Search Results

Search found 12857 results on 515 pages for 'spatial index'.

Page 452/515 | < Previous Page | 448 449 450 451 452 453 454 455 456 457 458 459  | Next Page >

  • Is there a better way to change user password in cakephp using Auth?

    - by sipiatti
    Hi, I am learning cakephp by myself. I tried to create a user controller with a changepassword function. It works, but I am not sure if this is the best way, and I could not googled up useful tutorials on this. Here is my code: class UsersController extends AppController { var $name = 'Users'; function login() { } function logout() { $this->redirect($this->Auth->logout()); } function changepassword() { $session=$this->Session->read(); $id=$session['Auth']['User']['id']; $user=$this->User->find('first',array('conditions' => array('id' => $id))); $this->set('user',$user); if (!empty($this->data)) { if ($this->Auth->password($this->data['User']['password'])==$user['User']['password']) { if ($this->data['User']['passwordn']==$this->data['User']['password2']) { // Passwords match, continue processing $data=$this->data; $this->data=$user; $this->data['User']['password']=$this->Auth->password($data['User']['passwordn']); $this->User->id=$id; $this->User->save($this->data); $this->Session->setFlash('Password changed.'); $this->redirect(array('controller'=>'Toners','action' => 'index')); } else { $this->Session->setFlash('New passwords differ.'); } } else { $this->Session->setFlash('Typed passwords did not match.'); } } } } password is the old password, passwordn is the new one, password2 is the new one retyped. Is there any other, more coomon way to do it in cake?

    Read the article

  • [LaTeX] positions of page numbers, position of chapter headings, chapters AND Table of Contents, Ref

    - by kaikanmonaco
    I am writing my PhD thesis (120+ pages) in latex, the deadline is approaching and I am struggling with layout problems. I am using the documentstyle book. I am posting both problems in this one thread because I am not sure if the solution might be related to both problems or not. Problems are: 1.) The page numbers are mostly located on the top-right of each page (this is correct and where I want them to be). However, only on the first page of chapters and on the first page of what I call "special chapters", the page number is located bottom-centered. With "special chapters" I mean: List of Contents, List of Figures, List of Tables, References, Index. My university will not accept the thesis like this. The page number must ALWAYS be top-right one each page, even if the page is the first page of a chapter or the first page of something like the List of Contents. How can I fix this? 2.) On the first page of chapters and "special chapters" (List of Contents...), the chapter title is located far too low on the page. This is the standard layout of LaTeX with documentstyle book I think. However, the chapter title must start at the very top of the page! I.e. the same height as the normal text on the pages that follow. I mean the chapter title, not the header. I.e., if there is a chapter called "Chapter 1 Dynamics of foobar under mechanical stress" then that text has to start from the top the page, but right now it starts several centimeters below the top. How can I fix this? Have tried all kinds of things to no effect, I'd be very thankful for a solution! Thanks.

    Read the article

  • odp.net SQL query retrieve set of rows from two input arrays.

    - by Karl Trumstedt
    I have a table with a primary key consisting of two columns. I want to retrieve a set of rows based on two input arrays, each corresponding to one primary key column. select pkt1.id, pkt1.id2, ... from PrimaryKeyTable pkt1, table(:1) t1, table(:2) t2 where pkt1.id = t1.column_value and pkt1.id2 = t2.column_value I then bind the values with two int[] in odp.net. This returns all different combinations of my resulting rows. So if I am expecting 13 rows I receive 169 rows (13*13). The problem is that each value in t1 and t2 should be linked. Value t1[4] should be used with t2[4] and not all the different values in t2. Using distinct solves my problem, but I'm wondering if my approach is wrong. Anyone have any pointers on how to solve this the best way? One way might be to use a for-loop accessing each index in t1 and t2 sequentially, but I wonder what will be more efficient. Edit: actually distinct won't solve my problem, it just did it based on my input-values (all values in t2 = 0)

    Read the article

  • Show iPad keyboard on select, focus or always (jQuery)

    - by Ryan
    I have a web app that is using jQuery to replace the RETURN key with TAB so that when I user presses return the form is not submitted but rather the cursor moves to the next text field. This works in all browsers but only 1/2 works on the iPad. On the iPad the next field is highlighted but the keyboard is hidden. How can I keep the keyboard visible or force it somehow? Here's my code (thanks to http://thinksimply.com/blog/jquery-enter-tab): function checkForEnter (event) { if (event.keyCode == 13) { currentBoxNumber = textboxes.index(this); if (textboxes[currentBoxNumber + 1] != null) { nextBox = textboxes[currentBoxNumber + 1] nextBox.focus(); nextBox.select(); event.preventDefault(); return false; } } } Drupal.behaviors.formFields = function(context) { $('input[type="text"]').focus(function() { $(this).removeClass("idleField").addClass("focusField"); }); $('input[type="text"]').blur(function() { $(this).removeClass("focusField").addClass("idleField"); }); // replaces the enter/return key function with tab textboxes = $("input.form-text"); if ($.browser.mozilla) { $(textboxes).keypress (checkForEnter); } else { $(textboxes).keydown (checkForEnter); } };

    Read the article

  • A little confused about MVC and where to put a database query

    - by jax
    OK, so my Joomla app is in MVC format. I am still a little confused about where to put certain operations, in the Controller or in the Model. This function below is in the controller, it gets called when &task=remove. Should the database stuff be in the Model? It does not seem to fit there because I have two models editapp (display a single application) and allapps (display all the applications), now which one would I put the delete operation in? /** * Delete an application */ function remove() { global $mainframe; $cid = JRequest::getVar( 'cid', array(), '', 'array' ); $db =& JFactory::getDBO(); //if there are items to delete if(count($cid)){ $cids = implode( ',', $cid ); $query = "DELETE FROM #__myapp_apps WHERE id IN ( $cids )"; $db->setQuery( $query ); if (!$db->query()){ echo "<script> alert('".$db->getErrorMsg()."');window.history.go(-1); </script>\n"; } } $mainframe->redirect( 'index.php?option=' . $option . '&c=apps'); } I am also confused about how the flow works. For example, there is a display() function in the controller that gets called by default. If I pass a task, does the display() function still run or does it go directly to the function name passed by $task?

    Read the article

  • Issue with transparent texture on 3D primitive, XNA 4.0

    - by Bevin
    I need to draw a large set of cubes, all with (possibly) unique textures on each side. Some of the textures also have parts of transparency. The cubes that are behind ones with transparent textures should show through the transparent texture. However, it seems that the order in which I draw the cubes decides if the transparency works or not, which is something I want to avoid. Look here: cubeEffect.CurrentTechnique = cubeEffect.Techniques["Textured"]; Block[] cubes = new Block[4]; cubes[0] = new Block(BlockType.leaves, new Vector3(0, 0, 3)); cubes[1] = new Block(BlockType.dirt, new Vector3(0, 1, 3)); cubes[2] = new Block(BlockType.log, new Vector3(0, 0, 4)); cubes[3] = new Block(BlockType.gold, new Vector3(0, 1, 4)); foreach(Block b in cubes) { b.shape.RenderShape(GraphicsDevice, cubeEffect); } This is the code in the Draw method. It produces this result: As you can see, the textures behind the leaf cube are not visible on the other side. When i reverse index 3 and 0 on in the array, I get this: It is clear that the order of drawing is affecting the cubes. I suspect it may have to do with the blend mode, but I have no idea where to start with that.

    Read the article

  • OCaml delimiters and scopes

    - by Jack
    Hello! I'm learning OCaml and although I have years of experience with imperative programming languages (C, C++, Java) I'm getting some problems with delimiters between declarations or expressions in OCaml syntax. Basically I understood that I have to use ; to concatenate expressions and the value returned by the sequence will be the one of last expression used, so for example if I have exp1; exp2; exp3 it will be considered as an expression that returns the value of exp3. Starting from this I could use let t = something in exp1; exp2; exp3 and it should be ok, right? When am I supposed to use the double semicol ;;? What does it exactly mean? Are there other delimiters that I must use to avoid syntax errors? I'll give you an example: let rec satisfy dtmc state pformula = match (state, pformula) with (state, `Next sformula) -> let s = satisfy_each dtmc sformula and adder a state = let p = 0.; for i = 0 to dtmc.matrix.rows do p <- p +. get dtmc.matrix i state.index done; a +. p in List.fold_left adder 0. s | _ -> [] It gives me syntax error on | but I don't get why.. what am I missing? This is a problem that occurs often and I have to try many different solutions until it suddently works :/ A side question: declaring with let instead that let .. in will define a var binding that lasts whenever after it has been defined? What I basically ask is: what are the delimiters I have to use and when I have to use them. In addition are there differences I should consider while using the interpreter ocaml instead that the compiler ocamlc? Thanks in advance!

    Read the article

  • Windows Phone - failing to get a string from a website with login information

    - by jumantyn
    I am new to accessing web services with Windows Phone 7/8. I'm using a WebClient to get a string from a php-website. The site returns a JSON string but at the moment I'm just trying to put it into a TextBox as a normal string just to test if the connection works. The php-page requires an authentication and I think that's where my code is failing. Here's my code: WebClient client = new WebClient(); client.Credentials = new NetworkCredential("myUsername", "myPassword"); client.DownloadStringCompleted += new DownloadStringCompletedEventHandler(client_DownloadStringCompleted); client.DownloadStringAsync(new Uri("https://www.mywebsite.com/ba/php/jsonstuff.php")); void client_DownloadStringCompleted(object sender, DownloadStringCompletedEventArgs e) { try { string data = e.Result; this.jsonText.Text = data; } catch (Exception ex) { System.Diagnostics.Debug.WriteLine(ex.Message); } } This returns first a WebException and then a TargetInvocationException. If I replace the Uri with for example "http://www.google.com/index.html" the jsonText TextBox gets filled with html text from Google (oddly enough, this also works even when the WebClient credentials are still set). So is the problem in the setting of the credentials? I couldn't find any good results when searching for guides on how to access php-pages with credentials, only without them. Then I found a short mention somewhere to use the WebClient.Credentials property. But should it work some other way? Update: here's what I can get out of the WebException (sorry for the bad formatting): System.Net.WebException: The remote server returned an error: NotFound. ---System.Net.WebException: The remote server returned an error: NotFound. at System.Net.Browser.ClientHttpWebRequest.InternalEndGetResponse(IAsyncResult asyncResult) at System.Net.Browser.ClientHttpWebRequest.<c_DisplayClasse.b_d(Object sendState) at System.Net.Browser.AsyncHelper.<c_DisplayClass1.b_0(Object sendState) --- End of inner exception stack trace --- at System.Net.Browser.AsyncHelper.BeginOnUI(SendOrPostCallback beginMethod, Object state) at System.Net.Browser.ClientHttpWebRequest.EndGetResponse(IAsyncResult asyncResult) at System.Net.WebClient.GetWebResponse(WebRequest request, IAsyncResult result) at System.Net.WebClient.DownloadBitsResponseCallback(IAsyncResult result)

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Why doesn't this PHP execute?

    - by cam
    I copied the code from this site exactly: http://davidwalsh.name/web-service-php-mysql-xml-json as follows, /* require the user as the parameter */ if(isset($_GET['user']) && intval($_GET['user'])) { /* soak in the passed variable or set our own */ $number_of_posts = isset($_GET['num']) ? intval($_GET['num']) : 10; //10 is the default $format = strtolower($_GET['format']) == 'json' ? 'json' : 'xml'; //xml is the default $user_id = intval($_GET['user']); //no default /* connect to the db */ $link = mysql_connect('localhost','username','password') or die('Cannot connect to the DB'); mysql_select_db('db_name',$link) or die('Cannot select the DB'); /* grab the posts from the db */ $query = "SELECT post_title, guid FROM wp_posts WHERE post_author = $user_id AND post_status = 'publish' ORDER BY ID DESC LIMIT $number_of_posts"; $result = mysql_query($query,$link) or die('Errant query: '.$query); /* create one master array of the records */ $posts = array(); if(mysql_num_rows($result)) { while($post = mysql_fetch_assoc($result)) { $posts[] = array('post'=>$post); } } /* output in necessary format */ if($format == 'json') { header('Content-type: application/json'); echo json_encode(array('posts'=>$posts)); } else { header('Content-type: text/xml'); echo '<posts>'; foreach($posts as $index => $post) { if(is_array($post)) { foreach($post as $key => $value) { echo '<',$key,'>'; if(is_array($value)) { foreach($value as $tag => $val) { echo '<',$tag,'>',htmlentities($val),'</',$tag,'>'; } } echo '</',$key,'>'; } } } echo '</posts>'; } /* disconnect from the db */ @mysql_close($link); } And the php doesn't execute, it just displays as plain text. What's the dealio? The host supports PHP, I use it to run a Wordpress blog and other things.

    Read the article

  • Have something loaded only when JList item is visibile

    - by elvencode
    Hello, i'm implementing a Jlist populated with a lot of elements. Each element corresponds to a image so i'd like to show a resized preview of them inside each row of the list. I've implemented a custom ImageCellRenderer extending the Jlabel and on getListCellRendererComponent i create the thumbnail if there'snt any for that element. Each row corresponds to a Page class where i store the path of the image and the icon applied to the JLabel. Each Page object is put inside a DefaultListModel to populate the JList. The render code is something like this: public Component getListCellRendererComponent( JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { Page page = (Page) value; if (page.getImgIcon() == null) { System.out.println(String.format("Creating thumbnail of %s", page.getImgFilename())); ImageIcon icon = new ImageIcon(page.getImgFilename()); int thumb_width = icon.getIconWidth() > icon.getIconHeight() ? 128 : ((icon.getIconWidth() * 128) / icon.getIconHeight()); int thumb_height = icon.getIconHeight() > icon.getIconWidth() ? 128 : ((icon.getIconHeight() * 128) / icon.getIconWidth()); icon.setImage(getScaledImage(icon.getImage(), thumb_width, thumb_height)); page.setImgIcon(icon); } setIcon(page.getImgIcon()); } I was thinking that only a certain item is visibile in the List the cell renderer is called but i'm seeing that all the thumnails are created when i add the Page object to the list model. I've tried to load the items and after set the model in the JList or set the model first and after starting appending the items but the results are the same. Is there any way to load the data only when necessary or do i need to create a custom control like a JScrollPanel with stacked items inside where i check myself the visibility of each elements? Thanks

    Read the article

  • Error in bisection method code in Matlab

    - by Amanda Collins
    I need to write a proper implementation of the bisection method, which means I must address all possible user input errors. Here is my code: function [x_sol, f_at_x_sol, N_iterations] = bisection(f, xn, xp, eps_f, eps_x) % solving f(x)=0 with bisection method % f is the function handle to the desired function, % xn and xp are borders of search, % f(xn)<0 and f(xp)>0 required, % eps_f defines how close f(x) should be to zero, % eps_x defines uncertainty of solution x if(f(xp) < 0) error('xp must be positive') end; if(f(xn)>0) error('xn must be negative') end; if (xn >= xp) error ('xn must be less than xp') end; xg=(xp+xn)/2; %initial guess fg=f(xg); % initial function evaluation N_iterations=1; while ( (abs(fg) > eps_f) & (abs(xg-xp) > eps_x) ) if (fg>0) xp=xg; else xn=xg; end xg=(xp+xn)/2; %update guess fg=f(xg); %update function evaluation N_iterations=N_iterations+1; end x_sol=xg; %solution is ready f_at_x_sol=fg; if (f_at_x_sol > eps_f) error('No convergence') end and here is the error message I receive when I try to test this in Matlab: >> bisection(x.^2, 2, -1, 1e-8, 1e-10) Attempted to access f(-1); index must be a positive integer or logical. Error in bisection (line 9) if(f(xp)<0) I was attempting to see if my error codes worked, but it doesn't look like they do. I get the same error when I try to test it on a function that should work.

    Read the article

  • No event is firing when placing a custom data bound control in DataRepeater control in Windows forms

    - by Remo
    Hi, Custom events in a custom data bound control are not firing in DataRepeater control. When I debug it I found that the DataRepeater Control recreates the control using Activator.CreateInstance and Copies the Properties and Events. In my case copying events doesn't copy the custom events that I hooked in. For example public class MyClass : Control { public event EventHandler MyEvent; protected virtual void OnMyEvent() { if(this.MyEvent != null) { this.MyEvent(this,EventArgs.Empty); } } private int selectedIndex= -1; public int SelectedIndex { get { return this.selectedIndex; } set { if(this.selectedIndex != value) { this.selectedIndex = value; this.OnMyEvent(); } } } // // DataBinding stuff goes here // } public Form1() { InitialiseComponent(); ArrayList list = new ArrayList(); list.Add("one"); this.dataRepeater1.DataSource = list; // One Repeater MyClass test = new Myclass(); test.DataSource = GetDataTable(); this.dataRepeater1.ItemTemplate.Controls.Add(test); test.MyEvent +=new EventHandler(test_MyEvent); } // This Event should fire when selected index of Datatable is changed and is firing when placed directly in the form and not firing when place in DataRepeater control/////////////////////// private void test_MyEvent(object sender, EventArgss e) { // This event is not fired/////////////////////// } private DataTable GetDataTable() { ..// Create a data Table and return } Any help Appreciated. Thanks,

    Read the article

  • Echoing users by group name in PHP

    - by BobSapp
    What I want to do is click a name of a group(every group what I create other than poweruser and admin groups) and that will echo all of the users in that group from the database. I have figured out the code so far but now my problem is how will I print it all out when clicking the name of the group? My code so far is: <h3>Groups</h3> <?php include('db.php'); if (isset($_GET["groupID"])) { $sql="SELECT `group`.*, `user`.* FROM `user` inner join `group` on group.groupID=user.groupID where group.groupID= " . mysql_real_escape_string($_GET["groupID"]) ; } else { $sql="SELECT * FROM `group` WHERE groupName <> 'admin' AND groupName <> 'poweruser'" ; } $result=mysql_query($sql,$connection); while($line=mysql_fetch_array($result)){ echo "<a href='index.php?page=groups&group=".$line['groupID']."'>".$line['groupName'].'</a><br />'; } mysql_free_result($result); mysql_close($connection); ?>

    Read the article

  • grails question (sample 1 of Grails To Action book) problem with Controller and Service

    - by fegloff
    Hi, I'm doing Grails To Action sample for chapter one. Every was just fine until I started to work with Services. When I run the app I have the following error: groovy.lang.MissingPropertyException: No such property: quoteService for class: qotd.QuoteController at qotd.QuoteController$_closure3.doCall(QuoteController.groovy:14) at qotd.QuoteController$_closure3.doCall(QuoteController.groovy) at java.lang.Thread.run(Thread.java:619) Here is my groovie QuoteService class, which has an error within the definition of GetStaticQuote (ERROR: Groovy:unable to resolve class Quote) package qotd class QuoteService { boolean transactional = false def getRandomQuote() { def allQuotes = Quote.list() def randomQuote = null if (allQuotes.size() > 0) { def randomIdx = new Random().nextInt(allQuotes.size()) randomQuote = allQuotes[randomIdx] } else { randomQuote = getStaticQuote() } return randomQuote } def getStaticQuote() { return new Quote(author: "Anonymous",content: "Real Programmers Don't eat quiche") } } Controller groovie class package qotd class QuoteController { def index = { redirect(action: random) } def home = { render "<h1>Real Programmers do not each quiche!</h1>" } def random = { def randomQuote = quoteService.getRandomQuote() [ quote : randomQuote ] } def ajaxRandom = { def randomQuote = quoteService.getRandomQuote() render "<q>${randomQuote.content}</q>" + "<p>${randomQuote.author}</p>" } } Quote Class: package qotd class Quote { String content String author Date created = new Date() static constraints = { author(blank:false) content(maxSize:1000, blank:false) } } I'm doing the samples using Eclipse with grails addin. Any advice? Regards, Francisco

    Read the article

  • How do I call +class methods in Objective C without referencing the class?

    - by TimM
    I have a series of "policy" objects which I thought would be convenient to implement as class methods on a set of policy classes. I have specified a protocol for this, and created classes to conform to (just one shown below) @protocol Counter +(NSInteger) countFor: (Model *)model; @end @interface CurrentListCounter : NSObject <Counter> +(NSInteger) countFor: (Model *)model; @end I then have an array of the classes that conform to this protocol (like CurrentListCounter does) +(NSArray *) availableCounters { return [[[NSArray alloc] initWithObjects: [CurrentListCounter class],[AllListsCounter class], nil] autorelease]; } Notice how I am using the classes like objects (and this might be my problem - in Smalltalk classes are objects like everything else - I'm not sure if they are in Objective-C?) My exact problem is when I want to call the method when I take one of the policy objects out of the array: id<Counter> counter = [[MyModel availableCounters] objectAtIndex: self.index]; return [counter countFor: self]; I get a warning on the return statement - it says -countFor: not found in protocol (so its assuming its an instance method where I want to call a class method). However as the objects in my array are instances of class, they are now like instance methods (or conceptually they should be). Is there a magic way to call class methods? Or is this just a bad idea and I should just create instances of my policy objects (and not use class methods)?

    Read the article

  • Storing values in the DataValueField and DataTextField of a dropdownlist using a linq query

    - by user1318369
    I have a website for dance academy where Users can register and add/drop dance classes. In the web page to drop a particular dance, for a particular user, the dropdown displays her registered dances. Now I want to delete one of the dances from the list. So I'll remove the row from the table and also from the dropdownlist. The problem is that everytime the item with the lowest ID (index) is getting deleted, no matter which one the user selects. I think I am storing the DataTextField and DataValueField for the dropdown incorrectly. The code is: private void PopulateDanceDropDown() { // Retrieve the username MembershipUser currentUser = Membership.GetUser(); var username = currentUser.UserName; // Retrive the userid of the curren user var dancerIdFromDB = from d in context.DANCER where d.UserName == username select d.UserId; Guid dancerId = new Guid(); var first = dancerIdFromDB.FirstOrDefault(); if (first != null) { dancerId = first; } dances.DataSource = (from dd in context.DANCER_AND_DANCE where dd.UserId == dancerId select new { Text = dd.DanceName, Value = dd.DanceId }).ToList(); dances.DataTextField = "Text"; dances.DataValueField = "Value"; dances.DataBind(); } protected void dropthedance(object o, EventArgs e) { String strDataValueField = dances.SelectedItem.Value; int danceIDFromDropDown = Convert.ToInt32(strDataValueField); var dancer_dance = from dd in context.DANCER_AND_DANCE where dd.DanceId == danceIDFromDropDown select dd; foreach (var dndd in dancer_dance) { context.DANCER_AND_DANCE.DeleteOnSubmit(dndd); } try { context.SubmitChanges(); } catch (Exception ex) { Console.WriteLine(ex); } } The problem is in the line: String strDataValueField = dances.SelectedItem.Value; The strDataValueField is always getting the minimum id from the list of dance item ids in the dropdown (which happens by default). I want this to hold the id of the dance selected by the user.

    Read the article

  • Magento products will not show in category

    - by Aaron
    I've recently been tasked with the build and deployment of a large Ecommerce site. In the past we've had to use the clients legacy X-cart installation for redevelopment (too far integrated with their existing work flow). We'd heard good things about Magento, so I've set up a test install to get to grips with it. After a couple of initial issues, there is a live development site which displays categories on the default theme. The problem we've hit now is that products don't display..! After a lot more in-depth research into this, all I've been able to discover is that quite a number of developers endorse using other solutions entirely, with the other 50% saying after the steep learning curve the platform is as wonderful as we'd initially been led to believe. Now, my test category is showing, so I know this is configured properly. I've set up three test products and associated them with this (all done following the Magento user guide), checked double checked and thrice checked the products are enabled and visible individually, yet still the front end says the category has no products in it. I've cleared the cache repeatedly, reset everything possible many times in index management - no products show up. I have to make a call tomorrow morning on whether we're going ahead with Magento. If I can't even get it to show products I'm going to have to go with something with a more established track record and more community support available. Can anybody advise what could possibly be wrong here?

    Read the article

  • integrating jquery with AJAX using MVC for ddl/html.dropdownlist

    - by needhelp
    the situation: a user on the page in question selects a category from a dropdown which then dynamically populates all the users of that category in a second dropdown beside it. all the data is being retrieved using LinqtoSQL and i was wondering if this can be done a) using html.dropdownlist in a strongly typed view? b) using jquery to trigger the ajax request on selected index change instead of a 'populate' button trigger? sorry i dont have code as what i was trying really wasnt working at all. I am having trouble with how to do it conceptually and programatically! will appreciate any links to examples etc greatly! thanks in advance! EDIT: this is kind of what i was trying to achieve.. first the ViewPage: <script type="text/javascript"> $(document).ready function TypeSearch() { $.getJSON("/Home/Type", null, function(data) { //dont know what to do here }); } </script> <p> <label for="userType">userType:</label> <%= Html.DropDownList("userType") %> <%= Html.ValidationMessage("userType", "*") %> <input type="submit" runat="server" onclick="TypeSearch()" /> <label for="accountNumber">accountNumber:</label> <%= Html.DropDownList("accountNumber") %> <%= Html.ValidationMessage("accountNumber", "*") %> </p> Then home controller action: public ActionResult Type() { string accountType = dropdownvalue; List<Account> accounts = userRep.GetAccountsByType(accountType).ToList(); return Json(accounts); }

    Read the article

  • php while selecting a node should be highlighted.

    - by shaibi
    I need to highlight the node value when I select it.how can I wrirte code for that in php my code is function generate_menu($parent) { $has_childs = false; global $menu_array; foreach($menu_array as $key = $value) { //print_r($value); if ($value['parentid'] == $parent) { if ($has_childs === false) { $has_childs = true; $menu .= '<ul>'; } $clor = 'black'; if(($_GET['id']>0) &&($key == $_GET['id'])) { $clor = '#990000'; } $chld = generate_menu($key); $cls = ($chld != '')? 'folder' : 'file'; $menu .= '<li><span class="'.$cls.'" color='.$clor.'>&nbsp;' . $value['humanid'].'-'.$value['title'] . ' <a href="index.php?id='.$key.'"><img src="images/edit.png" alt=" Edit" title="Edit"/></a></span>'; $menu .= $chld; $menu .= '</li>'; } } if ($has_childs === true) $menu .= '</ul>'; return $menu ; } ?

    Read the article

  • How to start matching and saving matched from exact point in a text

    - by yuliya
    I have a text and I write a parser for it using regular expressions and perl. I can match what I need with two empty lines (I use regexp), because there is a pattern that allows recognize blocks of text after two empty lines. But the problem is that the whole text has Introduction part and some text in the end I do not need. Here is a code which matches text when it finds two empty lines #!/usr/bin/perl use strict; use warnings; my $file = 'first'; open(my $fh, '<', $file); my $empty = 0; my $block_num = 1; open(OUT, '>', $block_num . '.txt'); while (my $line = <$fh>) { chomp ($line); if ($line =~ /^\s*$/) { $empty++; } elsif ($empty == 2) { close(OUT); open(OUT, '>', ++$block_num . '.txt'); $empty = 0; } else { $empty = 0;} print OUT "$line\n"; } close(OUT); This is example of the text I need (it's really small :)) this is file example I think that I need to iterate over the text till the moment it will find the word LOREM IPSUM with regexps this kind "/^LOREM IPSUM/", because it is the point from which needed text starts(and save the text in one file when i reach the word). And I need to finish iterating over the text when INDEX word is fount or save the text in separate file. How could I implement it. Should I use next function to proceed with lines or what? BR, Yuliya

    Read the article

  • Paperclip: Stay put on edit

    - by EricR
    When a user edits something in my application, they're forced to re-upload their image via paperclip even if they aren't changing it. Failing to do so will cause an error, since I validate_presence_of :image. This is quite annoying. How can I make it so Paperclip won't update its attributes if a user simply doesn't supply a new image on an edit? The photo controller is fresh out of Rails' scaffold generator. The rest of the source code is provided below. models/accommodation.rb class Accommodation < ActiveRecord::Base attr_accessible :photo validates_presence_of :photo has_one :photo has_many :notifications belongs_to :user accepts_nested_attributes_for :photo, :allow_destroy => true end controllers/accommodation_controller.rb class AccommodationsController < ApplicationController def index @accommodations = Accommodation.all end def show @accommodation = Accommodation.find(params[:id]) rescue ActiveRecord::RecordNotFound flash[:error] = "Accommodation not found." redirect_to :home end def new @accommodation = current_user.accommodations.build @accommodation.build_photo end def create @accommodation = current_user.accommodations.build(params[:accommodation]) if @accommodation.save flash[:notice] = "Successfully created your accommodation." redirect_to @accommodation else @accommodation.build_photo render :new end end def edit @accommodation = Accommodation.find(params[:id]) @accommodation.build_photo rescue ActiveRecord::RecordNotFound flash[:error] = "Accommodation not found." redirect_to :home end def update @accommodation = Accommodation.find(params[:id]) if @accommodation.update_attributes(params[:accommodation]) flash[:notice] = "Successfully updated accommodation." redirect_to @accommodation else @accommodation.build_photo render :edit end end def destroy @accommodation = Accommodation.find(params[:id]) @accommodation.destroy flash[:notice] = "Successfully destroyed accommodation." redirect_to :inkeep end end models/photo.rb class Photo < ActiveRecord::Base attr_accessible :image, :primary belongs_to :accommodation has_attached_file :image, :styles => { :thumb=> "100x100#", :small => "150x150>" } end

    Read the article

  • one-to-many with criteria question

    - by brnzn
    enter code hereI want to apply restrictions on the list of items, so only items from a given dates will be retrieved. Here are my mappings: <class name="MyClass" table="MyTable" mutable="false" > <cache usage="read-only"/> <id name="myId" column="myId" type="integer"/> <property name="myProp" type="string" column="prop"/> <list name="items" inverse="true" cascade="none"> <key column="myId"/> <list-index column="itemVersion"/> <one-to-many class="Item"/> </list> </class> <class name="Item" table="Items" mutable="false" > <cache usage="read-only"/> <id name="myId" column="myId" type="integer"/> <property name="itemVersion" type="string" column="version"/> <property name="startDate" type="date" column="startDate"/> </class> I tried this code: Criteria crit = session.createCriteria(MyClass.class); crit.add( Restrictions.eq("myId", new Integer(1))); crit = crit.createCriteria("items").add( Restrictions.le("startDate", new Date()) ); which result the following quires: select ... from MyTable this_ inner join Items items1_ on this_.myId=items1_.myId where this_.myId=? and items1_.startDate<=? followed by select ... from Items items0_ where items0_.myId=? But what I need is something like: select ... from MyTable this_ where this_.myId=? followed by select ... from Items items0_ where items0_.myId=? and items0_.startDate<=? Any idea how I can apply a criteria on the list of items?

    Read the article

  • Geohashing - recursively find neighbors of neighbors

    - by itsme
    I am now looking for an elegant algorithm to recursively find neighbors of neighbors with the geohashing algorithm (http://www.geohash.org). Basically take a central geohash, and then get the first 'ring' of same-size hashes around it (8 elements), then, in the next step, get the next ring around the first etc. etc. Have you heard of an elegant way to do so? Brute force could be to take each neighbor and get their neighbors simply ignoring the massive overlap. Neighbors around one central geohash has been solved many times (here e.g. in Ruby: http://github.com/masuidrive/pr_geohash/blob/master/lib/pr_geohash.rb) Edit for clarification: Current solution, with passing in a center key and a direction, like this (with corresponding lookup-tables): def adjacent(geohash, dir) base, lastChr = geohash[0..-2], geohash[-1,1] type = (geohash.length % 2)==1 ? :odd : :even if BORDERS[dir][type].include?(lastChr) base = adjacent(base, dir) end base + BASE32[NEIGHBORS[dir][type].index(lastChr),1] end (extract from Yuichiro MASUI's lib) I say this approach will get ugly soon, because directions gets ugly once we are in ring two or three. The algorithm would ideally simply take two parameters, the center area and the distance from 0 being the center geohash only (["u0m"] and 1 being the first ring made of 8 geohashes of the same size around it (= [["u0t", "u0w"], ["u0q", "u0n"], ["u0j", "u0h"], ["u0k", "u0s"]]). two being the second ring with 16 areas around the first ring etc. Do you see any way to deduce the 'rings' from the bits in an elegant way?

    Read the article

  • get path of Array (PHP)

    - by Kawah Grafis
    i have an array input like this .. Array ( [0] => Array ( [0] => 42 ) [**42**] => Array ( [0] => 12 [1] => 14 ) [**14**] => Array ( [0] => 317 ) [317] => Array ( [0] => 319 ) [**12**] => Array ( [0] => 306 [1] => 307 ) [307] => Array ( [0] => 311 ) [306] => Array ( [0] => 309 ) ) and i want to get result array like bellow : $paths[]=array(42,12,306,309); $paths[]=array(42,12,307,311); $paths[]=array(42,14,317,319); see array input root in array input = 42 (index of array 0) 42 have child = 12, 14 12 have child = 306, 307 14 have child = 317 306 have child = 309 307 have child = 311 317 have child = 319 like this.. and output array insert into $paths $paths[0]=array(42,12,306,309); $paths[1]=array(42,12,307,311); $paths[2]=array(42,14,317,319);

    Read the article

< Previous Page | 448 449 450 451 452 453 454 455 456 457 458 459  | Next Page >