Search Results

Search found 31207 results on 1249 pages for 'atg best practice in industries'.

Page 492/1249 | < Previous Page | 488 489 490 491 492 493 494 495 496 497 498 499  | Next Page >

• Approaches for cross server content sharing?

  - by Anonymity

  I've currently been tasked with finding a best solution to serving up content on our new site from another one of our other sites. Several approaches suggested to me, that I've looked into include using SharePoint's Lists Web Service to grab the list through javascript - which results in XSS and is not an option. Another suggestion was to build a server side custom web service and use SharePoint Request Forms to get the information - this is something I've only very briefly looked at. It's been suggested that I try permitting the requesting site in the HTTP headers of the serving site since I have access to both. This ultimately resulted in a semi-working solution that had major security holes. (I had to include username/password in the request to appease AD Authentication). This was done by allowing Access-Control-Allow-Origin: * The most direct approach I could think of was to simply build in the webpart in our new environment to have the authors manually update this content the same as they would on the other site. Are any one of the suggestions here more valid than another? Which would be the best approach? Are there other suggestions I may be overlooking? I'm also not sure if WebCrawling or Content Scrapping really holds water here...

  Read the article

• PHP Exceptions in Classes

  - by mike condiff

  I'm writing a web application (PHP) for my friend and have decided to use my limited OOP training from Java. My question is what is the best way to note in my class/application that specific critical things failed without actually breaking my page. Currently my problem is I have an Object "SummerCamper" which takes a camper_id as it's argument to load all of the necessary data into the object from the database. Say someone specifies a camper_id in the querystring that does not exist, I pass it to my objects constructor and the load fails. Currently I don't see a way for me to just return false from the constructor. I have read I could possibly do this with Exceptions, throwing an exception if no records are found in the database or if some sort of validation fails on input of the camper_id from the application etc. However, I have not really found a great way to alert my program that the Object Load has failed. I tried returning false from within the CATCH but the Object still persists in my php page. I do understand I could put a variable $is_valid = false if the load fails and then check the Object using a get method but I think there may be better ways. What is the best way of achieving the essential termination of an object if a load fails? Should I load data into the object from outside the constructor? Is there some osrt of design pattern that I should look into? Any help would be appreciated.

  Read the article

• Share in inbox in Google Apps Standard

  - by Saif Bechan

  I have recently signed up for the Standard account of Google apps. In my company I have certain email addresses that are handled by multiple users. For example the support emails are handled by multiple users. Now I have just multiple users log into the same account, but this is not a good practice. It can get quite messy when some emails are handled by different users but on the same email address. Now I looked into the groups option. I have made a group for [email protected], and added all the users to the group. Now everybody gets a copy of the support message sent. But its got a bigger mess because the users don't know who handles which message. Is there some workaround to this so I can make good use of this all in this way.

  Read the article

• Fortigate VPN Routing issue

  - by user1571299

  I have 200B Fortigate unit with 2 internet WAN connections. I also have a remote site which I'm connected to via IPSEC VPN through WAN1. This site has only one GW IP address. I'd also like to setup a VPN ontop of WAN2 with that specific site as it's destination. The default route for my end is WAN1. My problem is I cant figure out how to have both tunnels up at the same time. What's the best practice for achieving this? Thanks

  Read the article

• How to remove a package I compiled and installed manually?

  - by macek

  I recently compiled and installed Git on a new install of Mac OS 10.6 but it didn't install the documentation. I now realize I should've used the precompiled package offered here: http://code.google.com/p/git-osx-installer/downloads/list How do I remove all the files that I added to my system using make install with the Git source code? Edit: I've had similar problems in the past with other packages, too. For example, ./configure with the incorrect --prefix= or something. What's the general practice for removing unix packages?

  Read the article

• Advice on whether to use native C++ DLL or not: PINVOKE & Marshaling ?

  - by Bob

  What's the best way to do this....? I have some Native C++ code that uses a lot of Win32 calls together with byte buffers (allocated using HeapAlloc). I'd like to extend the code and make a C# GUI...and maybe later use a basic Win32 GUI (for use where there is no .Net and limited MFC support). (A) I could just re-write the code in C# and use multiple PINVOKEs....but even with the PINVOKES in a separate class, the code looks messy with all the marshaling. I'm also re-writing a lot of code. (B) I could create a native C++ DLL and use PINVOKE to marshal in the native data structures. I'm assuming I can include the native C++ DLL/LIB in a project using C#? (C) Create a mixed mode DLL (Native C++ class plus managed ref class). I'm assuming that this would make it easier to use the managed ref class in C#......but is this the case? Will the managed class handle all the marshaling? Can I use this mixed mode DLL on a platform with no .Net (i.e. still access the native C++ unmanaged component) or do I limit myself to .Net only platforms. One thing that bothers me about each of these options is all the marshalling. Is it better to create a managed data structure (array, string etc.) and pass that to the native C++ class, or, the other way around? Any ideas on what would be considered best practice...?

  Read the article

• Need an Overview of Possibilities for multicolumn programming

  - by Sam

  Hi folks, From source1 and source2 i gather that IE9 will NOT support multi-column css3!! Since it is still the most popular browser (another thing i cannot understand), i am left but no other choice than to use Programming Power to make multi-columns work. Now, I use three divs that float to left, and which are manually filled with text. Please don't laugh i know its stupid! But I would wish to not to have to worry about the columns and just have a one piece of (un-interrupted) text which all goes into only 1 div, and then have a program smart enough to split it up into X equally wide columns. Question: before i start reinvent the wheel, what methods of programming power have you known that tackle this elegantly? Please suggest your best working multi-column layout sources so I can evaluate which option is the best (I will update the below table). Exploring all possibilities 2011 and further, to enable multi column text user experience: Language Author SourceCodeUsage WorksOnAllMajorBrowser? ================================================================================= html manual labour put text manually in separate left-floating divs "Y" // Upside: control! Downside: few changes necessitates to reflow 3 divs manually! CSS3 w3c css3.info/preview/multi-column-layout/ "N" // {-moz-column-count: 3; -webkit-column-count: 3; } Thats all! javascript a list apart will add url soon ? // php ? ? ? //

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• What are steps to upgrade an cisco UCS B series system vmware vsphere from 4.1 to 5.0

  - by Gk.

  I have a Cisco UCS B-series system with 1.4 firmware running vsphere 4.1 (ESX) + Nexus 1000V. I want upgrade all that stuff to vsphere 5.0 without downtime. I tried to find any documentation describe all steps needed to do it, but cannot found anything clear. Here is my plan: Upgrade firmware of UCS from 1.4 to 2.0. Doc: http://www.cisco.com/en/US/docs/unified_computing/ucs/sw/upgrading/from1.4/to2.0/b_UpgradingCiscoUCSFrom1.4To2.0.html Upgrade all vcenter, hosts+VEM, virtual machines, datastores using VMWare best practice. Is it OK? Am I missing something? Thank you, giobuon.

  Read the article

• Google App Engine - How to implement the activity stream in a social network

  - by spidee

  I want some ideas on the best practice to implement an activity stream for a social network im building in app engine (PYTHON) I first want to keep a log for all activities of each user - so that we have a history. i.e. someone became a friend, added a picture, changed their address etc. This way we have a users history available should we need it. Also mean we can remove friendship joins, change user data but have a historical log. I also want to stream a users activity to their friends. for this only the last X activities need to be kept - that is in the scenario that messages are sent to friends when an activity occurs. Its pretty straight forward designing a history log - ie: when, what, where. The complication comes as to how we notify friends of a user as to their activity. In our app friendships are not mutual - ie they are based on the twitter following model. Some accounts could have thousands of followers. What is the best approach to model this. using a many to many join table and doing a costly query - using a feed class that fired a copy of the activity to all the subscribers - maybe into mcache? As their maybe a need to fire thousands of messages i would imagine a cron job would need to be used. Any help ideas thoughts on this Thx

  Read the article

• Java Constructor Style (Check parameters aren't null)

  - by Peter

  What are the best practices if you have a class which accepts some parameters but none of them are allowed to be null? The following is obvious but the exception is a little unspecific: public class SomeClass { public SomeClass(Object one, Object two) { if (one == null || two == null) { throw new IllegalArgumentException("Parameters can't be null"); } //... } } Here the exceptions let you know which parameter is null, but the constructor is now pretty ugly: public class SomeClass { public SomeClass(Object one, Object two) { if (one == null) { throw new IllegalArgumentException("one can't be null"); } if (two == null) { throw new IllegalArgumentException("two can't be null"); } //... } Here the constructor is neater, but now the constructor code isn't really in the constructor: public class SomeClass { public SomeClass(Object one, Object two) { setOne(one); setTwo(two); } public void setOne(Object one) { if (one == null) { throw new IllegalArgumentException("one can't be null"); } //... } public void setTwo(Object two) { if (two == null) { throw new IllegalArgumentException("two can't be null"); } //... } } Which of these styles is best? Or is there an alternative which is more widely accepted? Cheers, Pete

  Read the article

• Choosing design method for ladder-like word game.

  - by owca

  I'm trying to build a simple application, with the finished program looking like this : I will also have to implement two different GUI layouts for this. Now I'm trying to figure out the best method to perform this task. My professor told me to introduce Element class with 4 states : - empty - invisible (used in GridLayout) - first letter - other letter I've thought about following solutions (by List I mean any sort of Collection) : 1. Element is a single letter, and each line is Element[]. Game class will be array of arrays Element[]. I guess that's the dumbest way, and the validation might be troublesome. 2. Like previously but Line is a List of Element. Game is an array of Lines. 3. Like previously but Game is a List of Lines. Which one should I choose ? Or maybe do you have better ideas ? What collection would be best if to use one ?

  Read the article

• jquery callback functions failing to finish execution

  - by calumbrodie

  I'm testing a jquery app i've written and have come across some unexpected behaviour $('button.clickme').live('click',function(){ //do x (takes 2 seconds) //do y (takes 4 seconds) //do z (takes 0.5 seconds) }) The event can be triggered by a number of buttons. What I'm finding is that when I click each button slowly (allowing 10 seconds between clicks) - my callback function executes correctly (actions x, y & z complete). However If I rapidly click buttons on my page it appears that the function sometimes only completes up to step x or y before terminating. My question: Is it the case that if this function is fired by a clicking second DOM element, while the first callback function is completing - will jQuery terminate the first callback and start over again? Do I have to write my callback function explicitly outside the event handler and then call it?? function doStuff() { //do x //do y //do z ( } $('button.clickme).live('click',doStuff()) If this is the case can someone explain why this is happening or give me a link to some advice on best practice on closures etc - I'd like to know the BEST way to write jQuery to improve performance etc. Thanks

  Read the article

• Where should an application's default folder live?

  - by HotOil

  Hi: I'm creating a little app that configures a connected device and then saves the config information in a file. The filename cannot be chosen by the user, but its location can be chosen. Where is the best place for the app's default save-to folder? I have seen examples out there where it is the "MyDocuments" location (eg Visual Studio does this). I have seen a folder created right at the top of the C:\ drive. I find that to be a little obnoxious, personally. It could be in the Program Files[Manufacturer] or Program Files[Product Name], or wherever the app was installed. I have used this location in the past; I dislike it because Windows Explorer does not allow a user to browse to there very easily ('browsability'). Going with this last notion that 'browsability' is a factor, I suppose MyDocuments is the best choice. Is this the most common, most widely accepted practice? I think historically we have chosen the install folder because that co-locates the data with the device management utilities. But I would really like to get away from that. I don't want the user to have to go pawing through system files to find his/her data, esp if that person is not too Windows-savvy. Also, I am using the .NET WinForms FolderBrowserDialog, and the "Environment.SpecialFolders" enum isn't helpful in setting up the dialog to point into the Program Files folder. Thanks for your input! Suz.

  Read the article

• Getting started with workflows in sharepoint 2010

  - by Thomas Stock

  Hi, I'm a beginning sharepoint developer asked to implement the following scenario in sharepoint 2010. We're a bit lost on the best approach to get started.. I'm really struggling to find the best practise solution. This is the flow: A user can make a request with a title and a description. A mail gets sent to the representative with a link to a form. A representative can approve or reject the request. If approved: A mail gets sent to Board with a link to form If rejected: A mail gets sent to the user with the message that it has been rejected. when the request was approved by the representative, the board can approve or reject the request. A mail gets sent to the user and the representative with the descision of the board. So the list has the following fields: Request title Request description Representative approval Representative description Board approval Board description The user should see the following form: Request title (editable) Request description (editable) The representative should see the following form: Request title (read-only) Request description (read-only) Representative approval (editable) Representative description (editable) The Board should see the following form: Request title (read-only) Request description (read-only) Representative approval (read-only) Representative description (read-only) Board approval (editable) Board description (editable) My questions: What tool is most appropriate for making the forms? Infopath? SPD? VS2010? How do I handle rights to make sure only the board can access the board edit form? What kind of workflow do I use? When do I start the workflow(s)? What do I use to develop the workflow(s)? How do I handle rights when showing the listview with all requests? How can I build the links in the mails sent to the different groups. Thanks in advance for any advice.

  Read the article

• SAN/NAS with high availability?

  - by netvope

  I have two servers that I plan to use for storage. Each of them has a few SATA disks directly attached. I want the storage to be available even if one of the storage servers is down (preferably the clients wouldn't even notice that the fail-over, although I'm not sure if this is possible). The clients may access the storage via NFS and samba, but this is not a must; I could use something else if needed. I found this guide, Installing and Configuring Openfiler with DRBD and Heartbeat, which apparently does the thing I want. It relies on three components, Openfiler, DRBD, and Heartbeat, and all three of them need to be configured separately. I'm wondering are there simpler solutions? Is using DRBD+Heartbeat the best practice for a situation like mine? I'm also interested to know if there are alternatives that don't depend on DRBD.

  Read the article

• Structuring the UI code of a single-page EXTjs Web app using Rails?

  - by Daniel Beardsley

  I’m in the process of creating a large single-page web-app using ext-js for the UI components with Rails on the backend. I’ve come to good solutions for transferring data using Whorm gem and Rails support of RESTful Resources. What I haven’t come to a conclusion on is how to structure the UI and business logic aspects of the application. I’ve had a look at a few options, including Netzke but haven’t seen anything that I really think fits my needs. How should a web-application that uses ext-js components, layouts, and controls in the browser and Rails on the server best implement UI component re-use, good organization, and maintainability while maintaining a flexible layout design. Specifically I’m looking for best-practice suggestions for structuring the code that creates and configures UI components (many UI config options will be based on user data) Should EXT classes be extended in static JS for often re-used customizations and then instantiated with various configuration options by generated JS within html partials? Should partials create javascript blocks that instantiate EXT components? Should partials call helpers that return ruby hashes for EXT component config which is then dumped to Json? Something else entirely? There are many options and I'd love to hear from people who've been down this road and found some methodology that worked for them.

  Read the article

• What database strategy to choose for a large web application

  - by Snoopy

  I have to rewrite a large database application, running on 32 servers. The hardware is up to date, each machine has two quad core Xeon and 32 GByte RAM. The database is multi-tenant, each customer has his own file, around 5 to 10 GByte each. I run around 50 databases on this hardware. The app is open to the web, so I have no control on the load. There are no really complex queries, so SQL is not required if there is a better solution. The databases get updated via FTP every day at midnight. The database is read-only. C# is my favourite language and I want to use ASP.NET MVC. I thought about the following options: Use two big SQL servers running SQL Server 2012 to serve the 32 servers with data. On the 32 servers running IIS hosting providing REST services. Denormalize the database and use Redis on each webserver. Use booksleeve as a Redis client. Use a combination of SQL Server and Redis Use SQL Server 2012 together with Hadoop Use Hadoop without SQL Server What is the best way for a read-only database, to get the best performance without loosing maintainability? Does Map-Reduce make sense at all in such a scenario? The reason for the rewrite is, the old app written in C++ with ISAM technology is too slow, the interfaces are old fashioned and not nice to use from an website, especially when using ajax. The app uses a relational datamodel with many tables, but it is possible to write one accerlerator table where all queries can be performed on, and all other information from the other tables are possible by a simple key lookup.

  Read the article

• Can I create a DC without a DNS Server?

  - by onik

  So as the title says, I need to promote a standalone Win2008R2 server to a Domain Controller, and I don't a DNS Server (I think), as there will be no clients connected to the domain, it will be only used for Remote Desktop Services. Yes, I know, it's considered bad practice to install other roles on the DC, but in this case, it's necessary. Do I need to install the DNS Server, and if I do, how to make it as transparent as possible? EDIT: Seems that I need to install the DNS Server, so I can I configure it not to mess up my entire domain? For example: The server I need to promote is rdc.mydomain.com, and it has an A entry to it's IP in the current DNS, while other servers under mydomain.com are running Linux and don't need to know anything about this Windows box. The domain uses a third-party DNS and all edits and updates need to be done via a separate web page, our servers don't have write/update access.

  Read the article

• configuring linux server to send traffic to local machines using local IP address

  - by gkdsp

  Two linux servers, server1 and server2, are on the same local network (they also have access to an external network). Server2 has a local IP of 192.168.0.2 and a host name of host2.mydomain.com. QUESTION 1: If an application on server1 sends traffic to server2 using a host name of host2.mydomain.com, what determines whether this traffic is routed to server2 using the local or external network? QUESTION 2: To ensure that all traffic sent from server1 to server2 always uses the local network, could I simply include in the server1 /etc/hosts file the following? 192.168.0.2 host2.mydomain.com ...the thinking being, if the servers are always on the same network there should never be a need for server2 to send traffic to server1 via the external network (that I can think of anyway). Is this done in practice, or is some other method preferred?

  Read the article

• Has anyone figured out how to use same username with different passwords (Windows)

  - by Coder

  Tried Googling, tried net use, and anything I could, with no results. I have a PC with users, and I have a network server with shared folders. For some users the usernames of the share and local account match, but the passwords are different (a good security practice). Unfortunately, Windows doesn't want to remap the drives on login, and asks for credentials when I try to connect. If I enter the password, the connection succeeds, but it still fails on next login, even if I have checked the "remember" checkbox. On PC: usera@machinea pass1 On NAS: usera@nas pass2 net use z: \\nasip\usera /user:nasip\usera pass2 /persistent:yes Credential store seems to have the user credentials stored... But the mapping fails all the time.

  Read the article

• How to extract byte-array from one xml and store it in another in Java

  - by grobartn

  So I am using DocumentBuilderFactory and DocumentBuilder to parse an xml. So it is DOM parser. But what I am trying to do is extract byte-array data (its an image encoded in base64) Store it in one object and later in code write it out to another xml encoded in base64. What is the best way to store this in btw. Store it as string? or as ByteArray? How can I extract byte array data in best way and write it out. I am not experienced with this so wanted to get opinion from the group. UPDATE: I am given XML I do not have control of incoming XML that comes in binary64 encoded < byte-array > ... base64 encoded image ... < /byte-array > Using parser I have I need to store this node and question is should that be byte or string and then writing it out to another node in new xml. again in base64 encoding. thanks

  Read the article

• Force ntpd to make changes in smaller steps

  - by David Wolever

  The NTP documentation says: Under ordinariy conditions, ntpd adjusts the clock in small steps so that the timescale is effectively continuous and without discontinuities - http://doc.ntp.org/4.1.0/ntpd.htm However, this is not at all what I have noticed in practice. If I manually change the system time backwards or forwards 5 or 10 seconds then start ntpd, I notice that it adjusts the clock in one shot. For example, with this code: #!/usr/bin/env python import time last = time.time() while True: time.sleep(1) print time.time() - last last = time.time() When I first change the time, I'll notice something like: 1.00194311142 8.29711604118 1.0010509491 Then when I start NTPd, I'll see something like: 1.00194311142 -8.117301941 1.0010509491 Is there any way to force ntpd to make the adjustments in smaller steps?

  Read the article

• Reading a C/C++ data structure in C# from a byte array

  - by Chris Miller

  What would be the best way to fill a C# struct from a byte[] array where the data was from a C/C++ struct? The C struct would look something like this (my C is very rusty): typedef OldStuff { CHAR Name[8]; UInt32 User; CHAR Location[8]; UInt32 TimeStamp; UInt32 Sequence; CHAR Tracking[16]; CHAR Filler[12];} And would fill something like this: [StructLayout(LayoutKind.Explicit, Size = 56, Pack = 1)]public struct NewStuff{ [MarshalAs(UnmanagedType.ByValTStr, SizeConst = 8)] [FieldOffset(0)] public string Name; [MarshalAs(UnmanagedType.U4)] [FieldOffset(8)] public uint User; [MarshalAs(UnmanagedType.ByValTStr, SizeConst = 8)] [FieldOffset(12)] public string Location; [MarshalAs(UnmanagedType.U4)] [FieldOffset(20)] public uint TimeStamp; [MarshalAs(UnmanagedType.U4)] [FieldOffset(24)] public uint Sequence; [MarshalAs(UnmanagedType.ByValTStr, SizeConst = 16)] [FieldOffset(28)] public string Tracking;} What is best way to copy OldStuff to NewStuff, if OldStuff was passed as byte[] array? I'm currently doing something like the following, but it feels kind of clunky. GCHandle handle;NewStuff MyStuff;int BufferSize = Marshal.SizeOf(typeof(NewStuff));byte[] buff = new byte[BufferSize];Array.Copy(SomeByteArray, 0, buff, 0, BufferSize);handle = GCHandle.Alloc(buff, GCHandleType.Pinned);MyStuff = (NewStuff)Marshal.PtrToStructure(handle.AddrOfPinnedObject(), typeof(NewStuff));handle.Free(); Is there better way to accomplish this?

  Read the article

• Only ONE Outlook 2010 installation "Cannot connect to Exchange server" when setting up new profile.

  - by Johnny PDEX

  Exchange 2010, one-server installation (small production, I know not best practice) OWA Connectivity has been confirmed, Autodiscover is configured and working properly for EVERY other installation. Other user accounts tested on problem Outlook, none can connect. Windows Firewall is pre-configured by Group Policy, only modifications being related to remote management. Firewall has also been disabled during diagnostic period. Network discovery and file sharing is enabled on workstation as well. Windows 7 Professional, latest updates installed. Driving me nuts. Help, serverfault?

  Read the article

< Previous Page | 488 489 490 491 492 493 494 495 496 497 498 499  | Next Page >