Search Results

Search found 32752 results on 1311 pages for 'multi line'.

Page 458/1311 | < Previous Page | 454 455 456 457 458 459 460 461 462 463 464 465  | Next Page >

  • Netbeans PHP require_once() problem

    - by mawg
    I'm stumped! In PHP in Netbeans (6.8), a project has two files, file1.php and file2.php file1.php starts require_once('file2.php'); and I get Warning: require_once(query_form.php): failed to open stream: No such file or directory in C:\xampp\htdocs\my_project\file1.php on line 3 Call Stack: 0.0741 322920 1. {main}() C:\xampp\htdocs\my_project\file1.php:0 Fatal error: require_once(): Failed opening required 'file2.php' (include_path='.;\xampp\php\PEAR') in C:\xampp\htdocs\my_project\file1.php on line 3 Call Stack: 0.0741 322920 1. {main}() C:\xampp\htdocs\my_project\file1.php:0 I tried require_once('./file2.php'); and require_once('.\file2.php'); since it is windows. I even added C:\xampp\htdocs\my_project\ to the projects include path and it shows up as such on the prject view and see file1.php and file2.php It doesn't show up on this error report, but possibly because Netbeans (or PHP ]) knows that C:\xampp\htdocs\my_project\ === . Any suggestions? Btw, I am new to Netbeans, so it i sprobably something very obvious.

    Read the article

  • update table in gtk

    - by ali
    I have window that contains a table on screen, now I want to attach a widget to that table I use gtk_table_attach(GTK_TABLE(table), label, ...) the function is correct and it runs without any error but table does not respond to that line I mean there is no change on my table, I think I need something to tell that table update it self but how? note= that line is inside a callback of a signal and I am sure that signal runs note2= I do not want to destroy window for that note3= I use gtk+ and pygtk note4= I am sure I attach that widget to a correct position ( it is free)

    Read the article

  • Does .NET have a linker?

    - by Water Cooler v2
    From Jon Skeet's blog: What does the following comment mean? // The line below only works when linked rather than // referenced, as otherwise you need a cast. // The compiler treats it as if it both takes and // returns a dynamic value. string value = com.MakeMeDynamic(10); I understand what referencing an assembly is. You may reference it when compiling the program files either using the /ref: switch at the command line or you may add a statically reference to the assembly in Visual Studio. But how do you link to an assembly in .NET? Does he mean, load the assembly using Reflection (Assembly.LoadFile())? Or, the Win32 API LoadLibrary()? Or, does .NET have a linker that I have never heard of?

    Read the article

  • Finding rank of the student -Sql Compact

    - by Jankhana
    I have a table like this : Name Mar1 Mar2 Mar3 Total xxx 80 80 80 240 yyy 60 70 50 180 aaa 85 65 75 225 I wanted to find the rank of the student based on total. I using SQL Compact 3.5 . As we have rank() function in sql server do we have something with which we can find the students rank??? When I used "select Total,rank() over (order by total desc) i1 from stmarks " it's giving error as " Major Error 0x80040E14, Minor Error 25501 select Total,rank() over (order by total desc) i1 from stmarks There was an error parsing the query. [ Token line number = 1,Token line offset = 21,Token in error = over ] " Do Sql Compact support rank() over or is there any another way???

    Read the article

  • Sending message from one server to another in Twisted

    - by Casey Patton
    I've implemented my servers in the following way: def makeServer(application, port): factory = protocol.ServerFactory() factory.protocol = MyChat factory.clients = [] internet.TCPServer(port, factory).setServiceParent(application) application = service.Application("chatserver") server1 = makeServer(application, port=1025) server2 = makeServer(application, port=1026) server3 = makeServer(application, port=1027) Note that MyChat is an event handling class that has a "receiveMessage" action: def lineReceived(self, line): print "received", repr(line) for c in self.factory.clients: c.transport.write(message + '\n') I want server1 to be able to pass messages to server2. Rather, I want server1 to be treated as a client of server2. If server1 receives the message "hi" then I want it to send that same exact message to server2. How can I accomplish this?

    Read the article

  • UIViewController is popped from view stack and NSURLConnection crashes the application

    - by rickharrison
    I am pushing a UIViewController onto a UINavigationController. This view controller immediately starts a download of an xml feed and then parses it. However, if you hit the back button before it is done downloading, and crashes with EXC_BAD_ACCESS. The line that is crashing it is in parserDidEndDocument and is this line: if (self.delegate && [self.delegate conformsToProtocol:@protocol(ModelDelegate)]) [self.delegate modelDidFinishParsing:self]; I assume it is crashing because it is trying to access self.delegate which is not assigned anymore. How do I get around this? Also, I would release the model object in the modelDidFinishParsing method. How would I release this model if it never reaches this method.

    Read the article

  • Bash - Test for multiple users

    - by Mike Purcell
    I am trying to test if current user one of two allowed users to start a process, but I can't seem to get the multi-condition to work correctly: test ($(whoami) != 'mpurcell' || $(whoami) != 'root')) && (echo "Cannot start script as non-ccast user..."; exit 1) Is there a way to test multiple users without have to enter two lines, like this: test $(whoami) != 'mpurcell' && (echo "Cannot start script as non-ccast user..."; exit 1) test $(whoami) != 'root' && (echo "Cannot start script as non-ccast user..."; exit 1)

    Read the article

  • HASHREF in Perl

    - by Uri
    I'm trying to decrypt a Perl code which I'm not familiar with, somehow related to HashRef. I'm using Amazon::S3, but my question is a general Perl question. See the code below: use Amazon::S3; my $s3 = Amazon::S3-new( ... ); my $response = $s3-buckets; Documentation (here) sais, about s3-buckets: Returns undef on error, else HASHREF of results The following line is working for me, but I don't understand why: for $b in ( @ { $response-{buckets} } ) { print "bucket: " . $b-bucket . "\n"; } I'm buzzled by each operator on the first line. What type exactly are $response, $respone-{bucket}. Looks like the expression within the 'for' is an array, but I don't understand this syntax: @{ ... }?

    Read the article

  • NSURLConnection shown as leaking in instruments

    - by Gyozo Kudor
    Hello another stupid question regarding leaks and also NSURLConnection. How do i release it? Is it enough if i release in the following 2 methods? (void)connection:(NSURLConnection *)connection didFailWithError:(NSError *)error (void)connectionDidFinishLoading:(NSURLConnection *)connection Because in instruments it shows me the line where I alloc my connection as the source of leaking. OK I don't get it. After the following code my urlConnection has a retain count of 2. WTF? NSURLConnection *urlConnection = [[NSURLConnection alloc] initWithRequest: urlRequest delegate: self]; This is the line that instruments points me to. I find this very weird.

    Read the article

  • How to compare if string has a enter key in the end using jquery/javascript?

    - by user144842
    I have a string value from a user input box. I have to figure out if last char is a enter key (line feed). Thats the code. Here I am checking if last char has a whitespace. Now I also have to check if last char is enter key (carriage return or line feed). How can i do this? var txt = $get("<%= txtUserText.ClientID %>"); if (txt.value.substring(txt.value.length -1) !== ' ' || <checkifLastCharIsEnterKey>) //my code to take action **I don't think i need a keypress or keyup event because this above piece of code is not invoked at the time of user input.

    Read the article

  • ASP.NET Treeview Control not expanding on click

    - by Scott Vercuski
    I having an issue with the ASP.NET Treeview control. I create the treeview just fine but the nodes will not expand or collapse. I see there is a javascript error but it is for line 1 character 0 of the webpage, there is nothing at line 1 character 0. I am using the ASP:Treeview control in conjunction with the Telerik controls, but I'm not sure if that is an issue. I saw there was a similar question here but the answer is not pertinent to my site. Has anyone run into this issue before? I've tried searching Google and tried a number of proposed solutions but so far none have worked. Thank you,

    Read the article

  • Is it possible to push DNS search suffices from DNS server to client?

    - by Mark
    Our (active directory, windows-server-based) intranet used to be called "intranet", and DNS worked fine for windows machines and iPads/Android devices. We have changed it to be "apps.intranet", and it still works for windows machines, but no longer for iPads/Android devices. I think this is because out windows clients are configured to append .company.com when searching DNS, to make it a fully qualified lookup (this search suffix list is pushed to the PCs via AD group policies). I must admit, though, I don't know why it worked with just "intranet"! Does anyone know if it's possible to get DNS to "tell" the iPads/Android devices to append .company.com ... or how we can make it work some other way (but still using the multi-label, non-qualified DNS names) ? Thanks!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Same-directory includes failing on a Fedora server with PHP.

    - by JimmySawczuk
    I have a couple files that look like this: index.php: <?php include('includes/header.php'); ... includes/header.php: <?php include('config.php'); ... The error I get is Warning: require(config.php) [function.require]: failed to open stream: No such file or directory in [dir]/includes/header.php on line 2 Fatal error: require() [function.require]: Failed opening required 'config.php' (include_path='.:/usr/share/pear:/usr/share/php') in [dir]/includes/header.php on line 2 I did some further debugging: when I add the call system('pwd'); to includes/header.php, it shows [dir], where it should say [dir]/includes. Adding the 'includes/' to the include path works, but isn't desirable because that would fail on the production server. The above code works on a production server, and worked fine on my development Fedora server, until I tried to change my development environment so that the Fedora server's document root is a mounted CIFS share. Any ideas? Thanks.

    Read the article

  • Kerning problems when drawing text character by character

    - by shekel
    I'm trying to draw strings character by character to add lighting effects to shapes composed of text. while (i != line.length()) { c = line.substring(i, i + 1); cWidth = g.getFontMetrics().stringWidth(c); g.drawString(c, xx += cWidth, yy); i++; } The problem is, the width of a character isn't the actual distance it's drawn from another character when those two characters are printed as a string. Is there any way to get the correct distance in graphics2d?

    Read the article

  • Cloud services can't be reached from complex customer infrastructure

    - by Nock
    We have several services running on a cloud, they all are hosted on Windows Server 2012 R2, have public IP address and specific port. Some of our customers can't reach them because for "some reason" the ports are cut between a firewall between them and us. (some customers are using a shared internet connection in a multi tenant office and they can't change firewall communication) Well, you get it, we don't have the possibility to make all the firewall "allowing" the communication. My customers all runs Windows 7 at least. What is the best counter solution in such case, using Microsoft (Windows Server) technologies? The best would be some kind of tunneling communication or VPN, but the customer should also be able to access his/her enterprise resources. Bby the way, today we using IPSec using Windows Firewall to secure the communication, is IPSec tunneling a solution for us? Otherwise, is there a service in Windows to enable some kind of VPN between a client and a server but only for a given set of servers?

    Read the article

  • how to show the right word in my code, my code is : os.urandom(64)

    - by zjm1126
    My code is: print os.urandom(64) which outputs: > "D:\Python25\pythonw.exe" "D:\zjm_code\a.py" \xd0\xc8=<\xdbD' \xdf\xf0\xb3>\xfc\xf2\x99\x93 =S\xb2\xcd'\xdbD\x8d\xd0\\xbc{&YkD[\xdd\x8b\xbd\x82\x9e\xad\xd5\x90\x90\xdcD9\xbf9.\xeb\x9b>\xef#n\x84 which isn't readable, so I tried this: print os.urandom(64).decode("utf-8") but then I get: > "D:\Python25\pythonw.exe" "D:\zjm_code\a.py" Traceback (most recent call last): File "D:\zjm_code\a.py", line 17, in <module> print os.urandom(64).decode("utf-8") File "D:\Python25\lib\encodings\utf_8.py", line 16, in decode return codecs.utf_8_decode(input, errors, True) UnicodeDecodeError: 'utf8' codec can't decode bytes in position 0-3: invalid data What should I do to get human-readable output?

    Read the article

  • consts and other animals

    - by bks
    Hello i have a cpp code wich i'm having trouble reading. a class B is defined now, i understand the first two lines, but the rest isn't clear enough. is the line "B const * pa2 = pa1" defines a const variable of type class B? if so, what does the next line do? B a2(2); B *pa1 = new B(a2); B const * pa2 = pa1; B const * const pa3 = pa2; also, i'm having trouble figuring out the difference between these two: char const *cst = “abc”; const int ci = 15; thank you

    Read the article

  • how to manage formating of text when read a save file?

    - by moon
    hello i have a java applet application in which i use rich text area . i write URDU the national language of PAKISTAN. i managed to do so with uni codes. the problem is, when i write urdu in text area and select a font and color for each line it do all of this but when i save this file using UTF-8 encoding and then open it again it shows all text formatted as i choose format of last line. my requirement is to open file as it is saved. i mean each file should have same formatting as i done before saving.

    Read the article

  • Template class implicit copy constructor issues

    - by Nate
    Stepping through my program in gdb, line 108 returns right back to the calling function, and doesn't call the copy constructor in class A, like (I thought) it should: template <class S> class A{ //etc... A( const A & old ){ //do stuff... } //etc... }; template <class T> class B{ //etc... A<T> ReturnsAnA(){ A<T> result; // do some stuff with result return result; //line 108 } //etc... }; Any hints? I've banged my head against the wall about this for 4 hours now, and can't seem to come up with what's happening here.

    Read the article

  • USB Hub powers down in sleep mode on Win 7 64

    - by Andy B
    This question has been asked before but not answered. I would like the USB hub to remain on in sleep so I can wake up the laptop from an external keyboard and mouse. I have set all the device drivers by unchecking allow this device to be powered down and disabled selective suspend in control panel but the hub still powers down. If I plug a keyboard or mouse directly in to the PC they remain powered and wake the computer its only when they are connected through the hub there is a problem. I have another PC running Win 7 32. If I set this up in exactly the same way the hub remains powered in sleep. Both PC's are Toshiba Satellites with multi-core celerons but one runs Win 7 32 the other Win 7 64. BIOS settings are the same. Any help would be appreciated even confirmation that this is a feature of Win 7 64.

    Read the article

  • What is this for an IP in my google app engine log file?

    - by Christian Harms
    I get many normal log lines in my google app engine application. But today I go these instead the 4-part number: 2a01:e35:2f20:f770:6c54:3ee8:67fb:df8 What is this for an format? ipv6 are 6 numbers, mac address too... Normal logfile line: 187.14.44.208 - - [19/Mar/2010:14:31:35 -0700] "GET /geo_data.js HTTP/1.1" 200 776 "http://www.xxx.com.br/spl19/index.php?refid=gv_av_ri" "Mozilla/5.0 (Windows; U; Windows NT 5.1; pt-BR; rv:1.9.2) Gecko/20100115 Firefox/3.6 (.NET CLR 3.5.30729),gzip(gfe)" This special logfile line: 2a01:e35:2f20:f770:6c54:3ee8:67fb:df8 - - [18/Mar/2010:17:00:37 -0700] "GET /geo_data.js HTTP/1.1" 500 450 "http://www.xxx.com.br/spl19/index.php?refid=cm_av_ri" "Mozilla/5.0 (Windows; U; Windows NT 6.1; pt-PT; rv:1.9.2) Gecko/20100115 Firefox/3.6,gzip(gfe)"

    Read the article

  • What's wrong in this SELECT statement

    - by user522211
    Protected Sub Page_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load Dim SQLData As New System.Data.SqlClient.SqlConnection("Data Source=.\SQLEXPRESS;AttachDbFilename=|DataDirectory|\Database.mdf;Integrated Security=True;User Instance=True") Dim cmdSelect As New System.Data.SqlClient.SqlCommand("SELECT * FROM Table1 WHERE Seats ='" & TextBox1.Text & "'", SQLData) SQLData.Open() Using adapter As New SqlDataAdapter(cmdSelect) Using table As New Data.DataTable() adapter.Fill(table) TextBox1.Text = [String].Join(", ", table.AsEnumerable().[Select](Function(r) r.Field(Of Integer)("seat_select"))) End Using End Using SQLData.Close() End Sub This line will be highlighted with blue line: TextBox1.Text = [String].Join(", ", table.AsEnumerable().[Select](Function(r) r.Field(Of Integer)("seat_select")))

    Read the article

  • HD Crash SQL server -> DBCC - consistency errors in table 'sysindexes'

    - by Julian de Wit
    Hello A client of mine has had an HD crash an a SQL DB got corrupt : They did not make backups so they have a big problem. When I tried (an ultimate measure) to DBCC-repair I got the following message. Can anybody help me with this ? Server: Msg 8966, Level 16, State 1, Line 1 Could not read and latch page (1:872) with latch type SH. sysindexes failed. Server: Msg 8944, Level 16, State 1, Line 1 Table error: Object ID 2, index ID 0, page (1:872), row 11. Test (columnOffsets->IsComplex (varColumnNumber) && (ColumnId == COLID_HYDRA_TEXTPTR || ColumnId == COLID_INROW_ROOT || ColumnId == COLID_BACKPTR)) failed. Values are 2 and 5. The repair level on the DBCC statement caused this repair to be bypassed. CHECKTABLE found 0 allocation errors and 1 consistency errors in table 'sysindexes' (object ID 2). DBCC execution completed. If DBCC printed error messages, contact your system administrator.

    Read the article

< Previous Page | 454 455 456 457 458 459 460 461 462 463 464 465  | Next Page >