Search Results

Search found 12824 results on 513 pages for 'glen little'.

Page 471/513 | < Previous Page | 467 468 469 470 471 472 473 474 475 476 477 478  | Next Page >

• Do You Really Know Your Programming Languages?

  - by Kristopher Johnson

  I am often amazed at how little some of my colleagues know or care about their craft. Something that constantly frustrates me is that people don't want to learn any more than they need to about the programming languages they use every day. Many programmers seem content to learn some pidgin sub-dialect, and stick with that. If they see a keyword or construct that they aren't familiar with, they'll complain that the code is "tricky." What would you think of a civil engineer who shied away from calculus because it had "all those tricky math symbols?" I'm not suggesting that we all need to become "language lawyers." But if you make your living as a programmer, and claim to be a competent user of language X, then I think at a minimum you should know the following: Do you know the keywords of the language and what they do? What are the valid syntactic forms? How are memory, files, and other operating system resources managed? Where is the official language specification and library reference for the language? The last one is the one that really gets me. Many programmers seem to have no idea that there is a "specification" or "standard" for any particular language. I still talk to people who think that Microsoft invented C++, and that if a program doesn't compile under VC6, it's not a valid C++ program. Programmers these days have it easy when it comes to obtaining specs. Newer languages like C#, Java, Python, Ruby, etc. all have their documentation available for free from the vendors' web sites. Older languages and platforms often have standards controlled by standards bodies that demand payment for specs, but even that shouldn't be a deterrent: the C++ standard is available from ISO for $30 (and why am I the only person I know who has a copy?). Programming is hard enough even when you do know the language. If you don't, I don't see how you have a chance. What do the rest of you think? Am I right, or should we all be content with the typical level of programming language expertise? Update: Several great comments here. Thanks. A couple of people hit on something that I didn't think about: What really irks me is not the lack of knowledge, but the lack of curiosity and willingness to learn. It seems some people don't have any time to hone their craft, but they have plenty of time to write lots of bad code. And I don't expect people to be able to recite a list of keywords or EBNF expressions, but I do expect that when they see some code, they should have some inkling of what it does. Few people have complete knowledge of every dark corner of their language or platform, but everyone should at least know enough that when they see something unfamiliar, they will know how to get whatever additional information they need to understand it.

  Read the article

• Google Code + SVN or GitHub + Git

  - by Nazgulled

  Let me start by telling you that I never used anything besides SVN and I'm also a Windows user. I have a couple of simple projects that are open-source, others are on there way when I'm happy enough to release their source code but either way, I was thinking of using Google Code and SVN to share the source code of my projects instead of providing a link to the source on my website. This as always been a pain cause I had to update the binaries and the code every time I released a new version. This would also help me out to have a backup of my code some where instead of just my local machine (I used to have a local Subversion server running). What I want from a service like this is very simple... I just want a place to store my source code that people can download if they want, allows me to control revisions and provide a simple and easy issue system so people can submit bugs and stuff like that. I guess both of them have this. But I don't want to host any binaries in their websites, I want this to be hosted on my website so I can control download statistics with my own scripts, I also don't have the need for wiki pages as I prefer to have all the documentation in my own website. Does anyone of this services provide a way to "disable" features like wiki and downloads and don't show them at all for my project(s)? Now, I'm sure there are lots of pros and cons about using Google Code with SVN and GitHub with Git (of course) but here's what it's important for me on each one and why I like them: Google Code: As with any Google page, the complexity is almost non-existent Everyone (or almost) as a Google account and this is nice if people want to report problems using the issues system GitHub: May (or may not) be a little more complex (not a problem for me though) than Google's pages but... ...has a much prettier interface than Google's service It needs people to be registered on GitHub to post about issues I like the fact that with Git, you have your own revisions locally (can I use TortoiseGit for this or?) Basically that's it, not much I know... What other, most common, pros and cons can you tell me about each site/software? Keep in mind that my projects are simple, I'm probably the only one who will ever develop these projects on these repositories (or maybe not, for now I will)

  Read the article

• Implicit vs explicit getters/setters in AS3, which to use and why?

  - by James

  Since the advent of AS3 I have been working like this: private var loggy:String; public function getLoggy ():String { return loggy; } public function setLoggy ( loggy:String ):void { // checking to make sure loggy's new value is kosher etc... this.loggy = loggy; } and have avoided working like this: private var _loggy:String; public function get loggy ():String { return loggy; } public function set loggy ( loggy:String ):void { // checking to make sure loggy's new value is kosher etc... this.loggy = loggy; } I have avoided using AS3's implicit getters/setters partly so that I can just start typing "get.." and content assist will give me a list of all my getters, and likewise for my setters. I also dislike underscores in my code which turned me off the implicit route. Another reason is that I prefer the feel of this: whateverObject.setLoggy( "loggy's awesome new value!" ); to this: whateverObject.loggy = "loggy's awesome new value!"; I feel that the former better reflects what is actually happening in the code. I am calling functions, not setting values directly. After installing Flash Builder and the great new plugin SourceMate ( which helps to get some of the useful features that FDT is famous into FB ) I realized that when I use SourceMate's "generate getters and setters" feature it automatically sets my code up using the implicit route: private var _loggy:String; public function get loggy ():String { return loggy; } public function set loggy ( loggy:String ):void { // do whatever is needed to check to make sure loggy is an acceptable value this.loggy = loggy; } I figure that these SourceMate people must know what they are doing or they wouldn't be writing workflow enhancement plugins for coding in AS3, so now I am questioning my ways. So my question to you is: Can anyone give me a good reason why I should give up my explicit g/s ways, start using the implicit technique, and embrace those stinky little _underscores for my private vars? Or back me up in my reasons for doing things the way that I do?

  Read the article

• How to discover classes with [Authorize] attributes using Reflection in C#? (or How to build Dynamic

  - by Pretzel

  Maybe I should back-up and widen the scope before diving into the title question... I'm currently writing a web app in ASP.NET MVC 1.0 (although I do have MVC 2.0 installed on my PC, so I'm not exactly restricted to 1.0) -- I've started with the standard MVC project which has your basic "Welcome to ASP.NET MVC" and shows both the [Home] tab and [About] tab in the upper-right corner. Pretty standard, right? I've added 4 new Controller classes, let's call them "Astronomer", "Biologist", "Chemist", and "Physicist". Attached to each new controller class is the [Authorize] attribute. For example, for the BiologistController.cs [Authorize(Roles = "Biologist,Admin")] public class BiologistController : Controller { public ActionResult Index() { return View(); } } These [Authorize] tags naturally limit which user can access different controllers depending on Roles, but I want to dynamically build a Menu at the top of my website in the Site.Master Page based on the Roles the user is a part of. So for example, if JoeUser was a member of Roles "Astronomer" and "Physicist", the navigation menu would say: [Home] [Astronomer] [Physicist] [About] And naturally, it would not list links to "Biologist" or "Chemist" controller Index page. Or if "JohnAdmin" was a member of Role "Admin", links to all 4 controllers would show up in the navigation bar. Ok, you prolly get the idea... Starting with the answer from this StackOverflow topic about Dynamic Menu building in ASP.NET, I'm trying to understand how I would fully implement this. (I'm a newbie and need a little more guidance, so please bare with me.) The answer proposes Extending the Controller class (call it "ExtController") and then have each new WhateverController inherit from ExtController. My conclusion is that I would need to use Reflection in this ExtController Constructor to determine which Classes and Methods have [Authorize] attributes attached to them to determine the Roles. Then using a Static Dictionary, store the Roles and Controllers/Methods in key-value pairs. I imagine it something like this: public class ExtController : Controller { protected static Dictionary<Type,List<string>> ControllerRolesDictionary; protected override void OnActionExecuted(ActionExecutedContext filterContext) { // build list of menu items based on user's permissions, and add it to ViewData IEnumerable<MenuItem> menu = BuildMenu(); ViewData["Menu"] = menu; } private IEnumerable<MenuItem> BuildMenu() { // Code to build a menu SomeRoleProvider rp = new SomeRoleProvider(); foreach (var role in rp.GetRolesForUser(HttpContext.User.Identity.Name)) { } } public ExtController() { // Use this.GetType() to determine if this Controller is already in the Dictionary if (!ControllerRolesDictionary.ContainsKey(this.GetType())) { // If not, use Reflection to add List of Roles to Dictionary // associating with Controller } } } Is this doable? If so, how do I perform Reflection in the ExtController constructor to discover the [Authorize] attribute and related Roles (if any) ALSO! Feel free to go out-of-scope on this question and suggest an alternate way of solving this "Dynamic Site.Master Menu based on Roles" problem. I'm the first to admit that this may not be the best approach.

  Read the article

• Abnormally disconnected TCP sockets and write timeout

  - by James

  Hello I will try to explain the problem in shortest possible words. I am using c++ builder 2010. I am using TIdTCPServer and sending voice packets to a list of connected clients. Everything works ok untill any client is disconnected abnormally, For example power failure etc. I can reproduce similar disconnect by cutting the ethernet connection of a connected client. So now we have a disconnected socket but as you know it is not yet detected at server side so server will continue to try to send data to that client too. But when server try to write data to that disconnected client ...... Write() or WriteLn() HANGS there in trying to write, It is like it is wating for somekind of Write timeout. This hangs the hole packet distribution process as a result creating a lag in data transmission to all other clients. After few seconds "Socket Connection Closed" Exception is raised and data flow continues. Here is the code try { EnterCriticalSection(&SlotListenersCriticalSection); for(int i=0;i<SlotListeners->Count;i++) { try { //Here the process will HANG for several seconds on a disconnected socket ((TIdContext*) SlotListeners->Objects[i])->Connection->IOHandler->WriteLn("Some DATA"); }catch(Exception &e) { SlotListeners->Delete(i); } } }__finally { LeaveCriticalSection(&SlotListenersCriticalSection); } Ok i already have a keep alive mechanism which disconnect the socket after n seconds of inactivity. But as you can imagine, still this mechnism cant sync exactly with this braodcasting loop because this braodcasting loop is running almost all the time. So is there any Write timeouts i can specify may be through iohandler or something ? I have seen many many threads about "Detecting disconnected tcp socket" but my problem is little different, i need to avoid that hangup for few seconds during the write attempt. So is there any solution ? Or should i consider using some different mechanism for such data broadcasting for example the broadcasting loop put the data packet in some kind of FIFO buffer and client threads continuously check for available data and pick and deliver it to themselves ? This way if one thread hangs it will not stop/delay the over all distribution thread. Any ideas please ? Thanks for your time and help. Regards Jams

  Read the article

• Making Global Struct in C++ Program

  - by mosg

  Hello world! I am trying to make global structure, which will be seen from any part of the source code. I need it for my big Qt project, where some global variables needed. Here it is: 3 files (global.h, dialog.h & main.cpp). For compilation I use Visual Studio (Visual C++). global.h #ifndef GLOBAL_H_ #define GLOBAL_H_ typedef struct TNumber { int g_nNumber; } TNum; TNum Num; #endif dialog.h #ifndef DIALOG_H_ #define DIALOG_H_ #include <iostream> #include "global.h" using namespace std; class ClassB { public: ClassB() {}; void showNumber() { Num.g_nNumber = 82; cout << "[ClassB][Change Number]: " << Num.g_nNumber << endl; } }; #endif and main.cpp #include <iostream> #include "global.h" #include "dialog.h" using namespace std; class ClassA { public: ClassA() { cout << "Hello from class A!\n"; }; void showNumber() { cout << "[ClassA]: " << Num.g_nNumber << endl; } }; int main(int argc, char **argv) { ClassA ca; ClassB cb; ca.showNumber(); cb.showNumber(); ca.showNumber(); cout << "Exit.\n"; return 0; } When I`m trying to build this little application, compilation works fine, but the linker gives me back an error: 1>dialog.obj : error LNK2005: "struct TNumber Num" (?Num@@3UTNumber@@A) already defined in main.obj Is there exists any solution? Thanks.

  Read the article

• Specializating a template function that takes a universal reference parameter

  - by David Stone

  How do I specialize a template function that takes a universal reference parameter? foo.hpp: template<typename T> void foo(T && t) // universal reference parameter foo.cpp template<> void foo<Class>(Class && class) { // do something complicated } Here, Class is no longer a deduced type and thus is Class exactly; it cannot possibly be Class &, so reference collapsing rules will not help me here. I could perhaps create another specialization that takes a Class & parameter (I'm not sure), but that implies duplicating all of the code contained within foo for every possible combination of rvalue / lvalue references for all parameters, which is what universal references are supposed to avoid. Is there some way to accomplish this? To be more specific about my problem in case there is a better way to solve it: I have a program that can connect to multiple game servers, and each server, for the most part, calls everything by the same name. However, they have slightly different versions for a few things. There are a few different categories that these things can be: a move, an item, etc. I have written a generic sort of "move string to move enum" set of functions for internal code to call, and my server interface code has similar functions. However, some servers have their own internal ID that they communicate with, some use strings, and some use both in different situations. Now what I want to do is make this a little more generic. I want to be able to call something like ServerNamespace::server_cast<Destination>(source). This would allow me to cast from a Move to a std::string or ServerMoveID. Internally, I may need to make a copy (or move from) because some servers require that I keep a history of messages sent. Universal references seem to be the obvious solution to this problem. The header file I'm thinking of right now would expose simply this: namespace ServerNamespace { template<typename Destination, typename Source> Destination server_cast(Source && source); } And the implementation file would define all legal conversions as template specializations.

  Read the article

• HTML-like GUI Framework in Java

  - by wintermute

  I was recently brought onto a project where we are developing a lot GUI elements for BlackBerry devices. The standard RIM APIs are pretty basic, almost never do what is required and are difficult or impossible to extend, so we end up re-implementing chunks of it. Currently the code we have isn't super organized and factored so there are lots of little tricks that get implemented over and over again. I had a thought about how to aid development efforts on this platform and wanted to see if the community could tell me if I'm still sane or if I've gone totally nuts. By far, the biggest organizational problem I've run into is making sure that each screen is laid out properly with proper padding and such. The current approach is to manually keep track of padding like so: protected void sublayout(int width, int height) { final int padding = 5; int y = padding; int x = padding; layoutChild(_someChild, width - padding * 2, height / 3 - padding * 2); setPositionChild(_someChild, x, y); y += _someChild.getHeight() + padding; // Calculate where to start drawing next. /* ... snipped ... */ } As you can see, positioning elements on a screen is a nightmare due to the tedium. I have investigated other GUI frameworks but, for a variety of reasons, it is difficult to find one that suites our purposes. One potential solution that came to me is to create a GUI framework who's API resembles HTML/CSS. This would allow for things like padding, margins, borders and colours to be handled through a sort of CSS API while the content would be organized using the HTML part of the API. It might look something like this: public class OptionsScreen extends Document { public OptionsScreen() { // You would set the style (like CSS style) through the constructor. Div content = new Div(new Style(new Padding(5), Color.BLACK)); // Then build up a tree of elements which can each have their own style's. // Each element knows how to draw itself, but it doesn't have to worry about // manually handling things like padding. // content.addChild(new P("This is a paragraph", new Style(new Padding(), Color.RED))); Ul list = new Ul(); list.addChild(new Li("item 1")); list.addChild(new Li("item 2")); content.addChild(list); addChild(content); } } I can imagine this making it easier to customize the UI of our app (which is very important) with different fonts, colours and layouts. Does this idea belong on The Daily WTF or do you think there is some promise?

  Read the article

• PHP echo query result in Class??

  - by Jerry

  Hi all I have a question about PHP Class. I am trying to get the result from Mysql via PHP. I would like to know if the best practice is to display the result inside the Class or store the result and handle it in html. For example, display result inside the Class class Schedule { public $currentWeek; function teamQuery($currentWeek){ $this->currentWeek=$currentWeek; } function getSchedule(){ $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } $scheduleQuery=mysql_query("SELECT guest, home, time, winner, pickEnable FROM $this->currentWeek ORDER BY time", $connection); if (!$scheduleQuery){ die("database has errors: ".mysql_error()); } while($row=mysql_fetch_array($scheduleQuery, MYSQL_NUMS)){ //display the result..ex: echo $row['winner']; } mysql_close($scheduleQuery); //no returns } } Or return the query result as a variable and handle in php class Schedule { public $currentWeek; function teamQuery($currentWeek){ $this->currentWeek=$currentWeek; } function getSchedule(){ $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } $scheduleQuery=mysql_query("SELECT guest, home, time, winner, pickEnable FROM $this->currentWeek ORDER BY time", $connection); if (!$scheduleQuery){ die("database has errors: ".mysql_error()); // create an array } $ret = array(); while($row=mysql_fetch_array($scheduleQuery, MYSQL_NUMS)){ $ret[]=$row; } mysql_close($scheduleQuery); return $ret; // and handle the return value in php } } Two things here: I found that returned variable in php is a little bit complex to play with since it is two dimension array. I am not sure what the best practice is and would like to ask you experts opinions. Every time I create a new method, I have to recreate the $connection variable: see below $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } It seems like redundant to me. Can I only do it once instead of calling it anytime I need a query? I am new to php class. hope you guys can help me. thanks.

  Read the article

• Newbie - what do I need to do with httpd.conf to make CakePHP work correctly?

  - by EmmyS

  (Not sure if this belongs here or on webmasters; please move if necessary.) I'm a total newbie to Cake and not much better with apache; I've done a lot of PHP but always with a server that's already been set up by someone else. So I'm going through the basic blog tutorial, and it says: A Note On mod_rewrite Occasionally a new user will run in to mod_rewrite issues, so I'll mention them marginally here. If the Cake welcome page looks a little funny (no images or css styles), it probably means mod_rewrite isn't functioning on your system. Here are some tips to help get you up and running: Make sure that an .htaccess override is allowed: in your httpd.conf, you should have a section that defines a section for each Directory on your server. Make sure the AllowOverride is set to All for the correct Directory. Make sure you are editing the system httpd.conf rather than a user- or site-specific httpd.conf. For some reason or another, you might have obtained a copy of CakePHP without the needed .htaccess files. This sometimes happens because some operating systems treat files that start with '.' as hidden, and don't copy them. Make sure your copy of CakePHP is from the downloads section of the site or our SVN repository. Make sure you are loading up mod_rewrite correctly! You should see something like LoadModule rewrite_module libexec/httpd/mod_rewrite.so and AddModule mod_rewrite.c in your httpd.conf." I'm using XAMPP on linux. I've found my httpd.conf file in opt/lampp/ etc, but am not sure what I need to do with it. I've searched for "rewrite", and there's only one line: LoadModule rewrite_module modules/mod_rewrite.so There's nothing about AddModule mod_rewrite.c. Do I just create a Directory section for the directory I've installed Cake in and set AlllowOverride to All? (I created a separate subdirectory of my wwwroot and installed in there, since I also have installs of Joomla and CodeIgniter.) Is there anything else I need to do? My download of Cake did come with two htaccess-type files (._.htaccess and .htaccess) - do I need to do anything with them? Thanks for any help you can provide to this non-server-admin. EDIT TO ADD virtual host sample: <VirtualHost *:80> ServerAdmin [email protected] DocumentRoot /www/docs/dummy-host.example.com ServerName dummy-host.example.com ServerAlias www.dummy-host.example.com ErrorLog logs/dummy-host.example.com-error_log CustomLog logs/dummy-host.example.com-access_log common </VirtualHost>

  Read the article

• Thoughts on streamlining multiple .Net apps

  - by John Virgolino

  We have a series of ASP.Net applications that have been written over the course of 8 years. Mostly in the first 3-4 years. They have been running quite well with little maintenance, but new functionality is being requested and we are running into IDE and platform issues. The apps were written in .Net 1.x and 2.x and run in separate spaces but are presented as a single suite of applications which use a common navigation toolbar (implemented as a user control). Every time we want to add something to a menu in the nav we have to modify it in all the apps which is a pain. Also, the various versions of Crystal reports and that we used tables to organize the visual elements and we end up with a mess, especially with all the multi-platform .Net versions running. We need to streamline the suite of apps and make it easier to add on new apps without a hassle. We also need to bring all these apps under one .Net platform and IDE. In addition, there is a WordPress blog styled to match the style of the application suite "integrated" into the UI and a link to a MediaWiki Wiki application as well. My current thinking is to use an open source content management system (CMS) like Joomla (PHP based unfortunately, but it works well) as the user interface framework for style templating and menu management. Joomla's article management would allow us to migrate the Wiki content into articles which could be published without interfering with the .Net apps. Then essentially use an IFrame within an "article" to "host" the .Net application, then... Upgrade the .Net apps to VS2010, strip out all the common header/footer controls and migrate the styles to use the style sheets used in the CMS. As I write this, I certainly realize this is a lot of work and there are optimization issues which this may cause as well as using IFrames seems a bit like cheating and I've read about issues with IFrames. I know that we could use .Net application styling, but it seems like a lot more work (not sure really). Also, the use of a CMS to handle the blog and wiki also seems appealing, unless there is a .Net CMS out there that can handle all of these requirements. Given this information, I am looking to know if I am totally going in the wrong direction? We tried to use open source and integrate it over time, but not this has become hard to maintain. Am I not aware of some technology out there that will meet our requirements? Did we do this right and should we just focus on getting the .Net streamlined? I understand that no matter what we do, it's going to be a lot of work. The communities considerable experience would be helpful. Thanks!! PS - A complete rewrite is not an option.

  Read the article

• Primary language - C++/Qt, C#, Java?

  - by Airjoe

  I'm looking for some input, but let me start with a bit of background (for tl;dr skip to end). I'm an IT major with a concentration in networking. While I'm not a CS major nor do I want to program as a vocation, I do consider myself a programmer and do pretty well with the concepts involved. I've been programming since about 6th grade, started out with a proprietary game creation language that made my transition into C++ at college pretty easy. I like to make programs for myself and friends, and have been paid to program for local businesses. A bit about that- I wrote some programs for a couple local businesses in my senior year in high school. I wrote management systems for local shops (inventory, phone/pos orders, timeclock, customer info, and more stuff I can't remember). It definitely turned out to be over my head, as I had never had any formal programming education. It was a great learning experience, but damn was it crappy code. Oh yeah, by the way, it was all vb6. So, I've used vb6 pretty extensively, I've used c++ in my classes (intro to programming up to algorithms), used Java a little bit in another class (had to write a ping client program, pretty easy) and used Java for some simple Project Euler problems to help learn syntax and such when writing the program for the class. I've also used C# a bit for my own simple personal projects (simple programs, one which would just generate an HTTP request on a list of websites and notify if one responded unexpectedly or not at all, and another which just held a list of things to do and periodically reminded me to do them), things I would've written in vb6 a year or two ago. I've just started using Qt C++ for some undergrad research I'm working on. Now I've had some formal education, I [think I] understand organization in programming a lot better (I didn't even use classes in my vb6 programs where I really should have), how it's important to structure code, split into functions where appropriate, document properly, efficiency both in memory and speed, dynamic and modular programming etc. I was looking for some input on which language to pick up as my "primary". As I'm not a "real programmer", it will be mostly hobby projects, but will include some 'real' projects I'm sure. From my perspective: QtC++ and Java are cross platform, which is cool. Java and C# run in a virtual machine, but I'm not sure if that's a big deal (something extra to distribute, possibly a bit slower? I think Qt would require additional distributables too, right?). I don't really know too much more than this, so I appreciate any help, thanks! TL;DR Am an avocational programmer looking for a language, want quick and straight forward development, liked vb6, will be working with database driven GUI apps- should I go with QtC++, Java, C#, or perhaps something else?

  Read the article

• Recommended ASP.NET Shared Hosting

  - by coffeeaddict

  Ok, I have to admit I'm getting fed up with www.discountasp.net's pricing model and this annoyance has built up over the past 8 years or so. I've been with them for years and absolutely love them on the technical side, however it's getting ridiculously expensive for so little that you get. I mean here's my scenario: 1) I am running 2 SQL Server databases which costs me $10/ea per month so that's $20/month for 2 and I only get 500 mb disk space which is horrible 2) I am paying $10/mo just for the hosting itself which I only get 1 gig of disk space! I mean common! 3) I am simply running 2 small apps (Screwturn Wiki & Subtext Blog)...so I don't really care if it's up 99% or not, it's not worth paying a total of $300 just to keep these 2 apps running over discountasp.net Anyone else feel the same? Yes, I know they have great support, probably have great servers running behind this but in the end I really don't care as long as my site is up 95% or better. Yes, the hosting toolset rocks. But you know I bet you I can find a similar set somewhere else. I like how I can totally control IIS 7 at discountasp and I can control my own app pool etc. That's very powerful and essential. But anyone have any good alternatives to discountasp that gives me close to the same at a much more reasonable cost point? I mean http://www.m6.net/prices.aspx gives you 10 SQL Databases for $7 and 200 gigs disk space! I don't know about their tools or support but just looking at those numbers and some other hosts I've seen, I feel that discountasp.net is way out of line. They don't even offer any purchasing discounts such as it would be nice if my 2nd SQL Server is only $5/month not $10...stuff like this, to make it much more realistic and fair. Opinions (people who do have discountasp.net, people who have left them, or people who have another host they like)??? But geez $300 just to host a couple DBs and lightweight open source apps? Not worth the price they are charging. I'm almost at a price point that enables me to get a decent dedicated server! I really don't care about beta support. Not a big deal to me.

  Read the article

• Why the parent page get refreshed when I click the link to open thickbox-styled form?

  - by user333205

  Hi, all: I'm using Thickbox 3.1 to show signup form. The form content comes from jquery ajax post. The jquery lib is of version 1.4.2. I placed a "signup" link into a div area, which is a part of my other large pages, and the whole content of that div area is ajax+posted from my server. To make thickbox can work in my above arangement, I have modified the thickbox code a little like that: //add thickbox to href & area elements that have a class of .thickbox function tb_init(domChunk){ $(domChunk).live('click', function(){ var t = this.title || this.name || null; var a = this.href || this.alt; var g = this.rel || false; tb_show(t,a,g); this.blur(); return false; });} This modification is the only change against the original version. Beacause the "signup" link is placed in ajaxed content, so I Use live instead of binding the click event directly. When I tested on my pc, the thickbox works well. I can see the signup form quickly, without feeling the content of the parent page(here, is the other large pages) get refreshed. But after transmiting my site files into VHost, when I click the "signup" link, the signup form get presented very slowly. The large pages get refreshed evidently, because the borwser(ie6) are reloading images from server incessantly. These images are set as background images in CSS files. I think that's because the slow connection of network. But why the parent pages get refreshed? and why the browser reloads those images one more time? Havn't those images been placed in local computer's disk? Is there one way to stop that reloadding? Because the signup form can't get displayed sometimes due to slow connection of network. To verified the question, you can access http://www.juliantec.info/track-the-source.html and click the second link in left grey area, that is the "signup" link mentioned above. Thinks!

  Read the article

• How to replicate this button in CSS

  - by jasondavis

  I am trying to create a CSS theme switcher button like below. The top image shows what I have so far and the bottom image shows what I am trying to create. I am not the best at this stuff I am more of a back-end coder. I could really use some help. I have a live demo of the code here http://dabblet.com/gist/2230656 Just looking at what I have and the goal image, some differences. I need to add a gradient The border is not right on mine Radius is a little off Possibly some other stuff? Also here is the code...it can be changed anyway to improve this, the naming and stuff could be improved I am sure but I can use any help I can get. HTML <div class="switch-wrapper"> <div class="switcher left selected"> <span id="left">....</span> </div> <div class="switcher right"> <span id="right">....</span> </div> </div> CSS /* begin button styles */ .switch-wrapper{ width:400px; margin:220px; } .switcher { background:#507190; display: inline-block; max-width: 100%; box-shadow: 1px 1px 1px rgba(0,0,0,.3); position:relative; } #left, #right{ width:17px; height:11px; overflow:hidden; position:absolute; top:50%; left:50%; margin-top:-5px; margin-left:-8px; font: 0/0 a; } #left{ background-image: url(http://www.codedevelopr.com/assets/images/switcher.png); background-position: 0px px; } #right{ background-image: url(http://www.codedevelopr.com/assets/images/switcher.png); background-position: -0px -19px; } .left, .right{ width: 30px; height: 25px; border: 1px solid #3C5D7E; } .left{ border-radius: 6px 0px 0px 6px; } .right{ border-radius: 0 6px 6px 0; margin: 0 0 0 -6px } .switcher:hover, .selected { background: #27394b; box-shadow: -1px 1px 0px rgba(255,255,255,.4), inset 0 4px 5px rgba(0,0,0,.6), inset 0 1px 2px rgba(0,0,0,.6); }

  Read the article

• Is it possible to create a service like Feed My Inbox on my own server?

  - by Mark Bowen

  I was just wondering if it's at all possible to create a service like Feed My Inbox on my own server using PHP? Basically I have a site which has RSS feeds which are dynamic in nature and can search from thousands of posts based on many different criteria. I have the RSS feed working fine and bringing back data dynamically for whatever criteria I want so that bits fine. I am using the ExpressionEngine CMS to handle the site and there will be thousands of users on the site (currently there are around 2,0000) but that number is exponentially growing every single day. What I want to be able to do is allow the users to choose from certain criteria which will then build a dynamic RSS URL which will then be stored in a database table (one row for each user). This bit I will be able to do myself but then I want to be able to send out new RSS feed items via e-mail to each user. This is the part I'm a little stuck on. I'm guessing I would somehow need to run a cron job to hit a page which would check each users RSS feed and then if there are new items to send them to the user via e-mail. That's where I am totally stuck though and I'm just wondering what the best way to go about it would be? That or any software in PHP that already does this sort of thing would be great. I tried out phpList but it has severe problems working with RSS and I only ever got it to work once and now never again and I've read that lots of people have had this same problem so unfortunately it's not just me :-( I know there are services such as Feed My Inbox which I could easily set up so that users click a link and their RSS feed URL is added to go and use that service but I want to keep users from seeing the dynamic nature of the feed or they will easily be able to modify it to get at other items in the feed. I need this so that I can charge for access to the feeds but if people can see the URL of the feed then I will be totally unstuck as they will be able to get at whatever they want very easily. Therefore I'd like to be able to send the items out to them. Would really love to hear if anyone knows if this kind of thing is possible at all and what would be involved?

  Read the article

• Mixing .NET versions between website and virtual directories and the "server application unavailable" error Message

  - by Doug Chamberlain

  Backstory Last month our development team created a new asp.net 3.5 application to place out on our production website. Once we had the work completed, we requested from the group that manages are server to copy the app out to our production site, and configure the virtual directory as a new application. On 12/27/2010, two public 'Gineau Pigs' were selected to use the app, and it worked great. On 12/30/2010, We received notification by internal staff, that when that staff member tried to access the application (this was the Business Process Owner) they recieved the 'Server Application Unavailable' message. When I called the group that does our server support, I was told that it probably failed, because I didn't close the connections in my code. However, the same group went in and then created a separate app pool for this Extension Request application. It has had no issues since. I did a little googling, since I do not like being blamed for things. I found that the 'Server Application Unavailable' message will also appear when you have multiple applications using different frameworks and you do not put them in different application pools. Technical Details - Tree of our website structure Main Website <-- ASP Classic +-Virtual Directory(ExtensionRequest) <-- ASP 3.5 From our server support group: 'Reviewed server logs and website setup in IIS. Had to reset the application pool as it was not working properly. This corrected the website and it is now back online. We went ahead and created a application pool for the extension web so it is isolated from the main site pool. In the past we have seen other application do this when there is a connection being left open and the pool fills up. Would recommend reviewing site code to make sure no connections are being left open.' The Real Question: What really caused the failure? Isn't the connection being left open issue an ASP Classic issue? Wouldn't the ExtensionRequest application have to be used (more than twice) in the first place to have the connections left open? Is it more likely the failure is caused by them not bothering to setup the new Application in it's own App Pool in the first place? Sorry for the long windedness

  Read the article

• text in textbox shows up as circles instead of regular characters?

  - by BlueMonster

  When i type in either of the textboxes i get little circles appearing instead of text. Why is this happening and how do i stop it? Code is as follows: HTML: <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="MainPage.aspx.cs" Inherits="Foods.MainPage" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <link id="Link1" rel="stylesheet" type="text/css" href="Styles/mainStyle.css"/> </head> <body> <form id="form1" runat="server"> <div class = "userIDTboxDiv"> <div class = "userIDTboxText"> &nbsp;&nbsp;&nbsp; Enter User ID: </div> <asp:TextBox id="userIDBox" TextMode="password" runat="server" Height="52px" Width="200px" /> </div> <div class = "passwordTboxDiv"> <div class = "passwordTboxText"> &nbsp;&nbsp;&nbsp; Enter User Password: </div> <asp:TextBox id="TextBox1" TextMode="password" runat="server" Height="52px" Width="200px" /> </div> </form> </body> CSS: body { text-decoration:none; background: white; } input { margin-left: 0px; margin-top: 7px; } .userIDTboxDiv { padding-top: 20%; padding-left: 45%; width: 15%; height: 30%; } .userIDTboxText { padding-left: 17%; height: auto; width:203px; } .passwordTboxDiv { padding-top: 2%; padding-left: 45%; width: 15%; height: 111px; } .passwordTboxText { padding-left: 10%; height: auto; width:203px; }

  Read the article

• How do I remove elements from a jQuery wrapped set

  - by Bungle

  I'm a little confused about which jQuery method and/or selectors to use when trying to select an element, and then remove certain descendant elements from the wrapped set. For example, given the following HTML: <div id="article"> <div id="inset"> <ul> <li>This is bullet point #1.</li> <li>This is bullet point #2.</li> <li>This is bullet point #3.</li> </ul> </div> <p>This is the first paragraph of the article</p> <p>This is the second paragraph of the article</p> <p>This is the third paragraph of the article</p> </div> I want to select the article: var $article = $('#article'); but then remove <div id="inset"></div> and its descendants from the wrapped set. I tried the following: var $article = $('#article').not('#inset'); but that didn't work, and in retrospect, I think I can see why. I also tried using remove() unsuccessfully. What would be the correct way to do this? Ultimately, I need to set this up in such a way that I can define a configuration array, such as: var selectors = [ { select: '#article', exclude: ['#inset'] } ]; where select defines a single element that contains text content, and exclude is an optional array that defines one or more selectors to disregard text content from. Given the final wrapped set with the excluded elements removed, I would like to be able to call jQuery's text() method to end up with the following text: This is the first paragraph of the article.This is the second paragraph of the article.This is the third paragraph of the article. The configuration array doesn't need to work exactly like that, but it should provide roughly equivalent configuration potential. Thanks for any help you can provide!

  Read the article

• What database table structure should I use for versions, codebases, deployables?

  - by Zac Thompson

  I'm having doubts about my table structure, and I wonder if there is a better approach. I've got a little database for version control repositories (e.g. SVN), the packages (e.g. Linux RPMs) built therefrom, and the versions (e.g. 1.2.3-4) thereof. A given repository might produce no packages, or several, but if there are more than one for a given repository then a particular version for that repository will indicate a single "tag" of the codebase. A particular version "string" might be used to tag a version of the source code in more than one repository, but there may be no relationship between "1.0" for two different repos. So if packages P and Q both come from repo R, then P 1.0 and Q 1.0 are both built from the 1.0 tag of repo R. But if package X comes from repo Y, then X 1.0 has no relationship to P 1.0. In my (simplified) model, I have the following tables (the x_id columns are auto-incrementing surrogate keys; you can pretend I'm using a different primary key if you wish, it's not really important): repository - repository_id - repository_name (unique) ... version - version_id - version_string (unique for a particular repository) - repository_id ... package - package_id - package_name (unique) - repository_id ... This makes it easy for me to see, for example, what are valid versions of a given package: I can join with the version table using the repository_id. However, suppose I would like to add some information to this database, e.g., to indicate which package versions have been approved for release. I certainly need a new table: package_version - version_id - package_id - package_version_released ... Again, the nature of the keys that I use are not really important to my problem, and you can imagine that the data column is "promotion_level" or something if that helps. My doubts arise when I realize that there's really a very close relationship between the version_id and the package_id in my new table ... they must share the same repository_id. Only a small subset of package/version combinations are valid. So I should have some kind of constraint on those columns, enforcing that ... ... I don't know, it just feels off, somehow. Like I'm including somehow more information than I really need? I don't know how to explain my hesitance here. I can't figure out which (if any) normal form I'm violating, but I also can't find an example of a schema with this sort of structure ... not being a DBA by profession I'm not sure where to look. So I'm asking: am I just being overly sensitive?

  Read the article

• How to properly preload images, js and css files?

  - by Kenny Bones

  Hi, I'm creating a website from scratch and I was really into this in the late 90's but the web has changed alot since then! And I'm more of a designer so when I started putting this site together, I basically did a system of php includes to make the site more "dynamic" When you first visit the site, you'll be presented to a logon screen, if you're not already logged on (cookies). If you're not logged on, a page called access.php is introdused. I thought I'd preload the most heavy images at this point. So that when the user is done logging on, the images are already cached. And this is working as I want. But I still notice that the biggest image still isn't rendered immediatly anyway. So it's seems kinda pointless. All of this has made me rethink how the site is structured and how scripts and css files are loaded. Using FireBug and YSlow with Firefox I see a few pointers like expires headers and reducing the size of each script. But is this really the culprit? For example, would this be really really stupid in the main index.php? The entire site is basically structured like this <?php require("dbconnect.php"); ?> <?php include ("head.php"); ?> And below this is basically just the body and the content of the site. Head.php however consists of the doctype, head portions, linking of two css style sheets, jQuery library, jQuery validation engine, Cufon and Cufon font file, and then the small Cufon.Replace snippet. The rest of the body comes with the index.php file, but at the bottom of this again is an include of a file called "footer.php" which basically consists of loading of a couple of jsLoader scripts and a slidepanel and then a js function. All of this makes the end page source look like a typical complete webpage, but I'm wondering if any of you can see immediatly that "this is really really stupid" and "don't do that, do this instead" etc. :) Are includes a bad way to go? This site is also pretty image intensive and I can probably do a little more optimization. But I don't think that's its the primary culprit. YSlow gives me a report of what takes up the most space: doc(1) - 5.8K js(5) - 198.7K css(2) - 5.6K cssimage(8) - 634.7K image(6) - 110.8K I know it looks like it's cssimage(8) that weighs the most, but I've already preloaded these images from before and it doesn't really affect the rendering.

  Read the article

• Jumping into argv?

  - by jth

  Hi, I`am experimenting with shellcode and stumbled upon the nop-slide technique. I wrote a little tool that takes buffer-size as a parameter and constructs a buffer like this: [ NOP | SC | RET ], with NOP taking half of the buffer, followed by the shellcode and the rest filled with the (guessed) return address. Its very similar to the tool aleph1 described in his famous paper. My vulnerable test-app is the same as in his paper: int main(int argc, char **argv) { char little_array[512]; if(argc>1) strcpy(little_array,argv[1]); return 0; } I tested it and well, it works: jth@insecure:~/no_nx_no_aslr$ ./victim $(./exploit 604 0) $ exit But honestly, I have no idea why. Okay, the saved eip was overwritten as intended, but instead of jumping somewhere into the buffer, it jumped into argv, I think. gdb showed up the following addresses before strcpy() was called: (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x80483ed in main (victim.c:7); saved eip 0x154b56 source language c. Arglist at 0xbffff1e8, args: argc=2, argv=0xbffff294 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec Address of little_array: (gdb) print &little_array[0] $1 = 0xbfffefe8 "\020" After strcpy(): (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x804840d in main (victim.c:10); saved eip 0xbffff458 source language c. Arglist at 0xbffff1e8, args: argc=-1073744808, argv=0xbffff458 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec So, what happened here? I used a 604 byte buffer to overflow little_array, so he certainly overwrote saved ebp, saved eip and argc and also argv with the guessed address 0xbffff458. Then, after returning, EIP pointed at 0xbffff458. But little_buffer resides at 0xbfffefe8, that`s a difference of 1136 byte, so he certainly isn't executing little_array. I followed execution with the stepi command and well, at 0xbffff458 and onwards, he executes NOPs and reaches the shellcode. I'am not quite sure why this is happening. First of all, am I correct that he executes my shellcode in argv, not little_array? And where does the loader(?) place argv onto the stack? I thought it follows immediately after argc, but between argc and 0xbffff458, there is a gap of 620 bytes. How is it possible that he successfully "lands" in the NOP-Pad at Address 0xbffff458, which is way above the saved eip at 0xbffff1ec? Can someone clarify this? I have actually no idea why this is working. My test-machine is an Ubuntu 9.10 32-Bit Machine without ASLR. victim has an executable stack, set with execstack -s. Thanks in advance.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Running OpenMPI on Windows XP

  - by iamweird

  Hi there. I'm trying to build a simple cluster based on Windows XP. I compiled OpenMPI-1.4.2 successfully, and tools like mpicc and ompi_info work too, but I can't get my mpirun working properly. The only output I can see is Z:\orterun --hostfile z:\hosts.txt -np 2 hostname [host0:04728] Failed to initialize COM library. Error code = -2147417850 [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\mca\ess\hnp\ess_hnp_module.c at line 218 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_plm_init failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\runtime\orte_init.c at line 132 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_ess_set_name failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\..\..\openmpi -1.4.2\orte\tools\orterun\orterun.c at line 543 Where z:\hosts.txt appears as follows: host0 host1 Z: is a shared network drive available to both host0 and host1. What my problem is and how do I fix it? Upd: Ok, this problem seems to be fixed. It seems to me that WideCap driver and/or software components causes this error to appear. A "clean" machine runs local task successfully. Anyway, I still cannot run a task within at least 2 machines, I'm getting following message: Z:\mpirun --hostfile z:\hosts.txt -np 2 hostname connecting to host1 username:cluster password:******** Save Credential?(Y/N) y [host0:04728] This feature hasn't been implemented yet. [host0:04728] Could not connect to namespace cimv2 on node host1. Error code =-2147024891 -------------------------------------------------------------------------- mpirun was unable to start the specified application as it encountered an error. More information may be available above. -------------------------------------------------------------------------- I googled a little and did all the things as described here: http://www.open-mpi.org/community/lists/users/2010/03/12355.php but I'm still getting the same error. Can anyone help me? Upd2: Error code -2147024891 might be WMI error WBEM_E_INVALID_PARAMETER (0x80041008) which occures when one of the parameters passed to the WMI call is not correct. Does this mean that the problem is in OpenMPI source code itself? Or maybe it's because of wrong/outdated wincred.h and credui.lib I used while building OpenMPI from the source code?

  Read the article

• How to get a physics engine like Nape working?

  - by Glacius

  Introduction: I think Nape is a relatively new engine so some of you may not know it. It's supposedly faster than box2d and I like that there is decent documentation. Here's the site: http://code.google.com/p/nape/ I'm relatively new to programming. I am decent at AS3's basic functionality, but every time I try to implement some kind of engine or framework I can't even seem to get it to work. With Nape I feel I got a little further than before but I still got stuck. My problem: I'm using Adobe CS5, I managed to import the SWC file like described here. Next I tried to copy the source of one of the demo's like this one and get it to work but I keep getting errors. I made a new class file, copied the demo source to it, and tried to add it to the stage. My stage code basically looks like this: import flash.Boot; // these 2 lines are as described in the tutorial new Boot(); var demo = new Main(); // these 2 are me guessing what I'm supposed to do addChild(demo); Well, it seems the source code is not even being recognized by flash as a valid class file. I tried editing it, but even if I get it recognized (give a package name and add curly brackets) but I still get a bunch of errors. Is it psuedo code or something? What is going on? My goal: I can imagine I'm going about this the wrong way. So let me explain what I'm trying to achieve. I basically want to learn how to use the engine by starting from a simple basic example that I can edit and mess around with. If I can't even get a working example then I'm unable to learn anything. Preferably I don't want to start using something like FlashDevelop (as I'd have to learn how to use the program) but if it can't be helped then I can give it a try. Thank you.

  Read the article

< Previous Page | 467 468 469 470 471 472 473 474 475 476 477 478  | Next Page >