Search Results

Search found 13948 results on 558 pages for 'document centric'.

Page 472/558 | < Previous Page | 468 469 470 471 472 473 474 475 476 477 478 479  | Next Page >

• Choosing a W3C valid DOCTYPE and charset combination?

  - by George Carter

  I have a homepage with the following: <DOCTYPE html> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"> My choice of the DOCTYPE "html" is based on a recommendation for html pages using jQuery. My choice of charset=utf=8 is based on a recommendation to make my pages readable on most browsers. But these choices may be wrong. When I run this page thru the W3C HTML validator, I get messages you see below. Any way I can eliminate the 2 errors? ! Using experimental feature: HTML5 Conformance Checker. The validator checked your document with an experimental feature: HTML5 Conformance Checker. This feature has been made available for your convenience, but be aware that it may be unreliable, or not perfectly up to date with the latest development of some cutting-edge technologies. If you find any issue with this feature, please report them. Thank you. Validation Output: 2 Errors 1. Error Line 18, Column 70: Changing character encoding utf-8 and reparsing. …ntent-Type" content="text/html; charset=utf-8"> 2. Error Line 18, Column 70: Changing encoding at this point would need non-streamable behavior. …ntent-Type" content="text/html; charset=utf-8">

  Read the article

• How to make HTML layout whitespace-agnostic?

  - by ssg

  If you have consecutive inline-blocks white-space becomes significant. It adds some level of space between elements. What's the "correct" way of avoiding whitespace effect to HTML layout if you want those blocks to look stuck to each other? Example: <span>a</span> <span>b</span> This renders differently than: <span>a</span><span>b</span> because of the space inbetween. I want whitespace-effect to go away without compromising HTML source code layout. I want my HTML templates to stay clean and well-indented. I think these options are ugly: 1) Tweaking text-indent, margin, padding etc. (Because it would be dependent on font-size, default white-space width etc) 2) Putting everything on a single line, next to each other. 3) Zero font-size. That would require overriding font-size in blocks, which would otherwise be inherited. 4) Possible document-wide solutions. I want the solution to stay local for a certain block of HTML. Any ideas, any obvious points which I'm missing?

  Read the article

• How do I use Core Data with the Cocoa Text Input system?

  - by the Joel

  Hobbyist Cocoa programmer here. Have been looking around all the usual places, but this seems relatively under-explained: I am writing something a little out of the ordinary. It is much simpler than, but similar to, a desktop publishing app. I want editable text boxes on a canvas, arbitrarily placed. This is document-based and I’d really like to use Core Data. Now, The cocoa text-handling system seems to deal with a four-class structure: NSTextStorage, NSLayoutManager, NSTextContainer and finally NSTextView. I have looked into these and know how to use them, sort of. Have been making some prototypes and it works for simple apps. The problem arrives when I get into persistency. I don't know how to, by way of Cocoa Bindings or something else, store the contents of NSTextStorage (= the actual text) in my managed object context. I have considered overriding methods pairs like -words, -setWords: in these objects. This would let me link the words to a String, which I know how to store in Core Data. However, I’d have to override any method that affects the text - and that seems a little much. Thankful for any insights.

  Read the article

• Making a jQuery plugin to feed Tumblr to site

  - by tylorreimer

  I have some experience with PHP and a little with JS but I'm far from anything proficient. I'm trying to make a jQuery plugin for my site that I can call in my HTML via something like this: $('.new').tumble({username: "tylor", count: 9}); Which would basically put the Tumblr list the code should make into the DIV with class 'new' in this case. Here is my code so far; the problem seems to be how to get it to pick up class/id from the original call (in the HTML) and use that in the jQuery. Here's the code so far: (function($) { $.fn.tumble = function(options){ var settings = $.extend({ username: null, // [string or array] required to get url for tumblr account count: 3, // [integer] how many posts to display? }, options); //url construction var url = "http://" + settings.username + ".tumblr.com"; var jsonurl = url + "/api/read/json?num=" + settings.count + "&callback=?"; $.getJSON(jsonurl, function(data) { var items = []; $.each(data.posts, function(id, url) { // Goes over each post in the JSON document retrieved from data URL var url = this.url; // Just assigns a variable to the url to avoid constantly writing "this.whatever" var photourl = this['photo-url-250']; // photo-url-xxx needs to be called this way due to integers in the name items.push('<li><a href="' + url + '">' + photourl + '</a></li>'); }); $('<ul/>', { // Creates an empty list html: items.join('') // Takes the values in the item array and puts 'em together }).appendTo('.new'); // I don't want this to have the class set in the jQuery itself }); //end json }; })( jQuery ); Any help you can lend would be wonderful. Thank you

  Read the article

• Problem executing trackPageview with Google Analytics.

  - by dmrnj

  I'm trying to capture the clicks of certain download links and track them in Google Analytics. Here's my code var links = document.getElementsByTagName("a"); for (var i = 0; i < links.length; i++) { linkpath = links[i].pathname; if( linkpath.match(/\.(pdf|xls|ppt|doc|zip|txt)$/) || links[i].href.indexOf("mode=pdf") >=0 ){ //this matches our search addClickTracker(links[i]); } } function addClickTracker(obj){ if (obj.addEventListener) { obj.addEventListener('click', track , true); } else if (obj.attachEvent) { obj.attachEvent("on" + 'click', track); } } function track(e){ linkhref = (e.srcElement) ? e.srcElement.pathname : this.pathname; pageTracker._trackPageview(linkhref); } Everything up until the pageTracker._trackPageview() call works. In my debugging linkhref is being passed fine as a string. No abnormal characters, nothing. The issue is that, watching my http requests, Google never makes a second call to the tracking gif (as it does if you call this function in an "onclick" property). Calling the tracker from my JS console also works as expected. It's only in my listener. Could it be that my listener is not deferring the default action (loading the new page) before it has a chance to contact Google's servers? I've seen other tracking scripts that do a similar thing without any deferral.

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• ASP.NET - Webservice not being called from javascript

  - by Robert

  Ok I'm stumped on this one. I've got a ASMX web service up and running. I can browse to it (~/Webservice.asmx) and see the .NET generated page and test it out.. and it works fine. I've got a page with a Script Manager with the webservice registered... and i can call it in javascript (Webservice.Method(...)) just fine. However, I want to use this Webservice as part of a jQuery Autocomplete box. So I have use the url...? and the Webservice is never being called. Here's the code. [WebService(Namespace = "http://tempuri.org/")] [WebServiceBinding(ConformsTo = WsiProfiles.BasicProfile1_1)] // To allow this Web Service to be called from script, using ASP.NET AJAX, uncomment the following line. [System.Web.Script.Services.ScriptService] public class User : System.Web.Services.WebService { public User () { //Uncomment the following line if using designed components //InitializeComponent(); } [WebMethod] public string Autocomplete(string q) { StringBuilder sb = new StringBuilder(); //doStuff return sb.ToString(); } web.config <system.web> <webServices> <protocols> <add name="HttpGet"/> <add name="HttpPost"/> </protocols> </webServices> And the HTML $(document).ready(function() { User.Autocomplete("rr", function(data) { alert(data); });//this works ("#<%=txtUserNbr.ClientID %>").autocomplete("/User.asmx/Autocomplete"); //doesn't work $.ajax({ url: "/User.asmx/Autocomplete", success: function() { alert(data); }, error: function(e) { alert(e); } }); //just to test... calls "error" function });

  Read the article

• pdf external streams in Max OS X Preview

  - by olpa

  According to the specification, a part of a PDF document can reside in an external file. An example for an image: 2 0 obj << /Type /XObject /Subtype /Image /Width 117 /Height 117 /BitsPerComponent 8 /Length 0 /ColorSpace /DeviceRGB /FFilter /DCTDecode /F (pinguine.jpg) >> stream endstream endobj I found that this functionality does work in Adobe Acrobat 5.0 for Windows (sample PDF with the image), also I managed to view this file in Adobe Acrobat Reader 8.1.3 for Mac OS X after I found the setting "Allow external content". Unfortunately, it seems that non-Adobe tools ignore the external stream feature. I hope I'm wrong, therefore ask the question: How to enable external streams in Mac OS X? (I think that all the system Mac OS X tools use the same library, therefore say "Mac OS X" instead of "Preview".) Or maybe there could be a programming hook to emulate external streams? My task is: store a big set of images (total ˜300Mb) outside of a small PDF (˜1Mb). At some moment, I want to filter PDF through a quartz filter and get a PDF with the images embedded. Any suggestions are welcome.

  Read the article

• Fixed div once page is scrolled is flickering

  - by jasondavis

  I am trying to have an advertisement block/div that will be hald way down the page, once you scroll do the page to this point it will stick to the top. Here is a demo of what I am trying to do and the code I am using to do it with... http://jsfiddle.net/jasondavis/6vpA7/3/embedded/result/ In the demo it works perfectly how I am wanting it to be, however when I implement it on my live site, http://goo.gl/zuaZx it works but when you scroll down the div flickers in and out of view on each scroll or down key press. On my site to see the problem live it is the blokc on the right sidebar that says "Recommended Books" Here is the code I am using... $(document).ready( function() { $(window).scroll( function() { if ($(window).scrollTop() > $('#social-container').offset().top) $('#social').addClass('floating'); else $('#social').removeClass('floating'); } ); } );? css #social.floating { position: fixed; top: 0; }? My demo jsfiddle where it works correctly http://jsfiddle.net/jasondavis/6vpA7/3/ The only thing different on my live site is the div/id name is different. As you can see it is somewhat working on my live site except the flickering in and out of view as you scroll down the page. Anyone have any ideas why this would happen on my live site and not on my jsfiddle demo?

  Read the article

• Divs, flash and doctype :(

  - by nick

  I have a web-site, that uses colorbox, it also has flash header. Everything works fine in both ff and ie. Before ive started to use colorbox, i had little div that covered small part of flash header for menu purposes. Now, since im using colorbox, i had to declare doctype, and set wmode on flash to 'opaque', in order everything to work right way.But now i cant get that little div, to appear on top of my flash header. If anyone can help me with this, please do so.... or atleast tell me what should i read : ( im will be very gratefull for any solution. current html document structure: ... all the js and css files ... heres that div's style from corresponding css file: .cell_r0_c0{position: absolute;left: 61%;width:260;height:69; background-color: #000000; vertical-align: bottom;} I think i've allready tried all the combinations of position attribute, also tried diff z-index values, and i can't get it work the way i want. Maybe ive missed something idk. Please help me :(

  Read the article

• Validate a XDocument against schema without the ValidationEventHandler (for use in a HTTP handler)

  - by Vaibhav Garg

  Hi everyone, (I am new to Schema validation) Regarding the following method, System.Xml.Schema.Extensions.Validate( ByVal source As System.Xml.Linq.XDocument, ByVal schemas As System.Xml.Schema.XmlSchemaSet, ByVal validationEventHandler As System.Xml.Schema.ValidationEventHandler, ByVal addSchemaInfo As Boolean) I am using it as follows inside a IHttpHandler - Try Dim xsd As XmlReader = XmlReader.Create(context.Server.MapPath("~/App_Data/MySchema.xsd")) Dim schemas As New XmlSchemaSet() : schemas.Add("myNameSpace", xsd) : xsd.Close() myXDoxumentOdj.Validate(schemas, Function(s As Object, e As ValidationEventArgs) SchemaError(s, e, context), True) Catch ex1 As Threading.ThreadAbortException 'manage schema error' Return Catch ex As Exception 'manage other errors' End Try The handler- Function SchemaError(ByVal s As Object, ByVal e As ValidationEventArgs, ByVal c As HttpContext) As Object If c Is Nothing Then c = HttpContext.Current If c IsNot Nothing Then HttpContext.Current.Response.Write(e.Message) HttpContext.Current.Response.End() End If Return New Object() End Function This is working fine for me at present but looks very weak. I do get errors when I feed it bad XML. But i want to implement it in a more elegant way. This looks like it would break for large XML etc. Is there some way to validate without the handler so that I get the document validated in one go and then deal with errors? To me it looks Async such that the call to Validate() would pass and some non deterministic time later the handler would get called with the result/errors. Is that right? Thanks and sorry for any goofy mistakes :).

  Read the article

• Calling jQuery method from onClick attribute in HTML

  - by Russell

  I am relatively new to implementing JQuery throughout an entire system, and I am enjoying the opportunity. I have come across one issue I would love to find the correct resolve for. Here is a simple case example of what I want to do: I have a button on a page, and on the click event I want to call a jquery function I have defined. Here is the code I have used to define my method (Page.js): (function($) { $.fn.MessageBox = function(msg) { alert(msg); }; }); And here is my HTML page: <HTML> <head> <script type="text/javascript" src="C:\Sandpit\jQueryTest\jquery-1.3.2.js"></script> <script language="javascript" src="Page.js"></script> </head> <body> <div class="Title">Welcome!</div> <input type="button" value="ahaha" onclick="$().MessageBox('msg');" /> </body> </HTML> (The above code displays the button, but clicking does nothing.) I am aware I could add the click event in the document ready event, however it seems more maintainable to put events in the HTML element instead. However I have not found a way to do this. Is there a way to call a jquery function on a button element (or any input element)? Or is there a better way to do this? Thanks

  Read the article

• jQuery noobie can't make a checked checkbox show an alert.

  - by Kyle Sevenoaks

  I found this answer before, to fire an alert if the button is pressed but the checkbox isn't checked. Why won't this work? <input value="1" type="checkbox" name="salgsvilkar" ID="checkbox2" style="float:left;" onclick="document.getElementById('scrollwrap').style.cssText='border-color:#85c222; background-color:#E5F7C7;';" /><label for="checkbox2" class="akslabel">Salgs og leveringsvilkår er lest og akseptert</label> </span> {literal} <script type="text/javascript"> $(function() { //checkbox $("#checkbox2").click(function(){ //if this... //alert("this")... if($("#checkbox2").is(':checked')) { alert("im checked"); } }); //button $("#fullfor_btn").click(function(e){ if(!$("#checkbox2").is(':checked')) { alert("you did not check the agree to terms..."); e.preventDefault(); } }); } </script> {/literal} This on another .tpl: <label></label> <button type="submit" class="submit" name="{$method}" id="fullfor_btn" title="Fullfør bestillingen nå" value="">&nbsp;</button> What could be going wrong? The jQuery doesn't fire anything at all.

  Read the article

• increase number of photos from flickr using json

  - by Andrew Welch

  Hi this is my code: Is is possible to get more photos from flickr. What is the standard / default number? $(document).ready(function(){ $.getJSON("http://api.flickr.com/services/feeds/photos_public.gne?id=48719970@N07&lang=en-us&format=json&jsoncallback=?", function(data){ $.each(data.items, function(i, item){ var newurl = 'url(' + item.media.m + ')'; $("<div class='images'/>").css('background', newurl).css('backgroundPosition','top center').css('backgroundRepeat','no-repeat').appendTo("#images").wrap("<a target=\"_blank\ href='" + item.link + "'></a>"); }) $("#title").html(data.title); $("#description").html(data.description); $("#link").html("<a href='" + data.link + "' target=\"_blank\">Visit the Viget Inspiration Pool!</a>"); //Notice that the object here is "data" because that information sits outside of "items" in the JSON feed $('.jcycleimagecarousel').cycle({ fx: 'fade', speed: 300, timeout: 3000, next: '#next', prev: '#prev', pause: 1, random: 1 }); }); });

  Read the article

• Trouble determining onclick's target

  - by pwseo

  I've tried and tried... and I can't seem to make this work in IE (tested version 6) Can anybody help me? IE complains about an error but refuses to tell which error it is... var a = document.getElementsByTagName("a"); for (i = 0; i < a.length; i++) { if (a[i].getAttribute("class") == "info-link") { a[i].onclick = function(e) { e = e || window.event; var target = e.srcElement || e.target; var info = target.parentNode.getElementsByTagName("div")[0]; if (info.style.display == "none" || info.style.display == "") { info.style.display = "block"; } else { info.style.display = "none"; } return false; } } } <div class="auxdata"> <a href="#" class="info-link">Esta questão possuí dados anexos. Clique para ver.</a> <div style="display: none;" class="info-inner"> <!-- variable stuff here --> </div> </div>

  Read the article

• How do I get NHibernate to work with .NET Framework 2.0?

  - by Daniel Dolz

  I can not make NHibernate 2.1 work in machines without framework 3.X (basically, windows 2000 SP4, although it happens with XP too). NHibernate doc do not mention this. Maybe you can help? I NEED to make NHibernate 2.1 work in Windows 2000 PCs, do you think this can be done? PD: DataBase is SQL 2000/2005. Error is: NHibernate.MappingException: Could not compile the mapping document: Datos.NH_VEN_ComprobanteBF.hbm.xml ---> NHibernate.HibernateException: Could not instantiate dialect class NHibernate.Dialect.MsSql2000Dialect ---> System.Reflection.TargetInvocationException: Se produjo una excepción en el destino de la invocación. ---> System.TypeInitializationException: Se produjo una excepción en el inicializador de tipo de 'NHibernate.NHibernateUtil'. ---> System.TypeLoadException: No se puede cargar el tipo 'System.DateTimeOffset' del ensamblado'mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089'. en NHibernate.Type.DateTimeOffsetType.get_ReturnedClass() en NHibernate.NHibernateUtil..cctor() --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect..ctor() en NHibernate.Dialect.MsSql2000Dialect..ctor() --- Fin del seguimiento de la pila de la excepción interna --- en System.RuntimeTypeHandle.CreateInstance(RuntimeType type, Boolean publicOnly, Boolean noCheck, Boolean& canBeCached, RuntimeMethodHandle& ctor, Boolean& bNeedSecurityCheck) en System.RuntimeType.CreateInstanceSlow(Boolean publicOnly, Boolean fillCache) en System.RuntimeType.CreateInstanceImpl(Boolean publicOnly, Boolean skipVisibilityChecks, Boolean fillCache) en System.Activator.CreateInstance(Type type, Boolean nonPublic) en NHibernate.Bytecode.ActivatorObjectsFactory.CreateInstance(Type type) en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) en NHibernate.Dialect.Dialect.GetDialect(IDictionary`2 props) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Cfg.Configuration.LogAndThrow(Exception exception) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) en NHibernate.Cfg.Configuration.ProcessMappingsQueue() and continues...

  Read the article

• ASP.net MVC Routing on Postback

  - by Mark Kadlec

  In my ASP.net MVC View I have a dropdown that I want to get details on selection and asynchronously update a div. My aspx is as follows: <% using (Html.BeginForm("Index", "Portal", FormMethod.Post, new { id = "TheForm" })) {%> <h2>Index</h2> <% using (Ajax.BeginForm("Details", new AjaxOptions { UpdateTargetId = "mpkResults" })) { %> <%=Html.DropDownList("Docs", (IEnumerable<SelectListItem>)ViewData["Docs"], new { onchange = "document.getElementById('TheForm').submit();" })%> <p><input type="submit" value="Details" /></p> <% } %> <div id="mpkResults" style="margin:10px 0px 0px 0px;"></div> ... The onchange event fires correctly on selection of the dropdown, but instead of the Details method in my code behind firing, it hits my Index method. Why is the details method not getting hit on the onchange event? My Details() method in the controller is: public ActionResult Details() { ... < It never gets here, just goes to the index() method } It's a little frustrating right now since I'm sure it is a simple mistake but not sure what it could be. I looked at the Source of my page and sure enough, the form looks like it should be routing to the Details Action: <form action="/Portal/Details" method="post" ... Any help would be appreciated.

  Read the article

• Can someone tell me why this JavaScript code isn't lining up an array in order?

  - by DarkLightA

  Live code: http://jsfiddle.net/fCUZC/ //INPUT ARRAY: var input = [28,32,21,11,8,2,14,32,64]; //VARIABLE DECLARATION. a = highest number so far, b = position of that number entireLoop: for (var i = 1; i<=input.length; i++) { if(input[i] > input[i-1]) { for(var o = i; o>=0; o--) { if(input[i-1] > input[o]) { input.splice(i,0,input[o]); input.splice((o+1),1); continue entireLoop; } else if(input[o] > input[0]) { input.splice(0,0,input[o]); input.splice((o+1),1); continue entireLoop; } } } } document.write(input); I'm trying to order the array from largest to smallest, but there's a 32 stuck somewhere. I know there's the sort method, but I'm a newbie and want to try this for myself.

  Read the article

• Making a Javascript game, Having a little problem with scrolling.

  - by RobertWHurst

  I have a #wrapper div and a #grid div nested inside. currently I can scroll around with this function below. getCursorPos : function(){ // set the empty cursor object var cursor = {}; //get the offset from the left of the grid container var grid //offset loop $(function getCursorPos(){ grid = $('#grid').offset(); setTimeout(getCursorPos, game.loopSpeed); }); //continuosly get the position var that = this; $(document).mousemove(function(e){ //if game mode is menu exit if(game.mode === 'menu'){ return; } // NOTE: this looks a litle over done but don't remove anything // its like this because javascript uses floating points // and so in order to line up to the nearest hunderedth I // had to make the cursor and div position intergers by // muliplying by ten. one the two are added I reduced them // and rounded them. that.x = Math.round(((e.pageX * 10) - (grid.left * 10)) / 10); that.y = Math.round(((e.pageY * 10) - (grid.top * 10)) / 10); }); }, the problem is that the mouse coordinates only update when the mouse moves. is there any way to get the coordinates with out moving the mouse?

  Read the article

• jeditable table cell

  - by user666262

  Hi all, I am having an issue when using jeditable to edit a cell in a table. The project is the MVC 2 web application and the table has been put on the standard about page. How do i tell the script to call a specific method in the controller ? because it is currently just loading the entire page into the cell. This is the javascript: $(document).ready(function () { $('.editable').editable('http://localhost:2196/Home/About', { type: 'text', cancel: 'Cancel', event: 'dblclick', submit: 'OK', tooltip: 'double Click to edit...' }); }); This is the table : <% foreach (DataTableEditable.Models.Company item in (IEnumerable<DataTableEditable.Models.Company>)Model) {%> <tr id="<%= Html.Encode(item.ID) %>"> <td class="editable"><%= Html.Encode(item.Name) %> </td> <td><%= Html.Encode(item.Address) %> </td> <td><%= Html.Encode(item.Town) %> </td> </tr> <% }%> Thanks lots John

  Read the article

• Start with remoting or with WCF

  - by Sheldon

  Hi. I'm just starting with distributed application development. I need to create (all by myself) an enterprise application for document management. That application will run on an intranet (within the firewall, no internet access is required now, BUT is probably that will be later). The application needs to manage images that will be stored within MySQL Server (as blobs) and those images will be then recovered by the app and eventually one or more of them will be converted to PDF. Performance is the most important non-functional requirement. I have a couple of doubts. What do you suggest to use, .NET Remoting or WCF over TCP-IP (I think second one is the best for the moment I need to expose the business logic over internet, changing the protocol). Where do you suggest to make the transformation of the images to pdf files, I'm using iText. (I have thought to have the business logic stored within the IIS and exposed via WCF, and that business logic to be responsible of getting the images and transforming them to PDF, that because the IIS and the MySQL Server are the same physical machine). I ask about where to do the transformation because the app must be accessible from multiple devices, and for example, for mobile devices, the pdf maybe is not necessary. Thank you very much in advance.

  Read the article

• Can't get jQuery to wokr with Prototype - tried everything....

  - by thinkfuture

  Ok so here is the situation. Been pulling my hair out on this one. I'm a noob at this. Only been using rails for about 6 weeks. I'm using the standard setup package, and my code leverages prototype helpers heavily. Like I said, noob ;) So I'm trying to put in some jQuery effects, like PrettyPhoto. But what happens is that when the page is first loaded, PrettyPhoto works great. However, once someone uses a Prototype helper, like a link created with link_to_remote, Prettyphoto stops working. I've tried jRails, all of the fixes proposed on the JQuery site to stop conflicts... http://docs.jquery.com/Using_jQuery_with_Other_Libraries ...even done some crazy things likes renaming all of the $ in prototype.js to $$$ to no avail. Either the prototype helpers break, or jQuery breaks. Seems nothing I do can get these to work together. Any ideas? Here is part of my application.html.erb <%= javascript_include_tag 'application' %> <%= javascript_include_tag 'tooltip' %> <%= javascript_include_tag 'jquery' %> <%= javascript_include_tag 'jquery-ui' %> <%= javascript_include_tag "jquery.prettyPhoto" %> <%= javascript_include_tag 'prototype' %> <%= javascript_include_tag 'scriptalicious' %> </head> <body> <script type="text/javascript" charset="utf-8"> jQuery(document).ready( function() { jQuery("a[rel^='prettyPhoto']").prettyPhoto(); }); </script> If I put prototype before jquery, the prototype helpers don't work If I put the noconflict clause in, neither works. Thanks in advance! Chris

  Read the article

• Why would the IE Developer Toolbar claim a style is applied, yet that supposed fact is not reflected

  - by Deane

  I have a situation where IE7 is simply not applying styles, even though it claims it is. I have an element on my page. In the CSS, I have defined a rule that should apply "display: none" to it, so it should not be displayed. It's still displaying. I downloaded the IE Developer Toolbar, and found the element in the DOM selector. I right-clicked and selected "Applied Styles." Right there, IE claims that it is applying my "display: none" rule. In fact, the "Applied Styles" dialog confirms everything I think I know about my CSS and how it should be applied. Yet the element remains. Now, I'm not asking anyone to debug my CSS here. I'm asking, if the IE Developer Toolbar claims/confirms this element should be gone, but it's still there...what does that mean, exactly? Since the Toolbar is on my side, I think my CSS is fine. Is there some IE7 bug I'm not considering? Edit: One thing that might be relevant: the LINK elements that load the stylesheets are applied to the page in Javascript, via "document.write". I'm starting to suspect that has something to do with it.

  Read the article

• Testing approach for multi-threaded software

  - by Shane MacLaughlin

  I have a piece of mature geospatial software that has recently had areas rewritten to take better advantage of the multiple processors available in modern PCs. Specifically, display, GUI, spatial searching, and main processing have all been hived off to seperate threads. The software has a pretty sizeable GUI automation suite for functional regression, and another smaller one for performance regression. While all automated tests are passing, I'm not convinced that they provide nearly enough coverage in terms of finding bugs relating race conditions, deadlocks, and other nasties associated with multi-threading. What techniques would you use to see if such bugs exist? What techniques would you advocate for rooting them out, assuming there are some in there to root out? What I'm doing so far is running the GUI functional automation on the app running under a debugger, such that I can break out of deadlocks and catch crashes, and plan to make a bounds checker build and repeat the tests against that version. I've also carried out a static analysis of the source via PC-Lint with the hope of locating potential dead locks, but not had any worthwhile results. The application is C++, MFC, mulitple document/view, with a number of threads per doc. The locking mechanism I'm using is based on an object that includes a pointer to a CMutex, which is locked in the ctor and freed in the dtor. I use local variables of this object to lock various bits of code as required, and my mutex has a time out that fires my a warning if the timeout is reached. I avoid locking where possible, using resource copies where possible instead. What other tests would you carry out?

  Read the article

• Crystal Reports.NET problems accessing FieldObject for page count

  - by Stuart A

  Hi, We're using Crystal Reports.NET that was bundled with VS2005. We have a confirmation booking form letter report that we want to batch print. Generally this prints one page per person on letterhead paper, however occasionally if they've booked lots of courses the letter rolls over to two pages. The second page should not be printed to letterhead paper. Basically, because it's a rare occurance I was just going to print the lot and pause if a particular letter went over 1 page. I.e. Load the report, grab the page count, hollah at the user if it's more than one page otherwise carry on regardless. I have dropped a TotalPageCount on the footer of my report (Which I would supress if it worked!) and then try and read it in my application. Once I've loaded the document I am trying to call report.ReportDefinition.ReportObjects("TotalPageCount1") Which is of type CrystalDecisions.CrystalReports.Engine.FieldObject I cannot seem to get the value out of this for love nor money (nor any amount of cursing and swearing!) I can read any items of type TextObject, but if I append the TotalPageCount to a text field, it shows correctly in the report but then returns "Page count: TotalPageCount" rather than "Page count: 1" for example. Soo, short of going out of my mind, does anyone have any suggestions? Either a way to read the value or a way round it. The printer doesn't have multiple trays, though even if we got one, I'm not sure how to convince crystal to print different pages to different trays. Best regards, Stuart P.S. - is it a sign that the "crystal-reports" tag has a count of 666? :O(

  Read the article

< Previous Page | 468 469 470 471 472 473 474 475 476 477 478 479  | Next Page >