Search Results

Search found 12857 results on 515 pages for 'spatial index'.

Page 452/515 | < Previous Page | 448 449 450 451 452 453 454 455 456 457 458 459  | Next Page >

  • CSS "Cover" - No scroll bars?

    - by Lynda
    I am using the cover property to create a background image that fills the background and resizes with the browser. But I run into one issue, the page has a lot of content and no scroll bars appear for me to scroll down! Here is the code I am using: body{ background: url(path.jpg) no-repeat center center fixed; -webkit-background-size: cover; -moz-background-size: cover; -o-background-size: cover; /* Cover for IE 7/8 */ filter: progid:DXImageTransform.Microsoft.AlphaImageLoader(src='path.jpg', sizingMethod='scale'); -ms-filter: progid:DXImageTransform.Microsoft.AlphaImageLoader(src='path.jpg', sizingMethod='scale'); /* End Cover for IE 7/8 */ background-size: cover; background-color: transparent !important; position:fixed; top: 0; left: 0; width: 100%; height:100%; max-width:2500px; max-height:1500px; z-index:1; } If I remove position:fixed; I get the scroll bars back but the background image disappears. What is the best way to tackle this and have both scroll bars and the background cover image? Note: I am using jQuery and would use a JS answer if it works (though I prefer a CSS only answer.)

    Read the article

  • PHP include doesn't work

    - by Chris
    I'm not sure how simple is this to solve, but I assume I'm doing something wrong. I'm new to PHP, so bear with me, please. When I started learning PHP, I always placed all my project files into the same folder along with index.php and thus included everything like this: <?php include('./translation.php'); ?> Later on in the process of learning as I gained experience and my skill increased, I had to start using folders and place my files into sub folders. I ended up successfully including my files with the following: <?php include('../translation.php'); ?> My trouble-free coding took an unexpected turn when I decided to start using sub-sub folders. After placing all the files even deeper into the file structure I was shocked to find out that I cannot include them anymore, using: <?php include('.../translation.php'); ?> Now I'm lost. What did I do wrong? Am I to understand that I cannot include files deeper than 2 directories in the project? Should I start using a different file system?

    Read the article

  • odp.net SQL query retrieve set of rows from two input arrays.

    - by Karl Trumstedt
    I have a table with a primary key consisting of two columns. I want to retrieve a set of rows based on two input arrays, each corresponding to one primary key column. select pkt1.id, pkt1.id2, ... from PrimaryKeyTable pkt1, table(:1) t1, table(:2) t2 where pkt1.id = t1.column_value and pkt1.id2 = t2.column_value I then bind the values with two int[] in odp.net. This returns all different combinations of my resulting rows. So if I am expecting 13 rows I receive 169 rows (13*13). The problem is that each value in t1 and t2 should be linked. Value t1[4] should be used with t2[4] and not all the different values in t2. Using distinct solves my problem, but I'm wondering if my approach is wrong. Anyone have any pointers on how to solve this the best way? One way might be to use a for-loop accessing each index in t1 and t2 sequentially, but I wonder what will be more efficient. Edit: actually distinct won't solve my problem, it just did it based on my input-values (all values in t2 = 0)

    Read the article

  • Why doesn't this PHP execute?

    - by cam
    I copied the code from this site exactly: http://davidwalsh.name/web-service-php-mysql-xml-json as follows, /* require the user as the parameter */ if(isset($_GET['user']) && intval($_GET['user'])) { /* soak in the passed variable or set our own */ $number_of_posts = isset($_GET['num']) ? intval($_GET['num']) : 10; //10 is the default $format = strtolower($_GET['format']) == 'json' ? 'json' : 'xml'; //xml is the default $user_id = intval($_GET['user']); //no default /* connect to the db */ $link = mysql_connect('localhost','username','password') or die('Cannot connect to the DB'); mysql_select_db('db_name',$link) or die('Cannot select the DB'); /* grab the posts from the db */ $query = "SELECT post_title, guid FROM wp_posts WHERE post_author = $user_id AND post_status = 'publish' ORDER BY ID DESC LIMIT $number_of_posts"; $result = mysql_query($query,$link) or die('Errant query: '.$query); /* create one master array of the records */ $posts = array(); if(mysql_num_rows($result)) { while($post = mysql_fetch_assoc($result)) { $posts[] = array('post'=>$post); } } /* output in necessary format */ if($format == 'json') { header('Content-type: application/json'); echo json_encode(array('posts'=>$posts)); } else { header('Content-type: text/xml'); echo '<posts>'; foreach($posts as $index => $post) { if(is_array($post)) { foreach($post as $key => $value) { echo '<',$key,'>'; if(is_array($value)) { foreach($value as $tag => $val) { echo '<',$tag,'>',htmlentities($val),'</',$tag,'>'; } } echo '</',$key,'>'; } } } echo '</posts>'; } /* disconnect from the db */ @mysql_close($link); } And the php doesn't execute, it just displays as plain text. What's the dealio? The host supports PHP, I use it to run a Wordpress blog and other things.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • A little confused about MVC and where to put a database query

    - by jax
    OK, so my Joomla app is in MVC format. I am still a little confused about where to put certain operations, in the Controller or in the Model. This function below is in the controller, it gets called when &task=remove. Should the database stuff be in the Model? It does not seem to fit there because I have two models editapp (display a single application) and allapps (display all the applications), now which one would I put the delete operation in? /** * Delete an application */ function remove() { global $mainframe; $cid = JRequest::getVar( 'cid', array(), '', 'array' ); $db =& JFactory::getDBO(); //if there are items to delete if(count($cid)){ $cids = implode( ',', $cid ); $query = "DELETE FROM #__myapp_apps WHERE id IN ( $cids )"; $db->setQuery( $query ); if (!$db->query()){ echo "<script> alert('".$db->getErrorMsg()."');window.history.go(-1); </script>\n"; } } $mainframe->redirect( 'index.php?option=' . $option . '&c=apps'); } I am also confused about how the flow works. For example, there is a display() function in the controller that gets called by default. If I pass a task, does the display() function still run or does it go directly to the function name passed by $task?

    Read the article

  • Magento products will not show in category

    - by Aaron
    I've recently been tasked with the build and deployment of a large Ecommerce site. In the past we've had to use the clients legacy X-cart installation for redevelopment (too far integrated with their existing work flow). We'd heard good things about Magento, so I've set up a test install to get to grips with it. After a couple of initial issues, there is a live development site which displays categories on the default theme. The problem we've hit now is that products don't display..! After a lot more in-depth research into this, all I've been able to discover is that quite a number of developers endorse using other solutions entirely, with the other 50% saying after the steep learning curve the platform is as wonderful as we'd initially been led to believe. Now, my test category is showing, so I know this is configured properly. I've set up three test products and associated them with this (all done following the Magento user guide), checked double checked and thrice checked the products are enabled and visible individually, yet still the front end says the category has no products in it. I've cleared the cache repeatedly, reset everything possible many times in index management - no products show up. I have to make a call tomorrow morning on whether we're going ahead with Magento. If I can't even get it to show products I'm going to have to go with something with a more established track record and more community support available. Can anybody advise what could possibly be wrong here?

    Read the article

  • Why does my floating div push around other divs?

    - by Meke
    I have a div which has a table which has a google map. I want to place a info box within the google map external to the map, just floating on top But I can't seem to get it right, the info div just pushes around the google map despite being on top of the map... CSS .google_map { height: 270px; width: 100%; } #flightMapInfo { position: relative; float: left; z-index: 100; color: #FFFFFF; top: 30px; left: 50px; background:#5a85a5; padding: 5px; -moz-border-radius: 10px; -webkit-border-radius: 10px; } div.tabContent { border: 1px solid #c9c3ba; padding: 0.5em; background-color: #f1f0ee; min-height: 300px; } .tableLeft { width: 75%; float: left; border-right: dotted 2px black; } HTML <div class="mapBlock tabContent"> <div id="flightMapInfo">WHARGL</div> <table class="tableLeft"> <tr><td><div id="flightMap" class="google_map"></div> </table></td></tr></div>

    Read the article

  • grails question (sample 1 of Grails To Action book) problem with Controller and Service

    - by fegloff
    Hi, I'm doing Grails To Action sample for chapter one. Every was just fine until I started to work with Services. When I run the app I have the following error: groovy.lang.MissingPropertyException: No such property: quoteService for class: qotd.QuoteController at qotd.QuoteController$_closure3.doCall(QuoteController.groovy:14) at qotd.QuoteController$_closure3.doCall(QuoteController.groovy) at java.lang.Thread.run(Thread.java:619) Here is my groovie QuoteService class, which has an error within the definition of GetStaticQuote (ERROR: Groovy:unable to resolve class Quote) package qotd class QuoteService { boolean transactional = false def getRandomQuote() { def allQuotes = Quote.list() def randomQuote = null if (allQuotes.size() > 0) { def randomIdx = new Random().nextInt(allQuotes.size()) randomQuote = allQuotes[randomIdx] } else { randomQuote = getStaticQuote() } return randomQuote } def getStaticQuote() { return new Quote(author: "Anonymous",content: "Real Programmers Don't eat quiche") } } Controller groovie class package qotd class QuoteController { def index = { redirect(action: random) } def home = { render "<h1>Real Programmers do not each quiche!</h1>" } def random = { def randomQuote = quoteService.getRandomQuote() [ quote : randomQuote ] } def ajaxRandom = { def randomQuote = quoteService.getRandomQuote() render "<q>${randomQuote.content}</q>" + "<p>${randomQuote.author}</p>" } } Quote Class: package qotd class Quote { String content String author Date created = new Date() static constraints = { author(blank:false) content(maxSize:1000, blank:false) } } I'm doing the samples using Eclipse with grails addin. Any advice? Regards, Francisco

    Read the article

  • Find Pythagorean triplet for which a + b + c = 1000

    - by Rahul
    A Pythagorean triplet is a set of three natural numbers, a < b < c, for which, a^(2) + b^(2) = c^(2) For example, 3^(2) + 4^(2) = 9 + 16 = 25 = 5^(2). There exists exactly one Pythagorean triplet for which a + b + c = 1000. Find the product abc. Source: http://projecteuler.net/index.php?section=problems&id=9 I tried but didn't know where my code went wrong. Here's my code in C: #include <stdio.h> void main() { int a, b, c; for (a = 0; a<=1000; a++) { for (b = 0; b<=1000; b++) { for (c = 0; c<=1000; c++) { if (((a^(2) + b^(2) == c^(2)) && ((a+b+c) ==1000))) printf("a=%d, b=%d, c=%d",a,b,c); } } } return 0; }

    Read the article

  • Rails routing of a controller's functions query

    - by Jty.tan
    So I've got a Users controller, and it has (amongst others) a function called details. The idea is that a user can go to localhost:3000/user/:user_id/details and be able to view the details of :user_id. For example, I have a user called "tester". When I go to the uri: http://localhost:3000/users/tester/details I'd want the details function to be called up, to render the details view, and to display the information for the user tester. But instead I get an error saying that No action responded to tester. Actions: change_password, create, current_user, details, forgot_password, index, login_required, new, redirect_to_stored, show, and update_attributes And I understand that to basically mean that if I wanted to access details, I should really be using http://localhost:3000/users/details Except that that isn't really working either... .< That is instead bringing me to http://localhost:3000/users/details/registries (which is the default path that I'd stipulated for anybody trying to view users/:user_id, so again, that's working the way I wanted it to) Point is: Can anybody help and tell me how I can go about getting users/:user_id/details to work the way I want it to and display the details of :user_id? Thanks!

    Read the article

  • get path of Array (PHP)

    - by Kawah Grafis
    i have an array input like this .. Array ( [0] => Array ( [0] => 42 ) [**42**] => Array ( [0] => 12 [1] => 14 ) [**14**] => Array ( [0] => 317 ) [317] => Array ( [0] => 319 ) [**12**] => Array ( [0] => 306 [1] => 307 ) [307] => Array ( [0] => 311 ) [306] => Array ( [0] => 309 ) ) and i want to get result array like bellow : $paths[]=array(42,12,306,309); $paths[]=array(42,12,307,311); $paths[]=array(42,14,317,319); see array input root in array input = 42 (index of array 0) 42 have child = 12, 14 12 have child = 306, 307 14 have child = 317 306 have child = 309 307 have child = 311 317 have child = 319 like this.. and output array insert into $paths $paths[0]=array(42,12,306,309); $paths[1]=array(42,12,307,311); $paths[2]=array(42,14,317,319);

    Read the article

  • Paperclip: Stay put on edit

    - by EricR
    When a user edits something in my application, they're forced to re-upload their image via paperclip even if they aren't changing it. Failing to do so will cause an error, since I validate_presence_of :image. This is quite annoying. How can I make it so Paperclip won't update its attributes if a user simply doesn't supply a new image on an edit? The photo controller is fresh out of Rails' scaffold generator. The rest of the source code is provided below. models/accommodation.rb class Accommodation < ActiveRecord::Base attr_accessible :photo validates_presence_of :photo has_one :photo has_many :notifications belongs_to :user accepts_nested_attributes_for :photo, :allow_destroy => true end controllers/accommodation_controller.rb class AccommodationsController < ApplicationController def index @accommodations = Accommodation.all end def show @accommodation = Accommodation.find(params[:id]) rescue ActiveRecord::RecordNotFound flash[:error] = "Accommodation not found." redirect_to :home end def new @accommodation = current_user.accommodations.build @accommodation.build_photo end def create @accommodation = current_user.accommodations.build(params[:accommodation]) if @accommodation.save flash[:notice] = "Successfully created your accommodation." redirect_to @accommodation else @accommodation.build_photo render :new end end def edit @accommodation = Accommodation.find(params[:id]) @accommodation.build_photo rescue ActiveRecord::RecordNotFound flash[:error] = "Accommodation not found." redirect_to :home end def update @accommodation = Accommodation.find(params[:id]) if @accommodation.update_attributes(params[:accommodation]) flash[:notice] = "Successfully updated accommodation." redirect_to @accommodation else @accommodation.build_photo render :edit end end def destroy @accommodation = Accommodation.find(params[:id]) @accommodation.destroy flash[:notice] = "Successfully destroyed accommodation." redirect_to :inkeep end end models/photo.rb class Photo < ActiveRecord::Base attr_accessible :image, :primary belongs_to :accommodation has_attached_file :image, :styles => { :thumb=> "100x100#", :small => "150x150>" } end

    Read the article

  • Geohashing - recursively find neighbors of neighbors

    - by itsme
    I am now looking for an elegant algorithm to recursively find neighbors of neighbors with the geohashing algorithm (http://www.geohash.org). Basically take a central geohash, and then get the first 'ring' of same-size hashes around it (8 elements), then, in the next step, get the next ring around the first etc. etc. Have you heard of an elegant way to do so? Brute force could be to take each neighbor and get their neighbors simply ignoring the massive overlap. Neighbors around one central geohash has been solved many times (here e.g. in Ruby: http://github.com/masuidrive/pr_geohash/blob/master/lib/pr_geohash.rb) Edit for clarification: Current solution, with passing in a center key and a direction, like this (with corresponding lookup-tables): def adjacent(geohash, dir) base, lastChr = geohash[0..-2], geohash[-1,1] type = (geohash.length % 2)==1 ? :odd : :even if BORDERS[dir][type].include?(lastChr) base = adjacent(base, dir) end base + BASE32[NEIGHBORS[dir][type].index(lastChr),1] end (extract from Yuichiro MASUI's lib) I say this approach will get ugly soon, because directions gets ugly once we are in ring two or three. The algorithm would ideally simply take two parameters, the center area and the distance from 0 being the center geohash only (["u0m"] and 1 being the first ring made of 8 geohashes of the same size around it (= [["u0t", "u0w"], ["u0q", "u0n"], ["u0j", "u0h"], ["u0k", "u0s"]]). two being the second ring with 16 areas around the first ring etc. Do you see any way to deduce the 'rings' from the bits in an elegant way?

    Read the article

  • Git add not working with .png files?

    - by D Lawson
    I have a dirty working tree, dirty because I made changes to source files and touched up some images. I was trying to add just the images to the index, so I ran this command: git add *.png But, this doesn't add the files. There were a few new image files that were added, but none of the ones that were modified/pre-existing were added. What gives? Edit: Here is some relevant terminal output $ git status # On branch master # # Changed but not updated: # (use "git add <file>..." to update what will be committed) # (use "git checkout -- <file>..." to discard changes in working directory) # # modified: src/main/java/net/plugins/analysis/FormMatcher.java # modified: src/main/resources/icons/doctor_edit_male.png # modified: src/main/resources/icons/doctor_female.png # # Untracked files: # (use "git add <file>..." to include in what will be committed) # # src/main/resources/icons/arrow_up.png # src/main/resources/icons/bullet_arrow_down.png # src/main/resources/icons/bullet_arrow_up.png no changes added to commit (use "git add" and/or "git commit -a") Then executed "git add *.png" (no output after command) Then: $ git status # On branch master # # Changes to be committed: # (use "git reset HEAD <file>..." to unstage) # # new file: src/main/resources/icons/arrow_up.png # new file: src/main/resources/icons/bullet_arrow_down.png # new file: src/main/resources/icons/bullet_arrow_up.png # # Changed but not updated: # (use "git add <file>..." to update what will be committed) # (use "git checkout -- <file>..." to discard changes in working directory) # # modified: src/main/java/net/plugins/analysis/FormMatcher.java # modified: src/main/resources/icons/doctor_edit_female.png # modified: src/main/resources/icons/doctor_edit_male.png

    Read the article

  • Error when trying to overwrite an image (it succeeds the first time after iis reset )

    - by Omu
    First time (after iis reset) I succeed to overwrite the image, but if I try again it gives me that GDI error this is my code: [HttpPost] public ActionResult Change() { var file = Request.Files["fileUpload"]; if (file.ContentLength > 0) { var filePath = @ConfigurationManager.AppSettings["storagePath"] + @"\Temp\" + User.Identity.Name + ".jpg"; using (var image = Image.FromStream(file.InputStream)) { var size = ResizeImage(image, filePath, 600, 480, true); return RedirectToAction("Crop", new CropDisplay {ImageWidth = size[0], ImageHeight = size[1]}); } } return RedirectToAction("Index"); } private int[] ResizeImage(Image image, string newFilePath, int newWidth, int maxHeight, bool onlyResizeIfWider) { ... using (var thumbnail = new Bitmap(newWidth, newHeight)) { using (var graphic = Graphics.FromImage(thumbnail)) { graphic.InterpolationMode = InterpolationMode.HighQualityBicubic; graphic.SmoothingMode = SmoothingMode.HighQuality; graphic.PixelOffsetMode = PixelOffsetMode.HighQuality; graphic.CompositingQuality = CompositingQuality.HighQuality; graphic.DrawImage(image, 0, 0, newWidth, newHeight); var info = ImageCodecInfo.GetImageEncoders(); var encoderParameters = new EncoderParameters(1); encoderParameters.Param[0] = new EncoderParameter(Encoder.Quality, 100L); //this is where I get the GDI error thumbnail.Save(newFilePath, info[1], encoderParameters); return new[] { newWidth, newHeight }; } } }

    Read the article

  • Storing values in the DataValueField and DataTextField of a dropdownlist using a linq query

    - by user1318369
    I have a website for dance academy where Users can register and add/drop dance classes. In the web page to drop a particular dance, for a particular user, the dropdown displays her registered dances. Now I want to delete one of the dances from the list. So I'll remove the row from the table and also from the dropdownlist. The problem is that everytime the item with the lowest ID (index) is getting deleted, no matter which one the user selects. I think I am storing the DataTextField and DataValueField for the dropdown incorrectly. The code is: private void PopulateDanceDropDown() { // Retrieve the username MembershipUser currentUser = Membership.GetUser(); var username = currentUser.UserName; // Retrive the userid of the curren user var dancerIdFromDB = from d in context.DANCER where d.UserName == username select d.UserId; Guid dancerId = new Guid(); var first = dancerIdFromDB.FirstOrDefault(); if (first != null) { dancerId = first; } dances.DataSource = (from dd in context.DANCER_AND_DANCE where dd.UserId == dancerId select new { Text = dd.DanceName, Value = dd.DanceId }).ToList(); dances.DataTextField = "Text"; dances.DataValueField = "Value"; dances.DataBind(); } protected void dropthedance(object o, EventArgs e) { String strDataValueField = dances.SelectedItem.Value; int danceIDFromDropDown = Convert.ToInt32(strDataValueField); var dancer_dance = from dd in context.DANCER_AND_DANCE where dd.DanceId == danceIDFromDropDown select dd; foreach (var dndd in dancer_dance) { context.DANCER_AND_DANCE.DeleteOnSubmit(dndd); } try { context.SubmitChanges(); } catch (Exception ex) { Console.WriteLine(ex); } } The problem is in the line: String strDataValueField = dances.SelectedItem.Value; The strDataValueField is always getting the minimum id from the list of dance item ids in the dropdown (which happens by default). I want this to hold the id of the dance selected by the user.

    Read the article

  • Added CAGradientLayer, getting this in my UIView dealloc: [CALayer release]: message sent to deallocated instance

    - by developerdoug
    Here there, I have a custom UIView. This view acts as a activity indicator but as label above the UIActivityIndicatorView. In the init, I add a CAGradientLayer. I allocate and initialize it and insert it at index 0 as a sublayer of the UIView layer property. In my dealloc method was called, I received a message in the console: - [CALayer release]: message sent to deallocated instance. My code: @interface LabelActivityIndicatorView () { UILabel *_label; UIActivityIndicatorView *_activityIndicatorView; CAGradientLayer *_gradientLayer; } @end @implementation LabelActivityIndicatorView //dealloc - (void) dealloc { [_label release]; [_activityIndicatorView release]; //even tried to remove the layer [_gradientLayer removeFromSuperLayer]; [_gradientLayer release]; [super dealloc]; } // init - (id) initWithFrame:(CGRect)frame { if ( (self = [super initWithFrame:frame]) ) { // init the label // init the gradient layer _gradientLayer = [[CAGradientLayer alloc] init]; [_gradientLayer setBounds:[self bounds]]; [_gradientLayer setPosition:CGPointMake(frame.size.width/2, frame.size.height/2)]; [[self layer] insertSublayer:_gradientLayer atIndex:0]; [[self layer] setNeedsDisplay]; } return self; } @end Anyone have any ideas. Since I'm allocating and initializing the gradient layer I'm responsible for releasing it. I should be able to alloc and init and assign to some ivar. Perhaps I should create a property with retain on it. Thanks,

    Read the article

  • one-to-many with criteria question

    - by brnzn
    enter code hereI want to apply restrictions on the list of items, so only items from a given dates will be retrieved. Here are my mappings: <class name="MyClass" table="MyTable" mutable="false" > <cache usage="read-only"/> <id name="myId" column="myId" type="integer"/> <property name="myProp" type="string" column="prop"/> <list name="items" inverse="true" cascade="none"> <key column="myId"/> <list-index column="itemVersion"/> <one-to-many class="Item"/> </list> </class> <class name="Item" table="Items" mutable="false" > <cache usage="read-only"/> <id name="myId" column="myId" type="integer"/> <property name="itemVersion" type="string" column="version"/> <property name="startDate" type="date" column="startDate"/> </class> I tried this code: Criteria crit = session.createCriteria(MyClass.class); crit.add( Restrictions.eq("myId", new Integer(1))); crit = crit.createCriteria("items").add( Restrictions.le("startDate", new Date()) ); which result the following quires: select ... from MyTable this_ inner join Items items1_ on this_.myId=items1_.myId where this_.myId=? and items1_.startDate<=? followed by select ... from Items items0_ where items0_.myId=? But what I need is something like: select ... from MyTable this_ where this_.myId=? followed by select ... from Items items0_ where items0_.myId=? and items0_.startDate<=? Any idea how I can apply a criteria on the list of items?

    Read the article

  • OCaml delimiters and scopes

    - by Jack
    Hello! I'm learning OCaml and although I have years of experience with imperative programming languages (C, C++, Java) I'm getting some problems with delimiters between declarations or expressions in OCaml syntax. Basically I understood that I have to use ; to concatenate expressions and the value returned by the sequence will be the one of last expression used, so for example if I have exp1; exp2; exp3 it will be considered as an expression that returns the value of exp3. Starting from this I could use let t = something in exp1; exp2; exp3 and it should be ok, right? When am I supposed to use the double semicol ;;? What does it exactly mean? Are there other delimiters that I must use to avoid syntax errors? I'll give you an example: let rec satisfy dtmc state pformula = match (state, pformula) with (state, `Next sformula) -> let s = satisfy_each dtmc sformula and adder a state = let p = 0.; for i = 0 to dtmc.matrix.rows do p <- p +. get dtmc.matrix i state.index done; a +. p in List.fold_left adder 0. s | _ -> [] It gives me syntax error on | but I don't get why.. what am I missing? This is a problem that occurs often and I have to try many different solutions until it suddently works :/ A side question: declaring with let instead that let .. in will define a var binding that lasts whenever after it has been defined? What I basically ask is: what are the delimiters I have to use and when I have to use them. In addition are there differences I should consider while using the interpreter ocaml instead that the compiler ocamlc? Thanks in advance!

    Read the article

  • php while selecting a node should be highlighted.

    - by shaibi
    I need to highlight the node value when I select it.how can I wrirte code for that in php my code is function generate_menu($parent) { $has_childs = false; global $menu_array; foreach($menu_array as $key = $value) { //print_r($value); if ($value['parentid'] == $parent) { if ($has_childs === false) { $has_childs = true; $menu .= '<ul>'; } $clor = 'black'; if(($_GET['id']>0) &&($key == $_GET['id'])) { $clor = '#990000'; } $chld = generate_menu($key); $cls = ($chld != '')? 'folder' : 'file'; $menu .= '<li><span class="'.$cls.'" color='.$clor.'>&nbsp;' . $value['humanid'].'-'.$value['title'] . ' <a href="index.php?id='.$key.'"><img src="images/edit.png" alt=" Edit" title="Edit"/></a></span>'; $menu .= $chld; $menu .= '</li>'; } } if ($has_childs === true) $menu .= '</ul>'; return $menu ; } ?

    Read the article

  • No event is firing when placing a custom data bound control in DataRepeater control in Windows forms

    - by Remo
    Hi, Custom events in a custom data bound control are not firing in DataRepeater control. When I debug it I found that the DataRepeater Control recreates the control using Activator.CreateInstance and Copies the Properties and Events. In my case copying events doesn't copy the custom events that I hooked in. For example public class MyClass : Control { public event EventHandler MyEvent; protected virtual void OnMyEvent() { if(this.MyEvent != null) { this.MyEvent(this,EventArgs.Empty); } } private int selectedIndex= -1; public int SelectedIndex { get { return this.selectedIndex; } set { if(this.selectedIndex != value) { this.selectedIndex = value; this.OnMyEvent(); } } } // // DataBinding stuff goes here // } public Form1() { InitialiseComponent(); ArrayList list = new ArrayList(); list.Add("one"); this.dataRepeater1.DataSource = list; // One Repeater MyClass test = new Myclass(); test.DataSource = GetDataTable(); this.dataRepeater1.ItemTemplate.Controls.Add(test); test.MyEvent +=new EventHandler(test_MyEvent); } // This Event should fire when selected index of Datatable is changed and is firing when placed directly in the form and not firing when place in DataRepeater control/////////////////////// private void test_MyEvent(object sender, EventArgss e) { // This event is not fired/////////////////////// } private DataTable GetDataTable() { ..// Create a data Table and return } Any help Appreciated. Thanks,

    Read the article

  • jQuery / Loading content into div and changing url's (working but buggy)

    - by Bruno
    This is working, but I'm not being able to set an index.html file on my server root where i can specify the first page to go. It also get very buggy in some situations. Basically it's a common site (menu content) but the idea is to load the content without refreshing the page, defining the div to load the content, and make each page accessible by the url. One of the biggest problems here it's dealing with all url situations that may occur. The ideal would be to have a rel="divToLoadOn" and then pass it on my loadContent() function... so I would like or ideas/solutions for this please. Thanks in advance! //if page comes from URL if(window.location.hash != ''){ var url = window.location.hash; url = '..'+url.substr(1, url.length); loadContent(url); } //if page comes from an internal link $("a:not([target])").click(function(e){ e.preventDefault(); var url = $(this).attr("href"); if(url != '#'){ loadContent($(this).attr("href")); } }); //LOAD CONTENT function loadContent(url){ var contentContainer = $("#content"); //set load animation $(contentContainer).ajaxStart(function() { $(this).html('loading...'); }); $.ajax({ url: url, dataType: "html", success: function(data){ //store data globally so it can be used on complete window.data = data; }, complete: function(){ var content = $(data).find("#content").html(); var contentTitle = $(data).find("title").text(); //change url var parsedUrl = url.substr(2,url.length) window.location.hash = parsedUrl; //change title var titleRegex = /(.*)<\/title/.exec(data); contentTitle = titleRegex[1]; document.title = contentTitle; //renew content $(contentContainer).fadeOut(function(){ $(this).html(content).fadeIn(); }); }); }

    Read the article

  • IE7 & IE8 error executing function with ajax

    - by Yahreen
    I am loading an ajax page which executes an HTML5 video player script. The function for the Flash fallback is html5media(); : //Load 1st Case Study $("#splash").live('click', function (e) { $(this).fadeOut('slow', function () { $('#case-studies').load('case-study-1.html', function() { html5media(); //initiate Flash fallback }).fadeIn(); }); e.preventDefault(); }); This initial page load works fine in IE7 & IE8. The problem is once this page is loaded, there are links to 4 more videos which are loaded in again using ajax. I use this function: //Switcher function csClients(url, client) { $("#case-studies").fadeOut('slow', function() { $('#case-studies').load(url, function () { html5media(); //initiate Flash fallback }).fadeIn(); }); } //Page Loader $("#cs-client-list li.client1 a").live('click', function(e) { csClients('case-study-1.html', 'client1'); e.preventDefault(); }); Originally I was using return false; but none of the sub-page Flash videos would load in IE7. When I switched to preventDefault, the videos loaded in IE7 but still not in IE8. I also get a weird error in both IE7 & IE8 with no helpful feedback: Error on Page: Unspecified error. / (Line 49) Code: 0 (Char 5) URI: http://www.mysite.com This is line 49 in my index page: <section id="case-studies" class="main-section"> I have a feeling it has to do with calling html5media(); too many times? At a loss...

    Read the article

  • how to get data from another file?

    - by Ronnie Chester Lynwood
    hey guys i got this jquery codes: jQuery(function ($) { var OSX = { container: null, init: function () { $("input.osx, a.osx").click(function (e) { e.preventDefault(); $("#osx-modal-content").modal({ overlayId: 'osx-overlay', containerId: 'osx-container', closeHTML: null, minHeight: 80, opacity: 65, position: ['0',], overlayClose: true, onOpen: OSX.open, onClose: OSX.close }); }); }, open: function (d) { var self = this; self.container = d.container[0]; d.overlay.fadeIn('slow', function () { $("#osx-modal-content", self.container).show(); var title = $("#osx-modal-title", self.container); title.show(); d.container.slideDown('slow', function () { setTimeout(function () { var h = $("#osx-modal-data", self.container).height() + title.height() + 20; // padding d.container.animate( {height: h}, 200, function () { $("div.close", self.container).show(); $("#osx-modal-data", self.container).show(); } ); }, 300); }); }) }, close: function (d) { var self = this; // this = SimpleModal object d.container.animate( {top:"-" + (d.container.height() + 20)}, 500, function () { self.close(); // or $.modal.close(); } ); } }; OSX.init(); }); this js is gets #osx-modal-content,#osx-modal-title,#osx-modal-data from index.php. how can i get divs from another page? thanks

    Read the article

< Previous Page | 448 449 450 451 452 453 454 455 456 457 458 459  | Next Page >