Search Results

Search found 62736 results on 2510 pages for 'smart help'.

Page 472/2510 | < Previous Page | 468 469 470 471 472 473 474 475 476 477 478 479  | Next Page >

  • How to find out where or if MYSQL5 logs are stored on a machine WHM/Cpanel

    - by moi
    I have a WHM/Cpanel re-seller hosting account on a virtual private server (Linux). I have root access to the machine via SSH I am trying to locate a file that contains information that will help me to determine which users have accessed what db and from which hosts. I would imagine this kind of data is stored in a log file somewhere. The MySQL page says: The general query log - Established client connections and statements received from clients See: http://dev.mysql.com/doc/refman/5.0/en/server-logs.html It also says: By default, all log files are created in the mysqld data directory. So, I am am NOT asking where are the general query log logs stored, (cos I expect I will get answers saying "it depends") Please help me work out: "How can go about finding out where MySQL general query log logs are stored on a linux machine" Couple of things i've already tried: I looked at /etc/my.cnf it was a tiny file that only contained the following info: [mysqld] skip-bdb skip-innodb set-variable = max_connections=500 safe-show-database ~ ~ I have looked in: /var/lib/mysql/ But I could not see any log-like file names in that directory. Any clues on this would be most welcome.

    Read the article

  • Address (url) forwarding with Vyatta

    - by Trikks
    Hi Got this kind of noob question i suppose. I got this very basic network setup and need help to set up some address forwarding. As seen in my illustration below all traffic enters via the eth0 interface (85.123.32.23). The external dns is setup to direct all hosts to this ip as well. Now, how on earth do I filter the incoming requests to each box? The Ip's are static! Se the network layout here: http://vyatta.org/files/u11160/setup.png I do not wish to solve this by assigning tons of ports etc. In my wishful thinking something like this would be nice :) set service nat rule 10 type destination set service nat rule 10 inbound-interface eth0 set service nat rule 10 destination address ftp.myhost.com set service nat rule 10 inside-address address 192.168.100.20 This way ALL traffic to the address ftp.myhost.com (at eth0) should be routed to the internal ip, 192.168.100.20. Right, is there anyone who could point in some direction? Maybe it's wrong to use nat? Please help me! :)

    Read the article

  • MacBook Pro battery capacity 65K mAh

    - by Alexander Gladysh
    I have a 15" MacBook Pro 3.1 (that is Late 2007 model AFAIR). I've bought it new a couple of years ago. Recently its on-battery power lifespan became very short (30 to 10 minutes). When my notebook turns itself off due to "low battery" and I press the small button on the battery itself, all LED lights are alight, indicating full charge. When I plug in the power adapter, my Mac displays that "battery is fully charged, finishing charging process" (I have a Russian OS X 10.5.7, so that is a rough translation), but the LEDs on battery itself display (seemingly accurate) status that there are one or two "LEDs still not charged". My battery have as few as 37 recharge cycles (yes, I've neglected calibration over the time I've used it). Battery info programs like iBatt2 report battery capacity of 65 337 mAh (with by-design capacity of 5600 mAh). I get it that something went wrong with battery electronics. I've tried resetting my Mac's PRAM and SMC, it did not changed anything. Now I'm trying to recalibrate the battery, but looks like it does not help as well. Will try to recalibrate it several times in a row. I'd buy a new battery if I knew if it is battery fault, not a notebook's. Any suggestions? Update: After recalibration, my battery status now displays battery capacity of 1500 mAh. But with every recalibration (or simply when I use notebook without power adapter plugged in) this number changes in the range from 200 mAh to 1700 mAh. LEDs on battery now are synchronous with what nodebook thinks on the charge level. Also I've noticed that cycle count changes rather slowly. It is now 39, it was 37 when I've started recalibration, and I went through the process at least ten times... So, the main question is: does it look like that replacing the battery would help me (or does it look like this is notebook's problem)? I guess I should try replacing the battery.

    Read the article

  • Address (url) forwarding with Vyatta

    - by Trikks
    Got this kind of noob question i suppose. I got this very basic network setup and need help to set up some address forwarding. As seen in my illustration below all traffic enters via the eth0 interface (85.123.32.23). The external dns is setup to direct all hosts to this ip as well. Now, how on earth do I filter the incoming requests to each box? The Ip's are static! My network layout: I do not wish to solve this by assigning tons of ports etc. In my wishful thinking something like this would be nice :) set service nat rule 10 type destination set service nat rule 10 inbound-interface eth0 set service nat rule 10 destination address ftp.myhost.com set service nat rule 10 inside-address address 192.168.100.20 This way ALL traffic to the address ftp.myhost.com (at eth0) should be routed to the internal ip, 192.168.100.20. Right, is there anyone who could point in some direction? Maybe it's wrong to use nat? Please help me! :)

    Read the article

  • Internal disk not correctly recognised by Windows 7

    - by david
    i'm having problems configuring a disk in a brand new, clean windows-7 install. here are some system specifics- . disk- western digital velociraptor wd6000hlhx . mobo- gigabyte z77x-ud3h . bios sata-mode set to ahci [not raid], w/disk connected to sata0 [6gb/s hi-speed sata]. . windows 7 enterprise sp1 x64 the disk is recognized by bios and correctly identified [name & size ok]. the disk is also recognized by windows on a h/w level, but it won't show up in the explorer. windows reports the device is working correctly. windows disk manager shows the drive, but says it's uninitialized and has no partitions [which is incorrect]. if i try to initialize the drive, windows throws an error saying that it "cannot find the file specified". [which file???] before connecting the drive to the new machine, i partitioned and formatted the disk under windows xp sp2, giving it 2 partitions [mbr, not gpt] and copying over a boatload of data. obviously none of this appears under windows 7. removing the disk from the new machine and replacing it back in the windows xp machine shows the disk and all data are intact and functional. i'd like to have windows 7 recognize the disk w/o having to lose the data and start over. is this possible? if so, how would i do that? I checked this post, but even though the problem seems identical, the information didn't help. any help appreciated. thanks!

    Read the article

  • Xen HVM networking wont work

    - by Nathan
    I'm trying to get a Xen HVM network working using route however I am failing. Xen PV works fine using Ubuntu but when installing Ubuntu on HVM it fails to pick up the network. I'll let you know now that I'm not that experienced with Xen so I would appreciate any help. vm104 is the HVM thats causing me the problems, here is the configs that I believe should help resolve the problem. [root@eros vm104]# cat vm104.cfg import os, re arch = os.uname()[4] if re.search('64', arch): arch_libdir = 'lib64' else: arch_libdir = 'lib' kernel = '/usr/lib/xen/boot/hvmloader' builder = 'hvm' memory = 6000 shadow_memory = '8' cpu_weight = 256 name = 'vm104' vif = ['type=ioemu, ip=85.25.x.y, vifname=vifvm104.0, mac=00:16:3e:52:3d:fe, bridge=xenbr0'] acpi = 1 apic = 1 vnc = 1 vcpus = 4 vncdisplay = 3 vncviewer = 0 vncconsole = 1 vnclisten = '217.118.x.y' vncpasswd = 'kCfb5S4tE7' serial = 'pty' disk = ['phy:/dev/vpsvg/vm104_img,hda,w', 'file:/home/solusvm/xen/iso/Windows-Server-2008-RC2.iso,hdc:cdrom,r'] device_model = '/usr/' + arch_libdir + '/xen/bin/qemu-dm' boot = 'cd' sdl = '0' usbdevice = 'tablet' pae=1 [root@eros /]# cat /etc/xen/xend-config.sxp | egrep -v "(^#.*|^$)" (xend-unix-server yes) (xend-unix-path /var/lib/xend/xend-socket) (xend-relocation-hosts-allow '^localhost$ ^localhost\\.localdomain$') (network-script network-route) (vif-script vif-route) (network-script 'network-route netdev=eth0') (dom0-min-mem 256) (dom0-cpus 0) (vnc-listen '0.0.0.0') (vncpasswd '') (keymap 'en-us') The Windows install will not pick up the network - I've tried setting the IP manually by using the Xen servers IP as the gateway and setting the main IP in Windows but no luck. If anyone needs any more information let me know and I appreciate any input!

    Read the article

  • can't find port 22 traffic under VirtualBox

    - by telliott99
    I'm trying to learn to use tcpdump. I thought I'd eavesdrop on my ssh login. The setup is a bit unusual, I have OS X Lion running VirtualBox, with Ubuntu running in the VM. I have ssh enabled and can login from OS X normally: > ssh -p 22 10.0.1.2 -l telliott Welcome to Ubuntu 11.10 (GNU/Linux 3.0.0-17-generic i686) * Documentation: https://help.ubuntu.com/ 0 packages can be updated. 0 updates are security updates. Last login: Sat Mar 31 19:54:36 2012 from toms-mac-mini.local telliott@U32:~$ logout Connection to 10.0.1.2 closed. > I have not obfuscated the ssh port on Ubuntu. From OS X, stroke gives what I expect: > ./stroke 10.0.1.2 22 22 Port Scanning host: 10.0.1.2 Open TCP Port: 22 ssh So from OS X I do: > sudo tcpdump -i en1 -v port 22 Password: tcpdump: listening on en1, link-type EN10MB (Ethernet), capture size 65535 bytes Then I login from OS X to Ubuntu using ssh, but I see nothing with tcpdump. Here is ifconfig from Ubuntu: telliott@U32:~$ ifconfig eth1 Link encap:Ethernet HWaddr 08:00:27:d7:ba:0e inet addr:10.0.1.2 Bcast:10.0.1.255 Mask:255.255.255.0 inet6 addr: fe80::a00:27ff:fed7:ba0e/64 Scope:Link UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:799 errors:0 dropped:0 overruns:0 frame:0 TX packets:465 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:1000 RX bytes:96863 (96.8 KB) TX bytes:68638 (68.6 KB) Where are the packets I was hoping to see? Thanks for any help.

    Read the article

  • Probelms Intstalling Trac using apt-get Ubuntu Jaunty

    - by Ben Waine
    Hi, I'm having some issues getting apt to install trac correctly on my Ubuntu Jaunty Box. Using the command 'apt-get install trac' I get the following output: root@myserver:~# apt-get install trac Reading package lists... Done Building dependency tree Reading state information... Done Some packages could not be installed. This may mean that you have requested an impossible situation or if you are using the unstable distribution that some required packages have not yet been created or been moved out of Incoming. Since you only requested a single operation it is extremely likely that the package is simply not installable and a bug report against that package should be filed. The following information may help to resolve the situation: The following packages have unmet dependencies: trac: Depends: python-setuptools (> 0.5) but it is not installable Depends: python-pysqlite2 (>= 2.3.2) but it is not going to be installed Depends: python-subversion but it is not installable Depends: libjs-jquery but it is not installable Recommends: python-pygments (= 0.6) but it is not installable or enscript but it is not installable Recommends: python-tz but it is not installable E: Broken packages I have successfully used the command on my karmic kola desktop machine and am able to create new projects etc. I thought I might be able to solve the problem by installing all python related extensions. This produced a very similar output. I have Main, universe and multi-verse repositories enabled. Its a remote machine and I have no access to the gui. Hope someone can help, googleing failed to solve the issue or find a solution! Thanks, Ben

    Read the article

  • How can I access a webDAV folder as a UNC share?

    - by Amar
    first of all I am just getting to know about webDAV and appreciate your patience. I have a virtual directory on IIS 6 (windows 2003) that is based on a network share on a file server different from web server. something like www.mysite.com/myreports where myreport is based on \myfileserver\reports. I have been asked by network folks to not use the UNC path like that for security reason and try to explore using webDAV. What I have been told is webDAV can give me a UNC path without requiring to open the ports required for a file server UNC path. Then I can use the new UNC path to map my virtual directory and my asp.net code will not require any change. Help: Being new to webDAV, I did some research over the web. I now can create a web folder in fileserver. I put IIS on file server as well. I can browse the content as http:://fileserver/mywebDAVreports which is based on reports folder. But I don't know how to get a UNC for this web folder to be able to map my virtual directory on web server. I appreciate any help on this. Regards, Amar

    Read the article

  • Htpc aka "Media Center": cheap and *silent*?

    - by Unknown
    It may be me, or the place I live (Italy), but it seems pretty hard to get a build or a prebuilt nettop or a laptop that fits the need. I need something silent able to playback all h.264 fullhd content without stuttering, and well (and not loosing the hw acceleration because of softsubs...) silent not ugly silent and (possibly) cheap. I'm going the linux route, therefore i'm moving towards a cpu-based or nvida-integrated solution (i don't think ati hw accelerated playback - or the intel "hd" acceleration - is useable yet). Ion nettop; it's either the Acer Revo (but here it's incredibly pricey and it's hard to find the dualcore version) or the Asrock Ion 330, that in the current version is rated "silent" at 26Db. 26. Sounds pretty noisy to me!!! the previous version was even worse. was this product really aimed at htpc market?? the Dell Zino - i think it's ATI based unfortunately. Laptop: correct me if I'm wrong: sub 600€/$ units are quite loud under full load (because of the tiny fans). ULW laptops are indeed quite similar: tiniest fans = high pitched noise and the cpu still lacks power for non hd-accelerated video decoding Handmade build: little money can be saved with underpowered cpus, a low-midrange cpu would help in the case of non-hw-accelerated content the cases are quite pricey the PSU one has to get ranges between 100/150 €/$ minimum to keep the noise down a low-mid build, all included, sums up to over 650 €/$ for a still-looking-ugly-unit, without the blu-ray drive. Please help. What do you advise on this? ;) Am I ignoring laptops too much, maybe? Are low-priced Acers that noisy/high pitched under full load?

    Read the article

  • Looking for updated BIOS for '99 Gateway in order to format/recognize >127 GB HD

    - by Jeff
    I have a '99 Gateway that's apparently too old for even Gateway to acknowledge it exists. Want to use it as a media hub and put in a 320GB HD, but it will not format above 127GB even running Win XP SP3. Read somewhere that upgrading the BIOS may do the trick, but I can't find the correct BIOS, and GW has been no help. Hoping I can just upgrade the BIOS, which is 11 years old. Any help would be much appreciated! I don't know where to look, and searches have been fruitless. System info: OS Name Microsoft Windows XP Home Edition Version 5.1.2600 Service Pack 3 Build 2600 OS Manufacturer Microsoft Corporation System Name xxxx System Manufacturer Gateway System Model TABOR_II System Type X86-based PC Processor x86 Family 6 Model 7 Stepping 3 GenuineIntel ~596 Mhz BIOS Version/Date Intel Corp. 4W4SB0X0.15A.0015.P10, 9/28/1999 SMBIOS Version 2.1 BIOS info (from a free app I located): BIOS Type: Phoenix BIOS Date: September 28th 1999 BIOS ID: 4W4SB0X0.15A.0015.P10.9909281445-None BIOS OEM: 4W4SB0X0.15A.0015.P10 Chipset: Intel 440BX/ZX rev 3 SuperIO: SMC 70x or 80x rev 0 at port 0370 Manufacturer: Gateway Motherboard: WS440BX

    Read the article

  • Nagios Apache Config with PHP-FPM downloading cgi files

    - by tubaguy50035
    I'm trying to setup Nagios 3 under Apache 2.4 with PHP-FPM. I've run into a couple problems I could use help with. The PHP side of things seems to be working, I can see the home page and the sidebar. But all of the CGI files are downloading instead of executing, and when I try to click on "Read What's New In Nagios Core 3", I get an error /nagios3/docs/whatsnew.html was not found on this server. Below is my vhost config for Nagios. <VirtualHost *:300> # apache configuration for nagios 3.x ScriptAlias /cgi-bin/nagios3 /usr/lib/cgi-bin/nagios3 ScriptAlias /nagios3/cgi-bin /usr/lib/cgi-bin/nagios3 # Where the stylesheets (config files) reside Alias /nagios3/stylesheets /etc/nagios3/stylesheets # Where the HTML pages live Alias /nagios3 /usr/share/nagios3/htdocs ProxyPassMatch ^/(.*\.php)$ fcgi://127.0.0.1:9001/usr/share/nagios3/htdocs/$1 <DirectoryMatch (/usr/share/nagios3/htdocs|/usr/lib/cgi-bin/nagios3|/etc/nagios3/stylesheets)> Options FollowSymLinks ExecCGI AllowOverride AuthConfig Order Allow,Deny Allow From All AuthName "Nagios Access" AuthType Basic AuthUserFile /etc/nagios3/htpasswd.users require valid-user </DirectoryMatch> <Directory /usr/share/nagios3/htdocs> Options +ExecCGI </Directory> </VirtualHost> I also added this in my global Apache config: AddHandler cgi-script .cgi Any help or instructions you can give me would be much appreciated. If more information is needed, let me know.

    Read the article

  • nginx + wordpress in /wordpress subdir

    - by nkr1pt
    I installed nginx and would like to setup wordpress as a final step. I followed many howtos but am unable to get it working. The setup is fairly straightforward, the root dir of the webserver is /data/Sites/nkr1pt.homelinux.net. In that root dir I created a symlink to the wordpress folder in /usr/local/wordpress, so in fact all wordpress files can be accessed at /data/Sites/nkr1pt.homelinux.net/wordpress. Permissions are ok. The plan is to get wordpress working at http://sirius/wordpress, the server's name is sirius. spawn-fcgi is running and listening on port 7777. Here you can see the relevant config: server { listen 80; listen 8080; server_name sirius; root /data/Sites/nkr1pt.homelinux.net; passenger_enabled on; passenger_base_uri /redmine; #charset koi8-r; #access_log logs/access.log main; location ^~ /data { root /data/Sites/nkr1pt.homelinux.net; autoindex on; auth_basic "Restricted"; auth_basic_user_file htpasswd; } location ^~ /dump { root /data/Sites/nkr1pt.homelinux.net; autoindex on; } location ^~ /wordpress { try_files $uri $uri/ /wordpress/index.php; } # pass the PHP scripts to FastCGI server listening on 127.0.0.1:7777 location ~ \.php$ { #fastcgi_split_path_info ^(/wordpress)(/.*)$; fastcgi_pass localhost:7777; #fastcgi_index index.php; fastcgi_param SCRIPT_FILENAME $document_root$fastcgi_script_name; include fastcgi_params; #index index.php; } please note that redmine, and the locations dump and data are working perfectly, it is only wordpress that I cannot get to work. Can you please help me to the correct wordpress configuration in nginx? All help is much appreciated!

    Read the article

  • problem booting crusty old windows XP

    - by Carson Myers
    I have an acer aspire laptop running Windows XP home. I believe I have some virus on it, I'm not sure--I mostly just run linux in a VM on it so I wasn't too worried. I'm not sure if that virus caused this problem. The laptop wasn't recognizing my USB hard drive for some reason so I decided to restart it. When it started up, it got past the memory test, past the boot screen, (but it paused right here on a blank screen for awhile) and flashed the desktop once (like it does just before the login screen) and then crashed. I got a quick BSOD and then it restarted. Then it tried to boot again, etc etc infinite loop of failure. Well, before trying safe mode, I disabled automatic restart on system crash so I could read the blue screen. There wasn't anything important on it, it said *** STOP: 0x00000000 (0xC0000000 0x,.... ) beginning physical memory dump physical memory dump complete That's not verbatim (obviously) but it didn't help me. so I booted in safe mode, and it stopped on the driver gagp30kx.sys and then restarted (and infinite loop of failure again). I burned a recovery CD and tried that. It loaded it, and I went into repair mode. I ran chkdsk and then disabled the AGP driver. Same thing on booting in safe mode except it stopped at mup.sys instead. I enabled the AGP driver again, and ran chkdsk again from the CD. It said it found problems but didn't say it fixed them. So I ran it a second time, and it said "performing additional checking or recovery" lots of times (I can't tell how many, they went above the screen top). I tried booting again and no luck. Every time I run chkdsk after trying to boot again it says it found and fixed more errors. I think it might be whatever driver is after the AGP driver, but I don't know what it is or how to find out. Can anyone help me fix this?

    Read the article

  • How to Creat custom content for nginx error 502 page, keep origin url on browser

    - by user123862
    i'm trying to get custom language and message for nginx error page but keep url on browser.. not success for eg: i go to url : xaluan.com/aaa/bbb.html on the time server down.. nginx will show error 502. with the same url but custom message as my language. test 1. I created a custom page at /usr/local/nginx/html/205.html as following config but it show on web site when error is default nginx error at domain.com/50.html ( the content of webpage not same as i created) error_page 502 /502.html; location = /502.html { root /usr/local/nginx/html; } test 2. Then i create same page at my www domain folder /home/xaluano/public_html/502.html but this keep redirect me to root domain.com/502.html the content now same as i created. but.. the url still not as i need error_page 502 /502.html; location = /502.html { root /home/xaluano/public_html; internal; } EDIT UPDATE for more detail 10/06/2012 please download my nginx config http://pastebin.com/7iLD6WQq and vhost config following: http://pastebin.com/ZZ91KiY6 == the case test.. if apache httpd service stop: #service httpd stop then open browser go to: xaluan.com/modules.php?name=News&file=article&sid=123456 I will see the 502 error with the same url on browser address == Custome error page I need the config which help when apache fail .. will show the custom message tell user wail for 1 minute for service back then refress current page with same url ( refresh I can do easy by javascript ), Nginx dosent change url so java-script can work out. any help will be great.. thank in advance

    Read the article

  • Inter-vlan routing issues

    - by DKNUCKLES
    I've been brought in to help administer a network and I've run into an issue - I'm not sure why this one is beyond me, however I figure an extra set of eyes on the problem may help resolve the issue. I have an HP MSM720 controller and at the time I'm trying to set up a basic hotspot set up with access points. For the time being I'm just looking to have people authenticate with a PSK and access the internet and other resources (namely printers) on other vlans. The user authenticates and the DHCP server on the controller gives them a 192.168.1.0/24 address. They are able to successfully browse the internet and ping machines on other networks, however they are unable to print to network printers that sit on the same LANs as the very computers that wireless clients can ping. The (extremely simplified) topology is as follows Computers on the wireless 192.168.1.1 network are able to ping computers on the 192.168.0.0 network, however cannot ping or print to the printers on the same network. I'm baffled and I have no idea why this is the case. Can anyone shed some light on this for me? Can someone spot the error of my configuration? EDIT : It should be noted that for whatever reason other computers on the 10.0.100.0/24 network cannot even ping the gateway of the Wireless Access network (192.168.1.1) - I'm not sure if this is relevant. These are the VLANS listed on the controller.

    Read the article

  • hMail server - sending copy of an e-mail changing the sender

    - by Beggycev
    Dear All please help me with following request. I am using hMail server in a company(test.com) and have several hundred of guest e-mail accounts ([email protected]). I need to accomplish this: When any of the guest e-mails receives a message(either from internal or external sender) this e-mail(or its copy) is sent to another address "[email protected]" which is the same for all of these guest e-mails. But I need the sender to be identified as the [email protected] not as the original sender which happens when I use forwarding. I tried to prepare a simple VBS script using the OnAcceptMessage event to accomplish this. and it works on my testing machine without internet connectivity but not in the production environment. To be specific, if I send an e-mail to [email protected] in my test env it is delivered to the [email protected] with [email protected] being a sender. But in the production env the e-mail stays in the guest mailbox with the original sender. I am interested in any solution, using a rule in hMail or script, anything is welcome. Thank you for any help! The script: Sub OnAcceptMessage(oClient, oMessage) 'creating application object in order to perform operations as hMail server administrator Dim obApp Set obApp = CreateObject("hMailServer.Application") Dim adminLogin Dim adminPassword 'Enter actual values for administrator account and password 'CHANGE HERE: adminLogin = "Admin_login" adminPassword = "password" Call obApp.Authenticate(adminLogin, adminPassword) Dim addrStart 'Take first 5 characters of recipients address addrStart = Mid(oMessage.To, 1, 5) 'if the recipient's address start with "guest" if addrStart = "guest" then Dim recipient Dim recipientAddress 'enter name of the recipient and respective e-mail address() 'CHANGE HERE: recipient = "FINAL" recipientAddress = "[email protected]" 'change the sender and sender e-mail address to the guest oMessage.FromAddress = oMessage.To oMessage.From = oMessage.To & "<" & oMessage.To & ">" 'delete recipients and enter a new one - the actual mps and its e-mail from the variables set above oMessage.ClearRecipients() oMessage.AddRecipient recipient, recipientAddress 'save the e-mail oMessage.save end if End Sub

    Read the article

  • Windows Vista will not boot; the file header checksum does not match the computed checksum

    - by Magnus
    Right out of the blue, my wife's Sony Vaio stopped booting. This, not so fun, error message displays immediately after POST: The system cannot boot. The file is possibly corrupt. The file header checksum does not match the computed checksum The repair option on the Vista DVD says everything is fine and dandy, it couldn't be more happier or more clueless... Any ideas? Update: CHKDSK reports no issues. CHKDSK /r reports no issues. (Heck, both Windows Repair and CHKDSK could just as well tell me that I have won on lottery or that the earth is flat... ) Some have reported that a mem diagnostic could help, but for me the mem diag has just ran through 5 passes. It doesn't seem to help. According to Sony, pressing F10 should bring up the restore menu, but it doesn't, the error pops up straight after Bios POST. It seems that this error is first in line of all options at this point, and is doesn't put a smile on my face. I have attached an external USB drive and copied all user data/documents to it. I feel an OS re-install is around the corner.

    Read the article

  • pure-ftpd not listening on specified port

    - by Jason McLaren
    I installed the pure-ftpd package (version 1.0.35-1) on an Ubuntu 12.04 box (an EC2 instance based on the standard Ubuntu 12.04 AMI). The pure-ftpd daemon is running (verified with ps), though there is no PID file (expected one to be created by the /etc/init.d/pure-ftpd script). Here's the resulting command that gets run by the init.d script: /usr/sbin/pure-ftpd -l pam -O clf:/var/log/pure-ftpd/transfer.log -o -8 UTF-8 -u 1000 -E -B -g /var/run/pure-ftpd/pure-ftpd.pid Here's my real problem: the ftp server isn't actually listening on any port (checked with netstat and nmap). So I can't ftp to the server (either locally using localhost or remotely using the public IP address). I tried adding a Bind file to /etc/pure-ftpd/conf and restarting, but it didn't help. When I installed pure-ftpd, it replaced inetd with openbsd-inetd, but did not run it since there were no services enabled. So inetd is not listening on port 21 either. (Apparently Ubuntu has a no-inetd-by-default policy, according to https://lists.ubuntu.com/archives/ubuntu-users/2010-September/227905.html .) I want to run pure-ftpd by itself (not with inetd) anyways, since the /etc/init.d/pure-ftpd script requires no inetd if you use the UploadScript feature. I'm not familiar with how Ubuntu handles network services (and can't find any relevant docs besides generic man pages), so I'm probably missing something obvious. Nothing seems out of the ordinary with /etc/hosts.allow (empty) or hosts.deny (empty), and I didn't add any firewall rules (iptables -L shows that the firewall is in its initial state). I've checked the pure-ftpd docs; not sure what else to look at. Any help would be appreciated, thanks!

    Read the article

  • How to use a local Leopard Server Mail server acting "like" an Exchange mail server

    - by Richard Chevre
    We have a local Exchange 2003 server (company .local) who is collecting POP3 mail accounts on a distant (company .com) mailserver. The mails are collected by the Exchange server every 5-10 minutes and stored locally (on company .local), so the users can read them without going on the "real" mail server (company.com) What was explaned to me is that the mail collection is made with POP Now we are migrating on Snow Leopard Server. We have chosen to use a new extension for our local domain: .leo So our mailserver's FQDN is mail.company.leo, and the users have a user [email protected] formated mail address. A) All works fine except that I can't find how to tell the mail.company.leo that he must retreive the mails from the "real" public server (mail.company.com) I'm hoping to use IMAP and not POP. I can send mail using SMTP relay from mail.company.leo but (I know it's trivial) answering is not possible, even if I specify the reply-to as [email protected] (this seems to be related to A) ) I don't know if it's very complicated (I suspect not, but...) to achieve what I want to do, and I'm not a genius. But as I'm a little bit lost, I hopesomebody can or will help me. Solving this will allow us to use iCal invitations too, so a lot of services depends of these mailserver settings Some of you discuss the fact thta we choose to use a "new" tld with the .leo extension. We have no problem for that, we could use .local. no problem ;) We used .leo instead of .local just to differentiate the two systems (Exchange and SnowLeopardServer). The question was not about that, it was just to know if we can set a SnowLeopard mail server to act like an Exchange Server. Again thank you for your advice and help Richard Thanks in advance Richard

    Read the article

  • mysql startup, shtudown and logging on osx

    - by Joelio
    Hi, I am trying to troubleshoot some mysql problems (I have a table I cant seem to delete or drop, it hangs forever) I have 10.5.8 osx, I dont remember how/if I installed mysql, here is what I know: it automatically starts on boot the process looks like this: /usr/local/mysql/libexec/mysqld --basedir=/usr/local/mysql --datadir=/usr/local/mysql/var --pid-file=/usr/local/mysql/var/Joels-New-Pro.local.pid _mysql 96 0.0 0.0 75884 684 ?? Ss Sat06PM 0:00.02 /bin/sh /usr/local/mysql/bin/mysqld_safe when I run: /usr/local/mysql/libexec/mysqld --verbose --help it says: /usr/local/mysql/libexec/mysqld Ver 5.0.45 for apple-darwin9.1.0 on i686 (Source distribution) it seems to use my.cnf from /etc/my.cnf Now here are my questions: I dont see anything in the startupitems that remotely looks like mysql ls /Library/StartupItems/ BRESINKx86Monitoring ChmodBPF HP IO HP Trap Monitor Parallels ParallelsTransporter 1.) So how does it startup automatically? 2.) How do I start & stop this type of installation? Also, looking at the config, the logs have no values: /usr/local/mysql/libexec/mysqld --verbose --help|grep '^log' log (No default value) log-bin (No default value) log-bin-index (No default value) log-bin-trust-function-creators FALSE log-bin-trust-routine-creators FALSE log-error log-isam myisam.log log-queries-not-using-indexes FALSE log-short-format FALSE log-slave-updates FALSE log-slow-admin-statements FALSE log-slow-queries (No default value) log-tc tc.log log-tc-size 24576 log-update (No default value) log-warnings 1 3.) Does that mean there is no logging enabled in mysetup? thanks in advance! Joel

    Read the article

  • JAVASCRIPT ENABLED

    - by kirchoffs415
    HI, I hope somebody can help, i keep getting the following message when i log on-- Your Javascript is disabled. Limited functionality is available. it will stay for maybe a day sometimes two.I have uninstalled javascript and reinstalled but still the same. Iam using chrome. any help would be gratefull many thanks Dominic p.s. my system spec is as follows System InformationOS Name Microsoft® Windows Vista™ Home Premium Version 6.0.6002 Service Pack 2 Build 6002 Other OS Description Not Available OS Manufacturer Microsoft Corporation System Name DOM-PC System Manufacturer Dell Inc. System Model Inspiron 1545 System Type X86-based PC Processor Pentium(R) Dual-Core CPU T4200 @ 2.00GHz, 2000 Mhz, 2 Core(s), 2 Logical Processor(s) BIOS Version/Date Dell Inc. A05, 25/02/2009 SMBIOS Version 2.4 Windows Directory C:\Windows System Directory C:\Windows\system32 Boot Device \Device\HarddiskVolume3 Locale United Kingdom Hardware Abstraction Layer Version = "6.0.6002.18005" User Name DOM-PC\DOM Time Zone GMT Standard Time Installed Physical Memory (RAM) 3.00 GB Total Physical Memory 2.96 GB Available Physical Memory 1.38 GB Total Virtual Memory 5.89 GB Available Virtual Memory 4.25 GB Page File Space 3.00 GB Page File C:\pagefile.sys My System Specs

    Read the article

  • Event Log: atapi - the device did not respond within the timeout period - Freeze

    - by rjlopes
    Hi, I have a Windows Server 2003 that stops working randomly (displays image on monitor but is completely frozen), all I could found on the event log as causes were an error from atapi and a warning from msas2k3. The event log entries are: Event Type: Error Event Source: atapi Event Category: None Event ID: 9 Date: 22-07-2009 Time: 16:13:33 User: N/A Computer: SERVER Description: The device, \Device\Ide\IdePort0, did not respond within the timeout period. For more information, see Help and Support Center at http : // go.microsoft.com / fwlink / events.asp. Data: 0000: 0f 00 10 00 01 00 64 00 ......d. 0008: 00 00 00 00 09 00 04 c0 .......À 0010: 01 01 00 50 00 00 00 00 ...P.... 0018: f8 06 20 00 00 00 00 00 ø. ..... 0020: 00 00 00 00 00 00 00 00 ........ 0028: 00 00 00 00 01 00 00 00 ........ 0030: 00 00 00 00 07 00 00 00 ........ Event Type: Warning Event Source: msas2k3 Event Category: None Event ID: 129 Date: 22-07-2009 Time: 16:14:23 User: N/A Computer: SERVER Description: Reset to device, \Device\RaidPort0, was issued. For more information, see Help and Support Center at http : // go.microsoft.com / fwlink / events.asp. Data: 0000: 0f 00 10 00 01 00 68 00 ......h. 0008: 00 00 00 00 81 00 04 80 ......? 0010: 04 00 00 00 00 00 00 00 ........ 0018: 00 00 00 00 00 00 00 00 ........ 0020: 00 00 00 00 00 00 00 00 ........ 0028: 00 00 00 00 00 00 00 00 ........ 0030: 01 00 00 00 81 00 04 80 ......? Any hints?

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Can I have a single solid state drive and a RAID array on the same machine?

    - by jaminto
    Hi- To summarize, i'm looking to use a single solid state drive as my primary drive, and two conventional sata drives in a RAID 1 configuration for data. I am trying to install 64-bit Windows 7 onto this configuration. Is this possible? Here are the details: I built a desktop that has been running 64-bit Vista on two 500Gb in a RAID 1 array for a few years. I just purchased an Intel X25-M 80Gb Sata Solid-State Drive, and was planning on using this a my primary drive, and keeping the RAID 1 array as my data drive. I added the SSD drive and in the RAID setup, configured it as a RAID 0 array of only one disk. Then, I tried to do a clean install of windows 7 64-bit, but got stuck in the "Missing driver for CD/DVD drive" black hole of selecting driver files and Windows telling me that i don't have the appropriate driver for my hardware. The missing hardware is NOT a CD/DVD drive, since i'm installing off of my only CD/DVD drive. Plus at one point i was able to point it at a driver for my raid controller, and then my hard drives magically showed up as browsable sources for finding drivers for some other unnamed device that setup couldn't recognize. After a few hours of trying drivers (this was a very slow process) i decided to reboot and look at the BIOS settings. I'm using an ASUS M2A-VM motherboard which has an ATI SB600 RAID controller on board. I switched the "On board SATA Type" setting from "SATA" to "AHCI" thinking that since AHCI is an Intel thing, this would help. Unfortunately, this abandoned my RAID configuration, and my previously mirrored drives are showing up as separate drives when i boot into my current windows installation. Am i trying to do the impossible here? Should i just buy a separate SATA/RAID PCI card and plug the SSD into that? Any help would be greatly appreciated.

    Read the article

< Previous Page | 468 469 470 471 472 473 474 475 476 477 478 479  | Next Page >