am developing an application called WeatherBar. Its main functionality is based on its interaction with the Windows 7 taskbar — it changes the icon depending on the weather conditions in a specific location. The icons I am using in the application are all stored in a compiled native resource file (.res) — I am using it instead of the embedded resource manifest for icons only. By default, I modify the Icon property of the main form to change the icons accordingly and it works fine, as long as the icon is not pinned to the taskbar. When it gets pinned, the icon in the taskbar automatically switches to the default one for the executable (with index 0 in the resource file). After doing a little bit of research, I figured that a way to change the icon would be changing the shortcut icon (as all pinned applications are actually shortcuts stored in the user folder). But it didn't work. I assume that I need to change the icon for the executable, and therefore use UpdateResource, but I am not entirely sure about this. My executable is not digitally signed, so it shouldn't be an issue modifying it. What would be the way to solve this issue?

    Read the article

  • Why my http POST request doesn't go well?

    - by 0x90
    I am trying to make this POST request in ruby. but get back #<Net::HTTPUnsupportedMediaType:0x007f94d396bb98> what I tried is: require 'rubygems' require 'net/http' require 'uri' require 'json' auto_index_nodes =URI('http://localhost:7474/db/data/index/node/') request_nodes = Net::HTTP::Post.new(auto_index_nodes.request_uri) http = Net::HTTP.new(auto_index_nodes.host, auto_index_nodes.port) request_nodes.add_field("Accept", "application/json") request_nodes.set_form_data({"name"=>"node_auto_index", "config" => { "type" => "fulltext", "provider" =>"lucene"} , "Content-Type" => "application/json" }) response = http.request(request_nodes) Tried to write this part: "config" => { "type" => "fulltext", provider" =>"lucene"} , "Content-Type" => "application/json" } like that: "config" => '{ "type" => "fulltext",\ "provider" =>"lucene"},\ "Content-Type" => "application/json"\ }' this try didn't help either: request_nodes.set_form_data({"name"=>"node_auto_index", "config" => '{ \ "type" : "fulltext",\ "provider" : "lucene"}' , "Content-Type" => "application/json" })

    Read the article

< Previous Page | 448 449 450 451 452 453 454 455 456 457 458 459  | Next Page >