Search Results

Search found 12857 results on 515 pages for 'spatial index'.

Page 454/515 | < Previous Page | 450 451 452 453 454 455 456 457 458 459 460 461  | Next Page >

  • Python lists/arrays: disable negative indexing wrap-around

    - by wim
    While I find the negative number wraparound (i.e. A[-2] indexing the second-to-last element) extremely useful in many cases, there are often use cases I come across where it is more of an annoyance than helpful, and I find myself wishing for an alternate syntax to use when I would rather disable that particular behaviour. Here is a canned 2D example below, but I have had the same peeve a few times with other data structures and in other numbers of dimensions. import numpy as np A = np.random.randint(0, 2, (5, 10)) def foo(i, j, r=2): '''sum of neighbours within r steps of A[i,j]''' return A[i-r:i+r+1, j-r:j+r+1].sum() In the slice above I would rather that any negative number to the slice would be treated the same as None is, rather than wrapping to the other end of the array. Because of the wrapping, the otherwise nice implementation above gives incorrect results at boundary conditions and requires some sort of patch like: def ugly_foo(i, j, r=2): def thing(n): return None if n < 0 else n return A[thing(i-r):i+r+1, thing(j-r):j+r+1].sum() I have also tried zero-padding the array or list, but it is still inelegant (requires adjusting the lookup locations indices accordingly) and inefficient (requires copying the array). Am I missing some standard trick or elegant solution for slicing like this? I noticed that python and numpy already handle the case where you specify too large a number nicely - that is, if the index is greater than the shape of the array it behaves the same as if it were None.

    Read the article

  • Show iPad keyboard on select, focus or always (jQuery)

    - by Ryan
    I have a web app that is using jQuery to replace the RETURN key with TAB so that when I user presses return the form is not submitted but rather the cursor moves to the next text field. This works in all browsers but only 1/2 works on the iPad. On the iPad the next field is highlighted but the keyboard is hidden. How can I keep the keyboard visible or force it somehow? Here's my code (thanks to http://thinksimply.com/blog/jquery-enter-tab): function checkForEnter (event) { if (event.keyCode == 13) { currentBoxNumber = textboxes.index(this); if (textboxes[currentBoxNumber + 1] != null) { nextBox = textboxes[currentBoxNumber + 1] nextBox.focus(); nextBox.select(); event.preventDefault(); return false; } } } Drupal.behaviors.formFields = function(context) { $('input[type="text"]').focus(function() { $(this).removeClass("idleField").addClass("focusField"); }); $('input[type="text"]').blur(function() { $(this).removeClass("focusField").addClass("idleField"); }); // replaces the enter/return key function with tab textboxes = $("input.form-text"); if ($.browser.mozilla) { $(textboxes).keypress (checkForEnter); } else { $(textboxes).keydown (checkForEnter); } };

    Read the article

  • Why does my floating div push around other divs?

    - by Meke
    I have a div which has a table which has a google map. I want to place a info box within the google map external to the map, just floating on top But I can't seem to get it right, the info div just pushes around the google map despite being on top of the map... CSS .google_map { height: 270px; width: 100%; } #flightMapInfo { position: relative; float: left; z-index: 100; color: #FFFFFF; top: 30px; left: 50px; background:#5a85a5; padding: 5px; -moz-border-radius: 10px; -webkit-border-radius: 10px; } div.tabContent { border: 1px solid #c9c3ba; padding: 0.5em; background-color: #f1f0ee; min-height: 300px; } .tableLeft { width: 75%; float: left; border-right: dotted 2px black; } HTML <div class="mapBlock tabContent"> <div id="flightMapInfo">WHARGL</div> <table class="tableLeft"> <tr><td><div id="flightMap" class="google_map"></div> </table></td></tr></div>

    Read the article

  • Programmatically change the icon of the executable

    - by Dennis Delimarsky
    I am developing an application called WeatherBar. Its main functionality is based on its interaction with the Windows 7 taskbar — it changes the icon depending on the weather conditions in a specific location. The icons I am using in the application are all stored in a compiled native resource file (.res) — I am using it instead of the embedded resource manifest for icons only. By default, I modify the Icon property of the main form to change the icons accordingly and it works fine, as long as the icon is not pinned to the taskbar. When it gets pinned, the icon in the taskbar automatically switches to the default one for the executable (with index 0 in the resource file). After doing a little bit of research, I figured that a way to change the icon would be changing the shortcut icon (as all pinned applications are actually shortcuts stored in the user folder). But it didn't work. I assume that I need to change the icon for the executable, and therefore use UpdateResource, but I am not entirely sure about this. My executable is not digitally signed, so it shouldn't be an issue modifying it. What would be the way to solve this issue?

    Read the article

  • jQuery get the value of ahref and put it to button

    - by user1506189
    i have this problem that i need to get the value of href and pass it to a button. is this correct format of jQuery? $(function() { var getValue = $('#theLink').getAttributeNode('onclick').value; $('.yt_holder').live('click', '.videoThumb4', function(){ $(".videoThumb4").ytplaylist({ holderId: 'ytvideo4', html5: true, playerWidth: '520', autoPlay: false, sliding: false, listsliding: true, social: true, autoHide: false, playfirst: 0, playOnLoad: false, modestbranding: true, showInfo: false }); }); }); the button was working but it only play the first video on his list. the link of the website is here http://cocopop12.site11.com/search/index.php now the button is this. <input class="videoThumb4" onClick="http://www.youtube.com/watch?v=' . $yValue['videoid'] . '" type="button" name="previewSel" value="Preview" id="previewbut" /> is that correct? that i need to do a onclick http://www.... blabla? the <a href> that i like to make a button is this. <?php echo ' <a class="videoThumb4" href="http://www.youtube.com/watch?v=' . $yValue['videoid'] . '" id="link"> ' . $yValue['description'] . ' </a> '; ?> how can i use .each for the button {Preview}? how can i put the value in the button just like --when i click this href it automatically play the video? but the button it just play the first video but not the second video. this i want to make it like a button. thank you for your time.

    Read the article

  • Images won't load if they are of high size

    - by Fahim Parkar
    I have created web-application using JSF 2.0 and mysql. I am storing images in DB using MEDIUMBLOB. When I try to load image, I am able to see those images. However if the image size is big (1 MB or more), I can see half or 3/4th image on the browser. Any idea how to overcome this issue? Do I need to set any variable in JSF or MySQL? I know I should have saved the images over disk instead of DB, however this was client requirement. Client wanted to backup data and provide it to someone else and client don't want to backup DB and images also. Edit 1 Do I need to set any variables on mysql like query_cache. Edit 2 When I download same image and put below code it works perfectly. <h:graphicImage value="images/myImage4.png" width="50%" /> Edit 3 code is as below. <h:graphicImage value="DisplayImage?mainID=drawing" /> DisplayImage.java String imgLen = rs1.getString(1); int len = imgLen.length(); byte[] rb = new byte[len]; InputStream readImg = rs1.getBinaryStream(1); InputStream inputStream = readImg; int index = readImg.read(rb, 0, len); response.reset(); response.setHeader("Content-Length", String.valueOf(len)); response.setHeader("Content-disposition", "inline;filename=/file.png"); response.setContentType("image/png"); response.getOutputStream().write(rb, 0, len); response.getOutputStream().flush(); When I print len I get value as len=1548432

    Read the article

  • JQueryMobile 1.1.1 List items not anchoring to the left

    - by user1664935
    I'm trying to create a simple thumbnail list, the code is pretty much copied off jqm docs pages. However, when I use the code below the button element of the list isn't anchored to the left of the list item and instead appears centered...Can anyone help me? It's driving me crazy! I haven't got any styles in other than what is in the jquerymobile default page template <div id="listDiv" class="ui-content" data-role="main"> <div id="listInformation" data-role="content-primary"> <ul id="swipeMeChildrenList" data-role="listview" class="ui-listview"> <li data-corners="false" data-shadow="false" data-iconshadow="true" data-wrapperels="div" data-icon="arrow-r" data-iconpos="right" data-theme="c" class="ui-btn ui-btn-icon-right ui-li-has-arrow ui-li ui-btn-up-c"> <div class="ui-btn-inner ui-li"> <div class="ui-btn-text"> <a href="index.html" class="ui-link-inherit"> <img src="images/album-p.jpg" class="ui-li-thumb"> <p>Ha</p> </a> </div> <span class="ui-icon ui-icon-arrow-r ui-icon-shadow">&nbsp;</span> </div> </li> </ul> </div> </div>

    Read the article

  • SpringMvc java.lang.NullPointerException When Posting Form To Server

    - by dev_darin
    I have a form with a user name field on it when i tab out of the field i use a RESTFUL Web Service that makes a call to a handler method in the controller. The method makes a call to a DAO class that checks the database if the user name exists. This works fine, however when the form is posted to the server i call the same exact function i would call in the handler method however i get a java.lang.NullPointerException when it accesses the class that makes a call to the DAO object. So it does not even access the DAO object the second time. I have exception handlers around the calls in all my classes that makes calls. Any ideas as to whats happening here why i would get the java.lang.NullPointerException the second time the function is called.Does this have anything to do with Spring instantiating DAO classes using a Singleton method or something to that effect? What can be done to resolve this? This is what happens the First Time The Method is called using the Web Service(this is suppose to happen): 13011 [http-8084-2] INFO com.crimetrack.jdbc.JdbcOfficersDAO - Inside jdbcOfficersDAO 13031 [http-8084-2] DEBUG org.springframework.jdbc.core.JdbcTemplate - Executing prepared SQL query 13034 [http-8084-2] DEBUG org.springframework.jdbc.core.JdbcTemplate - Executing prepared SQL statement [SELECT userName FROM crimetrack.tblofficers WHERE userName = ?] 13071 [http-8084-2] DEBUG org.springframework.jdbc.datasource.DataSourceUtils - Fetching JDBC Connection from DataSource 13496 [http-8084-2] DEBUG org.springframework.jdbc.core.StatementCreatorUtils - Setting SQL statement parameter value: column index 1, parameter value [adminz], value class [java.lang.String], SQL type unknown 13534 [http-8084-2] DEBUG org.springframework.jdbc.datasource.DataSourceUtils - Returning JDBC Connection to DataSource 13537 [http-8084-2] INFO com.crimetrack.jdbc.JdbcOfficersDAO - No username was found in exception 13537 [http-8084-2] INFO com.crimetrack.service.ValidateUserNameManager - UserName :adminz does NOT exist The Second time When The Form Is 'Post' and a validation method handles the form and calls the same method the web service would call: 17199 [http-8084-2] INFO com.crimetrack.service.OfficerRegistrationValidation - UserName is not null so going to check if its valid for :adminz 17199 [http-8084-2] INFO com.crimetrack.service.OfficerRegistrationValidation - User Name in try.....catch block is adminz 17199 [http-8084-2] INFO com.crimetrack.service.ValidateUserNameManager - Inside Do UserNameExist about to validate with username : adminz 17199 [http-8084-2] INFO com.crimetrack.service.ValidateUserNameManager - UserName :adminz EXCEPTION OCCURED java.lang.NullPointerException

    Read the article

  • structDelete doesn't effect the shallow copy?

    - by Travis
    I was playing around onError so I tried to create an error using a large xml document object. <cfset variables.XMLByRef = variables.parsedXML.XMLRootElement.XMLChildElement> <cfset structDelete(variables.parsedXML, "XMLRootElement")> <cfset variables.startXMLShortLoop = getTickCount()> <cfloop from = "1" to = "#arrayLen(variables.XMLByRef)#" index = "variables.i"> <cfoutput>#variables.XMLByRef[variables.i].id.xmltext#</cfoutput><br /> </cfloop> <cfset variables.stopXMLShortLoop = getTickCount()> I expected to get an error because I deleted the structure I was referencing. From LiveDocs: Variable Assignment - Creates an additional reference, or alias, to the structure. Any change to the data using one variable name changes the structure that you access using the other variable name. This technique is useful when you want to add a local variable to another scope or otherwise change a variable's scope without deleting the variable from the original scope. instead I got 580df1de-3362-ca9b-b287-47795b6cdc17 25a00498-0f68-6f04-a981-56853c0844ed ... ... ... db49ed8a-0ba6-8644-124a-6d6ebda3aa52 57e57e28-e044-6119-afe2-aebffb549342 Looped 12805 times in 297 milliseconds <cfdump var = "#variables#"> Shows there's nothing in the structure, just parsedXML.xmlRoot.xmlName with the value of XMLRootElement. I also tried <cfset structDelete(variables.parsedXML.XMLRootElement, "XMLChildElement")> as well as structClear for both. More information on deleting from the xml document object. http://help.adobe.com/en_US/ColdFusion/9.0/Developing/WSc3ff6d0ea77859461172e0811cbec22c24-78e3.html Can someone please explain my faulty logic? Thanks.

    Read the article

  • how to get response from remote server

    - by ruhit
    I have made a desktop application in asp.net using c# that connecting with remote server.I am able to connect but how do i show that my login is successful or not. After that i want to retrieve data from the remote server..........so plz help me.I have written the below code..............is there any better way try { string strId = UserId_TextBox.Text; string strpasswrd = Password_TextBox.Text; ASCIIEncoding encoding = new ASCIIEncoding(); string postData = "UM_email=" + strId; postData += ("&UM_password=" + strpasswrd); byte[] data = encoding.GetBytes(postData); MessageBox.Show(postData); // Prepare web request... //HttpWebRequest myRequest = (HttpWebRequest)WebRequest.Create("http://localhost/ruhit/basic_framework/index.php?menu=login=" + postData); HttpWebRequest myRequest =(HttpWebRequest)WebRequest.Create("http://www.facebook.com/login.php=" + postData); myRequest.Method = "POST"; myRequest.ContentType = "application/x-www-form-urlencoded"; myRequest.ContentLength = data.Length; Stream newStream = myRequest.GetRequestStream(); // Send the data. newStream.Write(data, 0, data.Length); MessageBox.Show("u r now connected"); HttpWebResponse response = (HttpWebResponse)myRequest.GetResponse(); // WebResponse response = myRequest.GetResponse(); StreamReader reader = new StreamReader(response.GetResponseStream()); string str = reader.ReadLine(); while (str != null) { str = reader.ReadLine(); MessageBox.Show(str); } reader.Close(); newStream.Close(); } catch { MessageBox.Show("error connecting"); }

    Read the article

  • Asynchronous javascript issue

    - by amit
    I am trying to create a function which takes values from various html elements of the page to create a string and pass on to a variable. now this works great for all browsers except IE 8 and 9. IE tends to skip the part of fetching the values and goes straight to the variable and finds nothing.. is there a way to sync it all so that it works in IE? function seturl() { var qstring = returnQString(); $('span.keyword').text($.trim($('#hdnKeyWord').attr('value'))); $('input.search_box').attr('value', $.trim($('#hdnKeyWord').attr('value'))); $('#hdnSearchKeyword').attr('value', $.trim($('#hdnKeyWord').attr('value'))); $(".search_box").val($.trim($("#hdn_span_hdnKeyWord").text())); $(".header_inner input[type='text']").focus(); $(".search_term input[type='text']").focus(); $('#locationurl').attr('value', qstring); } function returnQString(){ var qstring = $.trim($('#locationurl').attr('init')); //initial value of the url qstring += "?type=" + $('#hdnSTSearch').attr('value'); // type of handler hit qstring += "&keyword=" + encodeURIComponent($('#hdnKeyWord').attr('value')); // keyword addition qstring += "&pagestart=" + $('#current_page').attr('value'); // pagestart(current page) addition qstring += "&pagesize=" + $('#show_per_page').attr('value'); // per page size addition qstring += "&facets=" // facetsearch $.each(selectedFilter.items, function (index, value) { qstring += value.filter + ","; }); qstring += "&selectedSection=" + selectedSection // Section Select return qstring; }

    Read the article

  • IE7 & IE8 error executing function with ajax

    - by Yahreen
    I am loading an ajax page which executes an HTML5 video player script. The function for the Flash fallback is html5media(); : //Load 1st Case Study $("#splash").live('click', function (e) { $(this).fadeOut('slow', function () { $('#case-studies').load('case-study-1.html', function() { html5media(); //initiate Flash fallback }).fadeIn(); }); e.preventDefault(); }); This initial page load works fine in IE7 & IE8. The problem is once this page is loaded, there are links to 4 more videos which are loaded in again using ajax. I use this function: //Switcher function csClients(url, client) { $("#case-studies").fadeOut('slow', function() { $('#case-studies').load(url, function () { html5media(); //initiate Flash fallback }).fadeIn(); }); } //Page Loader $("#cs-client-list li.client1 a").live('click', function(e) { csClients('case-study-1.html', 'client1'); e.preventDefault(); }); Originally I was using return false; but none of the sub-page Flash videos would load in IE7. When I switched to preventDefault, the videos loaded in IE7 but still not in IE8. I also get a weird error in both IE7 & IE8 with no helpful feedback: Error on Page: Unspecified error. / (Line 49) Code: 0 (Char 5) URI: http://www.mysite.com This is line 49 in my index page: <section id="case-studies" class="main-section"> I have a feeling it has to do with calling html5media(); too many times? At a loss...

    Read the article

  • button onclick not working

    - by nsw1475
    I have a javascript where I need to hide (and eventually show) some text by clicking a button. However, when I click the button, it does not call the function specified in the onclick parameter, and so nothing happens. Here is my source code: <script type="text/javascript"> $(document).ready(function(){ var tip = 1; $(".tip1").hide(); $(".tip2").hide(); switch (tip) { case 1: $(".tip1").show(); break; case 2: $(".tip2").show(); break; } function nextTip() { $(".tip1").hide(); return; } }); </script> <br/> <div id='bg_container' style='background-image: url("<?=$PICS?>trackingpage_middle.jpg")' > <img style='z-index:-1;' width='737px' src='<?=$PICS?>trackingpage_top.jpg'> <div id='main_container' > <form> <input type="button" onClick="nextTip()" value = "Next Tip" /> </form> <div class="tip1"> ... and so on.

    Read the article

  • C++, Ifstream opens local file but not file on HTTP Server

    - by fammi
    Hi, I am using ifstream to open a file and then read from it. My program works fine when i give location of the local file on my system. for eg /root/Desktop/abc.xxx works fine But once the location is on the http server the file fails to open. for eg http://192.168.0.10/abc.xxx fails to open. Is there any alternate for ifstream when using a URL address? thanks. part of the code where having problem: bool readTillEof = (endIndex == -1) ? true : false; // Open the file in binary mode and seek to the end to determine file size ifstream file ( fileName.c_str ( ), ios::in|ios::ate|ios::binary ); if ( file.is_open ( ) ) { long size = (long) file.tellg ( ); long numBytesRead; if ( readTillEof ) { numBytesRead = size - startIndex; } else { numBytesRead = endIndex - startIndex + 1; } // Allocate a new buffer ptr to read in the file data BufferSptr buf (new Buffer ( numBytesRead ) ); mpStreamingClientEngine->SetResponseBuffer ( nextRequest, buf ); // Seek to the start index of the byte range // and read the data file.seekg ( startIndex, ios::beg ); file.read ( (char *)buf->GetData(), numBytesRead ); // Pass on the data to the SCE // and signal completion of request mpStreamingClientEngine->HandleDataReceived( nextRequest, numBytesRead); mpStreamingClientEngine->MarkRequestCompleted( nextRequest ); // Close the file file.close ( ); } else { // Report error to the Streaming Client Engine // as unable to open file AHS_ERROR ( ConnectionManager, " Error while opening file \"%s\"\n", fileName.c_str ( ) ); mpStreamingClientEngine->HandleRequestFailed( nextRequest, CONNECTION_FAILED ); } }

    Read the article

  • My Rails session is getting reset when I have concurrent requests

    - by alex_c
    I think I might be misunderstanding something about Rails sessions, so please bear with me, I might not be phrasing my question the best way. I'm working on an iPhone app with a Ruby on Rails backend. I have a web view which by default goes to the index action of one controller (and uses sessions), and in the background a bunch of API calls going to a different controller (and which don't need to use sessions). The problem is, the sessions set by my web view seem to be overwitten by the API calls. My staging server is pretty slow, so there's lots of time for the requests to overlap each other - what I see in the logs is basically this: Request A (first controller) starts. Session is empty. Request B (second controller) starts. Session is empty. Request A finishes. Request A has done authentication, and stored the user ID in the session. Session contains user ID. Request B finishes. Session is empty. Request C starts. Session is empty - not what I want. Now, the strange thing is that request B should NOT be writing anything to the session. I do have before and after filters which READ from the session - things like: user = User.find_by_id(session[:id]) or logger.debug session.inspect and if I remove all of those, then everything works as expected - session contents get set by request A, and they're still there when request C starts. So. I think I'm missing something about how sessions work. Why would reading from the session overwrite it? Should I be accessing it some other way? Am I completely on the wrong track and the problem is elsewhere? Thank you for any insights!

    Read the article

  • How to make CSS URL background images show up in localhost?

    - by Joel
    Hi guys, I just installed xampp and I brought one of my live sites into it to be able to start working from localhost. So to view my site, I navigate to localhost/example.com I noticed some issues with images when on my html, I had for example: <img src="/new_pictures/05.jpg" alt="Central Market"/> Image wouldn't show up, but then I removed the / and this works: <img src="new_pictures/05.jpg" alt="Central Market"/> I seem to have a similar problem with the CSS background image, but I can't get it to work-if I remove the / there, the image doesn't show up on the live site. How do I make the background image show up on localhost? Example CSS (works in live site but not localhost): .outeremailcontainer { height:60px; width: 275px; background-image:url(/images/feather_email2.jpg); text-align:center; float:right; position:relative; z-index:1; } Thanks!

    Read the article

  • Reordering fields in Django model

    - by Alex Lebedev
    I want to add few fields to every model in my django application. This time it's created_at, updated_at and notes. Duplicating code for every of 20+ models seems dumb. So, I decided to use abstract base class which would add these fields. The problem is that fields inherited from abstract base class come first in the field list in admin. Declaring field order for every ModelAdmin class is not an option, it's even more duplicate code than with manual field declaration. In my final solution, I modified model constructor to reorder fields in _meta before creating new instance: class MyModel(models.Model): # Service fields notes = my_fields.NotesField() created_at = models.DateTimeField(auto_now_add=True) updated_at = models.DateTimeField(auto_now=True) class Meta: abstract = True last_fields = ("notes", "created_at", "updated_at") def __init__(self, *args, **kwargs): new_order = [f.name for f in self._meta.fields] for field in self.last_fields: new_order.remove(field) new_order.append(field) self._meta._field_name_cache.sort(key=lambda x: new_order.index(x.name)) super(TwangooModel, self).__init__(*args, **kwargs) class ModelA(MyModel): field1 = models.CharField() field2 = models.CharField() #etc ... It works as intended, but I'm wondering, is there a better way to acheive my goal?

    Read the article

  • Paperclip: Stay put on edit

    - by EricR
    When a user edits something in my application, they're forced to re-upload their image via paperclip even if they aren't changing it. Failing to do so will cause an error, since I validate_presence_of :image. This is quite annoying. How can I make it so Paperclip won't update its attributes if a user simply doesn't supply a new image on an edit? The photo controller is fresh out of Rails' scaffold generator. The rest of the source code is provided below. models/accommodation.rb class Accommodation < ActiveRecord::Base attr_accessible :photo validates_presence_of :photo has_one :photo has_many :notifications belongs_to :user accepts_nested_attributes_for :photo, :allow_destroy => true end controllers/accommodation_controller.rb class AccommodationsController < ApplicationController def index @accommodations = Accommodation.all end def show @accommodation = Accommodation.find(params[:id]) rescue ActiveRecord::RecordNotFound flash[:error] = "Accommodation not found." redirect_to :home end def new @accommodation = current_user.accommodations.build @accommodation.build_photo end def create @accommodation = current_user.accommodations.build(params[:accommodation]) if @accommodation.save flash[:notice] = "Successfully created your accommodation." redirect_to @accommodation else @accommodation.build_photo render :new end end def edit @accommodation = Accommodation.find(params[:id]) @accommodation.build_photo rescue ActiveRecord::RecordNotFound flash[:error] = "Accommodation not found." redirect_to :home end def update @accommodation = Accommodation.find(params[:id]) if @accommodation.update_attributes(params[:accommodation]) flash[:notice] = "Successfully updated accommodation." redirect_to @accommodation else @accommodation.build_photo render :edit end end def destroy @accommodation = Accommodation.find(params[:id]) @accommodation.destroy flash[:notice] = "Successfully destroyed accommodation." redirect_to :inkeep end end models/photo.rb class Photo < ActiveRecord::Base attr_accessible :image, :primary belongs_to :accommodation has_attached_file :image, :styles => { :thumb=> "100x100#", :small => "150x150>" } end

    Read the article

  • Creating a floating button

    - by Robert Smith
    Hey all, I'm working on a Firefox extension and am out of ideas on how to implement a floating button. I need a button that is overlayed on my page that I can show/hide and dynamically position just about anywhere on my page. I thought I could do something like a fancy CSS tool-tip except replace it with button functionality, but that idea failed because I couldn't pull my example apart well enough to understand what all I need to include, need to change, etc. I've thought about using jQuery(though wouldn't mind avoiding, unless it makes this painfully easy) but will be looking more into that as a possibility now. If anyone can offer a tutorial link, ideas, sample code, anything to help get me moving in the right direction I will greatly appreciate it! Thanks! Edit: Clarification I'm not entirely sure how to actually create the overlayed button. I tried to create a a floating div with some text in it, and nothing showed up, but I got no errors, which means I'm doing something wrong, but I have no idea what that is. http://www.fijiwebdesign.com/blog/css-tooltips-floating-html-elements.html If you take a look at that webpage you see that there is that floating "feedback" button, I would like to create something similar, only it wouldn't be anchored to the sides, but I could position it over text, etc. #floatingBtn { position: absolute; z-index: 10000; top: 50%; left: 50%; } Thats the CSS I used to try and float my div. I don't know if I'm creating the div in the wrong place or... I thought if I could get a floating div with some text, I could turn that into my button.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • crash when using stl vector at instead of operator[]

    - by Jamie Cook
    I have a method as follows (from a class than implements TBB task interface - not currently multithreading though) My problem is that two ways of accessing a vector are causing quite different behaviour - one works and the other causes the entire program to bomb out quite spectacularly (this is a plugin and normally a crash will be caught by the host - but this one takes out the host program as well! As I said quite spectacular) void PtBranchAndBoundIterationOriginRunner::runOrigin(int origin, int time) const // NOTE: const method { BOOST_FOREACH(int accessMode, m_props->GetAccessModes()) { // get a const reference to appropriate vector from member variable // map<int, vector<double>> m_rowTotalsByAccessMode; const vector<double>& rowTotalsForAccessMode = m_rowTotalsByAccessMode.find(accessMode)->second; if (origin != 129) continue; // Additional debug constrain: I know that the vector only has one non-zero element at index 129 m_job->Write("size: " + ToString(rowTotalsForAccessMode.size())); try { // check for early return... i.e. nothing to do for this origin if (!rowTotalsForAccessMode[origin]) continue; // <- this works if (!rowTotalsForAccessMode.at(origin)) continue; // <- this crashes } catch (...) { m_job->Write("Caught an exception"); // but its not an exception } // do some other stuff } } I hate not putting in well defined questions but at the moment my best phrasing is : "WTF?" I'm compiling this with Intel C++ 11.0.074 [IA-32] using Microsoft (R) Visual Studio Version 9.0.21022.8 and my implementation of vector has const_reference operator[](size_type _Pos) const { // subscript nonmutable sequence #if _HAS_ITERATOR_DEBUGGING if (size() <= _Pos) { _DEBUG_ERROR("vector subscript out of range"); _SCL_SECURE_OUT_OF_RANGE; } #endif /* _HAS_ITERATOR_DEBUGGING */ _SCL_SECURE_VALIDATE_RANGE(_Pos < size()); return (*(_Myfirst + _Pos)); } (Iterator debugging is off - I'm pretty sure) and const_reference at(size_type _Pos) const { // subscript nonmutable sequence with checking if (size() <= _Pos) _Xran(); return (*(begin() + _Pos)); } So the only difference I can see is that at calls begin instead of simply using _Myfirst - but how could that possibly be causing such a huge difference in behaviour?

    Read the article

  • jQuery.data() works in Mac OS WebKit, but not on iPhone OS?

    - by rpj
    I'm playing around with jQTouch for an iPhone OS app that I've been toying with off and on for a while. I wanted to try my hand building it as a web app so I started playing with jQTouch. For reference, here is the page+source (all my code is currently in index.html so you can just "View Source" to see it all): http://rpj.me/doughapp.com/wd/ Essentially, I'm trying to save pertinent JSON objects retrieved from Google Local into DOM objects using the data() method (in this example, obj is the Google Local object): $('#locPane').data('selected', obj); then later (in a different "pane"), retrieving that object to be used: $('#locPane').bind('pageAnimationEnd', function(e, inf) { var selobj = $(this).data('selected'); // use 'selobj' here ... } In Chromium and Safari on the desktop OS (Snow Leopard in my case), this works perfectly (try it out). However, the same code returns undefined for the call to $(this).data('selected') in the second snippet above. I've also tried $('#' + e.target.id).data('selected') and even the naive $('#locPane').data('selected'). All variants return undefined in the iPhone OS version of WebKit, but not on the desktop. Interestingly, the running this on Mobile Safari in the iPhone Simulator fails as well. If you look at the full source, you'll see that I even try to save this object into my global jQTouch object (named jqt in my code). This, too, fails on the mobile platform. Has anyone else ever ran into this? I'll admit to not being a web/javascript programmer by trade, so if I'm making an idiot's error please call me out on it. Thank you in advance for the help! -RPJ Update: I didn't make it clear in the original post, but I'm open to any workaround if it works consistently. Since I'm having trouble storing these objects in general, anything that allows me to keep them around is good enough for now. Thanks!

    Read the article

  • PHP Multiple navigation highlights

    - by Blackbird
    I'm using this piece of code below to highlight the "active" menu item on my global navigation. <?php $path = $_SERVER['PHP_SELF']; $page = basename($path); $page = basename($path, '.php'); ?> <ul id="nav"> <li class="home"><a href="index.php">Home</a></li> <li <?php if ($page == 'search') { ?>class="active"<?php } ?>><a href="#">Search</a></li> <li <?php if ($page == 'help') { ?>class="active"<?php } ?>><a href="help.php">Help</a></li> </ul> All works great but, on a couple of pages, I have a second sub menu (sidebar menu) within a global page. I basically need to add a OR type statement into the php somehow, but I haven't a clue a how. Example of what i mean: <li <?php if ($page == 'help') OR ($page == 'help-overview') OR ($page == 'help-cat-1') { ?>class="active"<?php } ?>><a href="#">Search</a></li> Thanks!

    Read the article

  • Efficiently select top row for each category in the set

    - by VladV
    I need to select a top row for each category from a known set (somewhat similar to this question). The problem is, how to make this query efficient on the large number of rows. For example, let's create a table that stores temperature recording in several places. CREATE TABLE #t ( placeId int, ts datetime, temp int, PRIMARY KEY (ts, placeId) ) -- insert some sample data SET NOCOUNT ON DECLARE @n int, @ts datetime SELECT @n = 1000, @ts = '2000-01-01' WHILE (@n>0) BEGIN INSERT INTO #t VALUES (@n % 10, @ts, @n % 37) IF (@n % 10 = 0) SET @ts = DATEADD(hour, 1, @ts) SET @n = @n - 1 END Now I need to get the latest recording for each of the places 1, 2, 3. This way is efficient, but doesn't scale well (and looks dirty). SELECT * FROM ( SELECT TOP 1 placeId, temp FROM #t WHERE placeId = 1 ORDER BY ts DESC ) t1 UNION ALL SELECT * FROM ( SELECT TOP 1 placeId, temp FROM #t WHERE placeId = 2 ORDER BY ts DESC ) t2 UNION ALL SELECT * FROM ( SELECT TOP 1 placeId, temp FROM #t WHERE placeId = 3 ORDER BY ts DESC ) t3 The following looks better but works much less efficiently (30% vs 70% according to the optimizer). SELECT placeId, ts, temp FROM ( SELECT placeId, ts, temp, ROW_NUMBER() OVER (PARTITION BY placeId ORDER BY ts DESC) rownum FROM #t WHERE placeId IN (1, 2, 3) ) t WHERE rownum = 1 The problem is, during the latter query execution plan a clustered index scan is performed on #t and 300 rows are retrieved, sorted, numbered, and then filtered, leaving only 3 rows. For the former query three times one row is fetched. Is there a way to perform the query efficiently without lots of unions?

    Read the article

  • Have something loaded only when JList item is visibile

    - by elvencode
    Hello, i'm implementing a Jlist populated with a lot of elements. Each element corresponds to a image so i'd like to show a resized preview of them inside each row of the list. I've implemented a custom ImageCellRenderer extending the Jlabel and on getListCellRendererComponent i create the thumbnail if there'snt any for that element. Each row corresponds to a Page class where i store the path of the image and the icon applied to the JLabel. Each Page object is put inside a DefaultListModel to populate the JList. The render code is something like this: public Component getListCellRendererComponent( JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { Page page = (Page) value; if (page.getImgIcon() == null) { System.out.println(String.format("Creating thumbnail of %s", page.getImgFilename())); ImageIcon icon = new ImageIcon(page.getImgFilename()); int thumb_width = icon.getIconWidth() > icon.getIconHeight() ? 128 : ((icon.getIconWidth() * 128) / icon.getIconHeight()); int thumb_height = icon.getIconHeight() > icon.getIconWidth() ? 128 : ((icon.getIconHeight() * 128) / icon.getIconWidth()); icon.setImage(getScaledImage(icon.getImage(), thumb_width, thumb_height)); page.setImgIcon(icon); } setIcon(page.getImgIcon()); } I was thinking that only a certain item is visibile in the List the cell renderer is called but i'm seeing that all the thumnails are created when i add the Page object to the list model. I've tried to load the items and after set the model in the JList or set the model first and after starting appending the items but the results are the same. Is there any way to load the data only when necessary or do i need to create a custom control like a JScrollPanel with stacked items inside where i check myself the visibility of each elements? Thanks

    Read the article

< Previous Page | 450 451 452 453 454 455 456 457 458 459 460 461  | Next Page >