Search Results

Search found 3324 results on 133 pages for 'gb j'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 5/133 | < Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >

  • Mapping of memory addresses to physical modules in Windows XP

    - by Josef Grahn
    I plan to run 32-bit Windows XP on a workstation with dual processors, based on Intel's Nehalem microarchitecture, and triple channel RAM. Even though XP is limited to 4 GB of RAM, my understanding is that it will function with more than 4 GB installed, but will only expose 4 GB (or slightly less). My question is: Assuming that 6 GB of RAM is installed in six 1 GB modules, which physical 4 GB will Windows actually map into its address space? In particular: Will it use all six 1 GB modules, taking advantage of all memory channels? (My guess is yes, and that the mapping to individual modules within a group happens in hardware.) Will it map 2 GB of address space to each of the two NUMA nodes (as each processor has it's own memory interface), or will one processor get fast access to 3 GB of RAM, while the other only has 1 GB? Thanks!

    Read the article

  • apt-get 403 Forbidden

    - by Lerp
    I've start a new job today and I am trying to set up my machine to run through their Windows server. I've managed to get a internet connection through the server now but now I can't run apt-get update as I get a "403 Forbidden" error. This is for every repo under my source list, apart from translations(?). I do have a proxy in apt.conf, if I don't have it I get a 407 Permission Denied error. Here's my apt.conf file (I have omitted my username and password) Acquire::http::proxy "http://username:[email protected]:8080/"; Here's my sources.list #deb cdrom:[Ubuntu 12.04.2 LTS _Precise Pangolin_ - Release amd64 (20130213)]/ dists/precise/main/binary-i386/ #deb cdrom:[Ubuntu 12.04.2 LTS _Precise Pangolin_ - Release amd64 (20130213)]/ dists/precise/restricted/binary-i386/ #deb cdrom:[Ubuntu 12.04.2 LTS _Precise Pangolin_ - Release amd64 (20130213)]/ precise main restricted # See http://help.ubuntu.com/community/UpgradeNotes for how to upgrade to # newer versions of the distribution. deb http://gb.archive.ubuntu.com/ubuntu/ precise main restricted deb-src http://gb.archive.ubuntu.com/ubuntu/ precise main restricted ## Major bug fix updates produced after the final release of the ## distribution. deb http://gb.archive.ubuntu.com/ubuntu/ precise-updates main restricted deb-src http://gb.archive.ubuntu.com/ubuntu/ precise-updates main restricted ## N.B. software from this repository is ENTIRELY UNSUPPORTED by the Ubuntu ## team. Also, please note that software in universe WILL NOT receive any ## review or updates from the Ubuntu security team. deb http://gb.archive.ubuntu.com/ubuntu/ precise universe deb-src http://gb.archive.ubuntu.com/ubuntu/ precise universe deb http://gb.archive.ubuntu.com/ubuntu/ precise-updates universe deb-src http://gb.archive.ubuntu.com/ubuntu/ precise-updates universe ## N.B. software from this repository is ENTIRELY UNSUPPORTED by the Ubuntu ## team, and may not be under a free licence. Please satisfy yourself as to ## your rights to use the software. Also, please note that software in ## multiverse WILL NOT receive any review or updates from the Ubuntu ## security team. deb http://gb.archive.ubuntu.com/ubuntu/ precise multiverse deb-src http://gb.archive.ubuntu.com/ubuntu/ precise multiverse deb http://gb.archive.ubuntu.com/ubuntu/ precise-updates multiverse deb-src http://gb.archive.ubuntu.com/ubuntu/ precise-updates multiverse ## N.B. software from this repository may not have been tested as ## extensively as that contained in the main release, although it includes ## newer versions of some applications which may provide useful features. ## Also, please note that software in backports WILL NOT receive any review ## or updates from the Ubuntu security team. deb http://gb.archive.ubuntu.com/ubuntu/ precise-backports main restricted universe multiverse deb-src http://gb.archive.ubuntu.com/ubuntu/ precise-backports main restricted universe multiverse deb http://security.ubuntu.com/ubuntu precise-security main restricted deb-src http://security.ubuntu.com/ubuntu precise-security main restricted deb http://security.ubuntu.com/ubuntu precise-security universe deb-src http://security.ubuntu.com/ubuntu precise-security universe deb http://security.ubuntu.com/ubuntu precise-security multiverse deb-src http://security.ubuntu.com/ubuntu precise-security multiverse ## Uncomment the following two lines to add software from Canonical's ## 'partner' repository. ## This software is not part of Ubuntu, but is offered by Canonical and the ## respective vendors as a service to Ubuntu users. # deb http://archive.canonical.com/ubuntu precise partner # deb-src http://archive.canonical.com/ubuntu precise partner ## This software is not part of Ubuntu, but is offered by third-party ## developers who want to ship their latest software. deb http://extras.ubuntu.com/ubuntu precise main deb-src http://extras.ubuntu.com/ubuntu precise main I can sort-of fix this by changing all the http in sources.list to ftp but I still have issues with ppas

    Read the article

  • Why is the usable memory on my Macbook pro shown as 2.74 Gb when there is 4GB installed with 32bit Windows 7? [closed]

    - by Bobby Alexander
    Possible Duplicate: Windows XP and RAM 3.5GB+ Installed RAM : 4 GB but 2.96GB Usable......why? I have a Macbook Pro with 4GB of installed RAM. I have installed Windows 7 on it which shows the usable memory as 2.74GB. Why is this? Don't tell me the 32 bit story; I program for a living. The maximum addressible memory on a 32 bit system is 4 GB not 3 GB. Need proof? MSDN: Memory Limits for Windows Releases

    Read the article

  • Does the Dell Inspiron 1501 handle more than 4 Gb of RAM?

    - by zillion
    After the following comment on my last question, I'm thinking about upgrading my RAM: I got a 160 GB Scorpio Blue a couple months ago for my 1501. It's nice. That + 2 GB Crucial RAM have rather revived my notebook (meaning a very nice speed and storage boost). I was outgrowing it... – Nathaniel What would be the best choice to add more RAM? I've already got 2 GB, but I'm not sure what their speed is. What are the size, type and speed limitations for RAM on my particular laptop?

    Read the article

  • How do I move my LVM 250 GB root partition to a new 120GB hard disk?

    - by Dennis Schma
    I have the following situation: My current Ubuntu installation is running from an external HDD (250 GB) because I was to lazy to buy an new internal hdd. Now i've got a new internal (120GB) and i want to move everything to the internal. Installing Ubuntu new is out of disscussion because its to peronalized. Luckily (i hope so) the root partition is partitioned with LVM, so i hope i can move the partition to the smaller internal HDD. Is this possible? And where do i find help?

    Read the article

  • HP SmartArray P400: How to repair failed logical drive?

    - by TegtmeierDE
    I have a HP Server with SmartArray P400 controller (incl. 256 MB Cache/Battery Backup) with a logicaldrive with replaced failed physicaldrive that does not rebuild. This is how it looked when I detected the error: ~# /usr/sbin/hpacucli ctrl slot=0 show config Smart Array P400 in Slot 0 (Embedded) (sn: XXXX) array A (SATA, Unused Space: 0 MB) logicaldrive 1 (698.6 GB, RAID 1, OK) physicaldrive 1I:1:1 (port 1I:box 1:bay 1, SATA, 750 GB, OK) physicaldrive 1I:1:2 (port 1I:box 1:bay 2, SATA, 750 GB, OK) array B (SATA, Unused Space: 0 MB) logicaldrive 2 (2.7 TB, RAID 5, Failed) physicaldrive 1I:1:3 (port 1I:box 1:bay 3, SATA, 750 GB, OK) physicaldrive 1I:1:4 (port 1I:box 1:bay 4, SATA, 750 GB, OK) physicaldrive 2I:1:5 (port 2I:box 1:bay 5, SATA, 750 GB, OK) physicaldrive 2I:1:6 (port 2I:box 1:bay 6, SATA, 750 GB, Failed) physicaldrive 2I:1:7 (port 2I:box 1:bay 7, SATA, 750 GB, OK) unassigned physicaldrive 2I:1:8 (port 2I:box 1:bay 8, SATA, 750 GB, OK) ~# I thought that I had drive 2I:1:8 configured as a spare for Array A and Array B, but it seems this was not the case :-(. I noticed the problem due to I/O errors on the host, even if only 1 physicaldrive of the RAID5 is failed. Does someone know why this could happen? The logicaldrive should go into "Degraded" mode but still be fully accessible from the host os!? I first tried to add the unassigned drive 2I:1:8 as a spare to logicaldrive 2, but this was not possible: ~# /usr/sbin/hpacucli ctrl slot=0 array B add spares=2I:1:8 Error: This operation is not supported with the current configuration. Use the "show" command on devices to show additional details about the configuration. ~# Interestingly it is possible to add the unassigned drive to the first array without problems. I thought maybe the controller put the array into "failed" state due to the missing spare and protects failed arrays from modification. So I tried was to reenable the logicaldrive (to add the spare afterwards): ~# /usr/sbin/hpacucli ctrl slot=0 ld 2 modify reenable Warning: Any previously existing data on the logical drive may not be valid or recoverable. Continue? (y/n) y Error: This operation is not supported with the current configuration. Use the "show" command on devices to show additional details about the configuration. ~# But as you can see, re-enabling the logicaldrive this was not possible. Now I replaced the failed drive by hotswapping it with the unassigned drive. The status now looks like this: ~# /usr/sbin/hpacucli ctrl slot=0 show config Smart Array P400 in Slot 0 (Embedded) (sn: XXXX) array A (SATA, Unused Space: 0 MB) logicaldrive 1 (698.6 GB, RAID 1, OK) physicaldrive 1I:1:1 (port 1I:box 1:bay 1, SATA, 750 GB, OK) physicaldrive 1I:1:2 (port 1I:box 1:bay 2, SATA, 750 GB, OK) array B (SATA, Unused Space: 0 MB) logicaldrive 2 (2.7 TB, RAID 5, Failed) physicaldrive 1I:1:3 (port 1I:box 1:bay 3, SATA, 750 GB, OK) physicaldrive 1I:1:4 (port 1I:box 1:bay 4, SATA, 750 GB, OK) physicaldrive 2I:1:5 (port 2I:box 1:bay 5, SATA, 750 GB, OK) physicaldrive 2I:1:6 (port 2I:box 1:bay 6, SATA, 750 GB, OK) physicaldrive 2I:1:7 (port 2I:box 1:bay 7, SATA, 750 GB, OK) ~# The logical drive is still not accessible. Why is it not rebuilding? What can I do? FYI, this is the configuration of my controller: ~# /usr/sbin/hpacucli ctrl slot=0 show Smart Array P400 in Slot 0 (Embedded) Bus Interface: PCI Slot: 0 Serial Number: XXXX Cache Serial Number: XXXX RAID 6 (ADG) Status: Enabled Controller Status: OK Chassis Slot: Hardware Revision: Rev E Firmware Version: 5.22 Rebuild Priority: Medium Expand Priority: Medium Surface Scan Delay: 15 secs Surface Analysis Inconsistency Notification: Disabled Raid1 Write Buffering: Disabled Post Prompt Timeout: 0 secs Cache Board Present: True Cache Status: OK Accelerator Ratio: 25% Read / 75% Write Drive Write Cache: Disabled Total Cache Size: 256 MB No-Battery Write Cache: Disabled Cache Backup Power Source: Batteries Battery/Capacitor Count: 1 Battery/Capacitor Status: OK SATA NCQ Supported: True ~# Thanks for you help in advance.

    Read the article

  • Proliant server will not accept new hard disks in RAID 1+0?

    - by Leigh
    I have a HP ProLiant DL380 G5, I have two logical drives configured with RAID. I have one logical drive RAID 1+0 with two 72 gb 10k sas 1 port spare no 376597-001. I had one hard disk fail and ordered a replacement. The configuration utility showed error and would not rebuild the RAID. I presumed a hard disk fault and ordered a replacement again. In the mean time I put the original failed disk back in the server and this started rebuilding. Currently shows ok status however in the log I can see hardware errors. The new disk has come and I again have the same problem of not accepting the hard disk. I have updated the P400 controller with the latest firmware 7.24 , but still no luck. The only difference I can see is the original drive has firmware 0103 (same as the RAID drive) and the new one has HPD2. Any advice would be appreciated. Thanks in advance Logs from server ctrl all show config Smart Array P400 in Slot 1 (sn: PAFGK0P9VWO0UQ) array A (SAS, Unused Space: 0 MB) logicaldrive 1 (68.5 GB, RAID 1, Interim Recovery Mode) physicaldrive 2I:1:1 (port 2I:box 1:bay 1, SAS, 73.5 GB, OK) physicaldrive 2I:1:2 (port 2I:box 1:bay 2, SAS, 72 GB, Failed array B (SAS, Unused Space: 0 MB) logicaldrive 2 (558.7 GB, RAID 5, OK) physicaldrive 1I:1:5 (port 1I:box 1:bay 5, SAS, 300 GB, OK) physicaldrive 2I:1:3 (port 2I:box 1:bay 3, SAS, 300 GB, OK) physicaldrive 2I:1:4 (port 2I:box 1:bay 4, SAS, 300 GB, OK) ctrl all show config detail Smart Array P400 in Slot 1 Bus Interface: PCI Slot: 1 Serial Number: PAFGK0P9VWO0UQ Cache Serial Number: PA82C0J9VWL8I7 RAID 6 (ADG) Status: Disabled Controller Status: OK Hardware Revision: E Firmware Version: 7.24 Rebuild Priority: Medium Expand Priority: Medium Surface Scan Delay: 15 secs Surface Scan Mode: Idle Wait for Cache Room: Disabled Surface Analysis Inconsistency Notification: Disabled Post Prompt Timeout: 0 secs Cache Board Present: True Cache Status: OK Cache Status Details: A cache error was detected. Run more information. Cache Ratio: 100% Read / 0% Write Drive Write Cache: Disabled Total Cache Size: 256 MB Total Cache Memory Available: 208 MB No-Battery Write Cache: Disabled Battery/Capacitor Count: 0 SATA NCQ Supported: True Array: A Interface Type: SAS Unused Space: 0 MB Status: Failed Physical Drive Array Type: Data One of the drives on this array have failed or has Logical Drive: 1 Size: 68.5 GB Fault Tolerance: RAID 1 Heads: 255 Sectors Per Track: 32 Cylinders: 17594 Strip Size: 128 KB Full Stripe Size: 128 KB Status: Interim Recovery Mode Caching: Enabled Unique Identifier: 600508B10010503956574F305551 Disk Name: \\.\PhysicalDrive0 Mount Points: C:\ 68.5 GB Logical Drive Label: A0100539PAFGK0P9VWO0UQ0E93 Mirror Group 0: physicaldrive 2I:1:2 (port 2I:box 1:bay 2, S Mirror Group 1: physicaldrive 2I:1:1 (port 2I:box 1:bay 1, S Drive Type: Data physicaldrive 2I:1:1 Port: 2I Box: 1 Bay: 1 Status: OK Drive Type: Data Drive Interface Type: SAS Size: 73.5 GB Rotational Speed: 10000 Firmware Revision: 0103 Serial Number: B379P8C006RK Model: HP DG072A9B7 PHY Count: 2 PHY Transfer Rate: Unknown, Unknown physicaldrive 2I:1:2 Port: 2I Box: 1 Bay: 2 Status: Failed Drive Type: Data Drive Interface Type: SAS Size: 72 GB Rotational Speed: 15000 Firmware Revision: HPD9 Serial Number: D5A1PCA04SL01244 Model: HP EH0072FARUA PHY Count: 2 PHY Transfer Rate: Unknown, Unknown Array: B Interface Type: SAS Unused Space: 0 MB Status: OK Array Type: Data Logical Drive: 2 Size: 558.7 GB Fault Tolerance: RAID 5 Heads: 255 Sectors Per Track: 32 Cylinders: 65535 Strip Size: 64 KB Full Stripe Size: 128 KB Status: OK Caching: Enabled Parity Initialization Status: Initialization Co Unique Identifier: 600508B10010503956574F305551 Disk Name: \\.\PhysicalDrive1 Mount Points: E:\ 558.7 GB Logical Drive Label: AF14FD12PAFGK0P9VWO0UQD007 Drive Type: Data physicaldrive 1I:1:5 Port: 1I Box: 1 Bay: 5 Status: OK Drive Type: Data Drive Interface Type: SAS Size: 300 GB Rotational Speed: 10000 Firmware Revision: HPD4 Serial Number: 3SE07QH300009923X1X3 Model: HP DG0300BALVP Current Temperature (C): 32 Maximum Temperature (C): 45 PHY Count: 2 PHY Transfer Rate: Unknown, Unknown physicaldrive 2I:1:3 Port: 2I Box: 1 Bay: 3 Status: OK Drive Type: Data Drive Interface Type: SAS Size: 300 GB Rotational Speed: 10000 Firmware Revision: HPD4 Serial Number: 3SE0AHVH00009924P8F3 Model: HP DG0300BALVP Current Temperature (C): 34 Maximum Temperature (C): 47 PHY Count: 2 PHY Transfer Rate: Unknown, Unknown physicaldrive 2I:1:4 Port: 2I Box: 1 Bay: 4 Status: OK Drive Type: Data Drive Interface Type: SAS Size: 300 GB Rotational Speed: 10000 Firmware Revision: HPD4 Serial Number: 3SE08NAK00009924KWD6 Model: HP DG0300BALVP Current Temperature (C): 35 Maximum Temperature (C): 47 PHY Count: 2 PHY Transfer Rate: Unknown, Unknown

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Given an array of arrays, how can I strip out the substring "GB" from each value?

    - by stormist
    Each item in my array is an array of about 5 values.. Some of them are numerical ending in "GB".. I need the same array but with "GB" stripped out so that just the number remains. So I need to iterate through my whole array, on each subarray take each value and strip the string "GB" from it and create a new array from the output. Can anyone recommend and efficient method of doing this?

    Read the article

  • Sun Fire X4270 M3 SAP Enhancement Package 4 for SAP ERP 6.0 (Unicode) Two-Tier Standard Sales and Distribution (SD) Benchmark

    - by Brian
    Oracle's Sun Fire X4270 M3 server achieved 8,320 SAP SD Benchmark users running SAP enhancement package 4 for SAP ERP 6.0 with unicode software using Oracle Database 11g and Oracle Solaris 10. The Sun Fire X4270 M3 server using Oracle Database 11g and Oracle Solaris 10 beat both IBM Flex System x240 and IBM System x3650 M4 server running DB2 9.7 and Windows Server 2008 R2 Enterprise Edition. The Sun Fire X4270 M3 server running Oracle Database 11g and Oracle Solaris 10 beat the HP ProLiant BL460c Gen8 server using SQL Server 2008 and Windows Server 2008 R2 Enterprise Edition by 6%. The Sun Fire X4270 M3 server using Oracle Database 11g and Oracle Solaris 10 beat Cisco UCS C240 M3 server running SQL Server 2008 and Windows Server 2008 R2 Datacenter Edition by 9%. The Sun Fire X4270 M3 server running Oracle Database 11g and Oracle Solaris 10 beat the Fujitsu PRIMERGY RX300 S7 server using SQL Server 2008 and Windows Server 2008 R2 Enterprise Edition by 10%. Performance Landscape SAP-SD 2-Tier Performance Table (in decreasing performance order). SAP ERP 6.0 Enhancement Pack 4 (Unicode) Results (benchmark version from January 2009 to April 2012) System OS Database Users SAPERP/ECCRelease SAPS SAPS/Proc Date Sun Fire X4270 M3 2xIntel Xeon E5-2690 @2.90GHz 128 GB Oracle Solaris 10 Oracle Database 11g 8,320 20096.0 EP4(Unicode) 45,570 22,785 10-Apr-12 IBM Flex System x240 2xIntel Xeon E5-2690 @2.90GHz 128 GB Windows Server 2008 R2 EE DB2 9.7 7,960 20096.0 EP4(Unicode) 43,520 21,760 11-Apr-12 HP ProLiant BL460c Gen8 2xIntel Xeon E5-2690 @2.90GHz 128 GB Windows Server 2008 R2 EE SQL Server 2008 7,865 20096.0 EP4(Unicode) 42,920 21,460 29-Mar-12 IBM System x3650 M4 2xIntel Xeon E5-2690 @2.90GHz 128 GB Windows Server 2008 R2 EE DB2 9.7 7,855 20096.0 EP4(Unicode) 42,880 21,440 06-Mar-12 Cisco UCS C240 M3 2xIntel Xeon E5-2690 @2.90GHz 128 GB Windows Server 2008 R2 DE SQL Server 2008 7,635 20096.0 EP4(Unicode) 41,800 20,900 06-Mar-12 Fujitsu PRIMERGY RX300 S7 2xIntel Xeon E5-2690 @2.90GHz 128 GB Windows Server 2008 R2 EE SQL Server 2008 7,570 20096.0 EP4(Unicode) 41,320 20,660 06-Mar-12 Complete benchmark results may be found at the SAP benchmark website http://www.sap.com/benchmark. Configuration and Results Summary Hardware Configuration: Sun Fire X4270 M3 2 x 2.90 GHz Intel Xeon E5-2690 processors 128 GB memory Sun StorageTek 6540 with 4 * 16 * 300GB 15Krpm 4Gb FC-AL Software Configuration: Oracle Solaris 10 Oracle Database 11g SAP enhancement package 4 for SAP ERP 6.0 (Unicode) Certified Results (published by SAP): Number of benchmark users: 8,320 Average dialog response time: 0.95 seconds Throughput: Fully processed order line: 911,330 Dialog steps/hour: 2,734,000 SAPS: 45,570 SAP Certification: 2012014 Benchmark Description The SAP Standard Application SD (Sales and Distribution) Benchmark is a two-tier ERP business test that is indicative of full business workloads of complete order processing and invoice processing, and demonstrates the ability to run both the application and database software on a single system. The SAP Standard Application SD Benchmark represents the critical tasks performed in real-world ERP business environments. SAP is one of the premier world-wide ERP application providers, and maintains a suite of benchmark tests to demonstrate the performance of competitive systems on the various SAP products. See Also SAP Benchmark Website Sun Fire X4270 M3 Server oracle.com OTN Oracle Solaris oracle.com OTN Oracle Database 11g Release 2 Enterprise Edition oracle.com OTN Disclosure Statement Two-tier SAP Sales and Distribution (SD) standard SAP SD benchmark based on SAP enhancement package 4 for SAP ERP 6.0 (Unicode) application benchmark as of 04/11/12: Sun Fire X4270 M3 (2 processors, 16 cores, 32 threads) 8,320 SAP SD Users, 2 x 2.90 GHz Intel Xeon E5-2690, 128 GB memory, Oracle 11g, Solaris 10, Cert# 2012014. IBM Flex System x240 (2 processors, 16 cores, 32 threads) 7,960 SAP SD Users, 2 x 2.90 GHz Intel Xeon E5-2690, 128 GB memory, DB2 9.7, Windows Server 2008 R2 EE, Cert# 2012016. IBM System x3650 M4 (2 processors, 16 cores, 32 threads) 7,855 SAP SD Users, 2 x 2.90 GHz Intel Xeon E5-2690, 128 GB memory, DB2 9.7, Windows Server 2008 R2 EE, Cert# 2012010. Cisco UCS C240 M3 (2 processors, 16 cores, 32 threads) 7,635 SAP SD Users, 2 x 2.90 GHz Intel Xeon E5-2690, 128 GB memory, SQL Server 2008, Windows Server 2008 R2 DE, Cert# 2012011. Fujitsu PRIMERGY RX300 S7 (2 processors, 16 cores, 32 threads) 7,570 SAP SD Users, 2 x 2.90 GHz Intel Xeon E5-2690, 128 GB memory, SQL Server 2008, Windows Server 2008 R2 EE, Cert# 2012008. HP ProLiant DL380p Gen8 (2 processors, 16 cores, 32 threads) 7,865 SAP SD Users, 2 x 2.90 GHz Intel Xeon E5-2690, 128 GB memory, SQL Server 2008, Windows Server 2008 R2 EE, Cert# 2012012. SAP, R/3, reg TM of SAP AG in Germany and other countries. More info www.sap.com/benchmark

    Read the article

  • Is current SATA 6 gb/s equipment simply unreliable?

    - by korkman
    I have a 45-disk array of Seagate Barracuda 3 TB ST3000DM001 (yes these are desktop drives I'm aware of that) in a Supermicro sc847 JBOD, connected via LSI 9285. I have found a solution for the problem description below by reducing speed via MegaCli -PhySetLinkSpeed -phy0 2 -a0; for i in $(seq 48); do MegaCli -PhySetLinkSpeed -phy${i} 2 -a0; done and rebooting. The question remains: Is this typical for current 6 gb/s equipment? Is this the sad state of SATA storage? Or is some of my equipment (the sff-8088 cables come to mind) bad? The Problem was: Synchronizing HW RAID-6, disks kept offlining. Fetching SMART values reveiled that those which offlined did not increase powered-on hours anymore. That is, their firmware (CC4C) seems to crash. Digging into the matter by switching to Software RAID-6, with the disks passed-through, I got tons of kernel messages scattered across all disks, with 6 gb/s: sd 0:0:9:0: [sdb] Sense Key : No Sense [current] Info fld=0x0 sd 0:0:9:0: [sdb] Add. Sense: No additional sense information And finally, when a disk offlines: megasas: [ 5]waiting for 160 commands to complete ... megasas: [35]waiting for 159 commands to complete ... megasas: [155]waiting for 156 commands to complete ... megaraid_sas: pending commands remain after waiting, will reset adapter. Ugly controller reset here, then minutes later: megaraid_sas: Reset successful. sd 0:0:28:0: Device offlined - not ready after error recovery ... sd 0:0:28:0: [sdu] Unhandled error code sd 0:0:28:0: [sdu] Result: hostbyte=DID_ERROR driverbyte=DRIVER_OK sd 0:0:28:0: [sdu] CDB: Read(10): 28 00 23 21 2f 40 00 00 70 00 sd 0:0:28:0: [sdu] killing request Reduced speed to 3 gb/s like written above, all problems vanished.

    Read the article

  • SPARC T4-4 Beats 8-CPU IBM POWER7 on TPC-H @3000GB Benchmark

    - by Brian
    Oracle's SPARC T4-4 server delivered a world record TPC-H @3000GB benchmark result for systems with four processors. This result beats eight processor results from IBM (POWER7) and HP (x86). The SPARC T4-4 server also delivered better performance per core than these eight processor systems from IBM and HP. Comparisons below are based upon system to system comparisons, highlighting Oracle's complete software and hardware solution. This database world record result used Oracle's Sun Storage 2540-M2 arrays (rotating disk) connected to a SPARC T4-4 server running Oracle Solaris 11 and Oracle Database 11g Release 2 demonstrating the power of Oracle's integrated hardware and software solution. The SPARC T4-4 server based configuration achieved a TPC-H scale factor 3000 world record for four processor systems of 205,792 QphH@3000GB with price/performance of $4.10/QphH@3000GB. The SPARC T4-4 server with four SPARC T4 processors (total of 32 cores) is 7% faster than the IBM Power 780 server with eight POWER7 processors (total of 32 cores) on the TPC-H @3000GB benchmark. The SPARC T4-4 server is 36% better in price performance compared to the IBM Power 780 server on the TPC-H @3000GB Benchmark. The SPARC T4-4 server is 29% faster than the IBM Power 780 for data loading. The SPARC T4-4 server is up to 3.4 times faster than the IBM Power 780 server for the Refresh Function. The SPARC T4-4 server with four SPARC T4 processors is 27% faster than the HP ProLiant DL980 G7 server with eight x86 processors on the TPC-H @3000GB benchmark. The SPARC T4-4 server is 52% faster than the HP ProLiant DL980 G7 server for data loading. The SPARC T4-4 server is up to 3.2 times faster than the HP ProLiant DL980 G7 for the Refresh Function. The SPARC T4-4 server achieved a peak IO rate from the Oracle database of 17 GB/sec. This rate was independent of the storage used, as demonstrated by the TPC-H @3000TB benchmark which used twelve Sun Storage 2540-M2 arrays (rotating disk) and the TPC-H @1000TB benchmark which used four Sun Storage F5100 Flash Array devices (flash storage). [*] The SPARC T4-4 server showed linear scaling from TPC-H @1000GB to TPC-H @3000GB. This demonstrates that the SPARC T4-4 server can handle the increasingly larger databases required of DSS systems. [*] The SPARC T4-4 server benchmark results demonstrate a complete solution of building Decision Support Systems including data loading, business questions and refreshing data. Each phase usually has a time constraint and the SPARC T4-4 server shows superior performance during each phase. [*] The TPC believes that comparisons of results published with different scale factors are misleading and discourages such comparisons. Performance Landscape The table lists the leading TPC-H @3000GB results for non-clustered systems. TPC-H @3000GB, Non-Clustered Systems System Processor P/C/T – Memory Composite(QphH) $/perf($/QphH) Power(QppH) Throughput(QthH) Database Available SPARC Enterprise M9000 3.0 GHz SPARC64 VII+ 64/256/256 – 1024 GB 386,478.3 $18.19 316,835.8 471,428.6 Oracle 11g R2 09/22/11 SPARC T4-4 3.0 GHz SPARC T4 4/32/256 – 1024 GB 205,792.0 $4.10 190,325.1 222,515.9 Oracle 11g R2 05/31/12 SPARC Enterprise M9000 2.88 GHz SPARC64 VII 32/128/256 – 512 GB 198,907.5 $15.27 182,350.7 216,967.7 Oracle 11g R2 12/09/10 IBM Power 780 4.1 GHz POWER7 8/32/128 – 1024 GB 192,001.1 $6.37 210,368.4 175,237.4 Sybase 15.4 11/30/11 HP ProLiant DL980 G7 2.27 GHz Intel Xeon X7560 8/64/128 – 512 GB 162,601.7 $2.68 185,297.7 142,685.6 SQL Server 2008 10/13/10 P/C/T = Processors, Cores, Threads QphH = the Composite Metric (bigger is better) $/QphH = the Price/Performance metric in USD (smaller is better) QppH = the Power Numerical Quantity QthH = the Throughput Numerical Quantity The following table lists data load times and refresh function times during the power run. TPC-H @3000GB, Non-Clustered Systems Database Load & Database Refresh System Processor Data Loading(h:m:s) T4Advan RF1(sec) T4Advan RF2(sec) T4Advan SPARC T4-4 3.0 GHz SPARC T4 04:08:29 1.0x 67.1 1.0x 39.5 1.0x IBM Power 780 4.1 GHz POWER7 05:51:50 1.5x 147.3 2.2x 133.2 3.4x HP ProLiant DL980 G7 2.27 GHz Intel Xeon X7560 08:35:17 2.1x 173.0 2.6x 126.3 3.2x Data Loading = database load time RF1 = power test first refresh transaction RF2 = power test second refresh transaction T4 Advan = the ratio of time to T4 time Complete benchmark results found at the TPC benchmark website http://www.tpc.org. Configuration Summary and Results Hardware Configuration: SPARC T4-4 server 4 x SPARC T4 3.0 GHz processors (total of 32 cores, 128 threads) 1024 GB memory 8 x internal SAS (8 x 300 GB) disk drives External Storage: 12 x Sun Storage 2540-M2 array storage, each with 12 x 15K RPM 300 GB drives, 2 controllers, 2 GB cache Software Configuration: Oracle Solaris 11 11/11 Oracle Database 11g Release 2 Enterprise Edition Audited Results: Database Size: 3000 GB (Scale Factor 3000) TPC-H Composite: 205,792.0 QphH@3000GB Price/performance: $4.10/QphH@3000GB Available: 05/31/2012 Total 3 year Cost: $843,656 TPC-H Power: 190,325.1 TPC-H Throughput: 222,515.9 Database Load Time: 4:08:29 Benchmark Description The TPC-H benchmark is a performance benchmark established by the Transaction Processing Council (TPC) to demonstrate Data Warehousing/Decision Support Systems (DSS). TPC-H measurements are produced for customers to evaluate the performance of various DSS systems. These queries and updates are executed against a standard database under controlled conditions. Performance projections and comparisons between different TPC-H Database sizes (100GB, 300GB, 1000GB, 3000GB, 10000GB, 30000GB and 100000GB) are not allowed by the TPC. TPC-H is a data warehousing-oriented, non-industry-specific benchmark that consists of a large number of complex queries typical of decision support applications. It also includes some insert and delete activity that is intended to simulate loading and purging data from a warehouse. TPC-H measures the combined performance of a particular database manager on a specific computer system. The main performance metric reported by TPC-H is called the TPC-H Composite Query-per-Hour Performance Metric (QphH@SF, where SF is the number of GB of raw data, referred to as the scale factor). QphH@SF is intended to summarize the ability of the system to process queries in both single and multiple user modes. The benchmark requires reporting of price/performance, which is the ratio of the total HW/SW cost plus 3 years maintenance to the QphH. A secondary metric is the storage efficiency, which is the ratio of total configured disk space in GB to the scale factor. Key Points and Best Practices Twelve Sun Storage 2540-M2 arrays were used for the benchmark. Each Sun Storage 2540-M2 array contains 12 15K RPM drives and is connected to a single dual port 8Gb FC HBA using 2 ports. Each Sun Storage 2540-M2 array showed 1.5 GB/sec for sequential read operations and showed linear scaling, achieving 18 GB/sec with twelve Sun Storage 2540-M2 arrays. These were stand alone IO tests. The peak IO rate measured from the Oracle database was 17 GB/sec. Oracle Solaris 11 11/11 required very little system tuning. Some vendors try to make the point that storage ratios are of customer concern. However, storage ratio size has more to do with disk layout and the increasing capacities of disks – so this is not an important metric in which to compare systems. The SPARC T4-4 server and Oracle Solaris efficiently managed the system load of over one thousand Oracle Database parallel processes. Six Sun Storage 2540-M2 arrays were mirrored to another six Sun Storage 2540-M2 arrays on which all of the Oracle database files were placed. IO performance was high and balanced across all the arrays. The TPC-H Refresh Function (RF) simulates periodical refresh portion of Data Warehouse by adding new sales and deleting old sales data. Parallel DML (parallel insert and delete in this case) and database log performance are a key for this function and the SPARC T4-4 server outperformed both the IBM POWER7 server and HP ProLiant DL980 G7 server. (See the RF columns above.) See Also Transaction Processing Performance Council (TPC) Home Page Ideas International Benchmark Page SPARC T4-4 Server oracle.com OTN Oracle Solaris oracle.com OTN Oracle Database 11g Release 2 Enterprise Edition oracle.com OTN Sun Storage 2540-M2 Array oracle.com OTN Disclosure Statement TPC-H, QphH, $/QphH are trademarks of Transaction Processing Performance Council (TPC). For more information, see www.tpc.org. SPARC T4-4 205,792.0 QphH@3000GB, $4.10/QphH@3000GB, available 5/31/12, 4 processors, 32 cores, 256 threads; IBM Power 780 QphH@3000GB, 192,001.1 QphH@3000GB, $6.37/QphH@3000GB, available 11/30/11, 8 processors, 32 cores, 128 threads; HP ProLiant DL980 G7 162,601.7 QphH@3000GB, $2.68/QphH@3000GB available 10/13/10, 8 processors, 64 cores, 128 threads.

    Read the article

  • nm-applet gone?

    - by welp
    nm-applet seems to have disappeared from my system. I am running 12.10. Here's what I get when I check my package manager logs: ? ~ grep network-manager /var/log/dpkg.log 2012-10-06 10:37:08 upgrade network-manager-gnome:amd64 0.9.6.2-0ubuntu5 0.9.6.2-0ubuntu6 2012-10-06 10:37:08 status half-configured network-manager-gnome:amd64 0.9.6.2-0ubuntu5 2012-10-06 10:37:08 status unpacked network-manager-gnome:amd64 0.9.6.2-0ubuntu5 2012-10-06 10:37:08 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu5 2012-10-06 10:37:08 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu5 2012-10-06 10:37:08 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu5 2012-10-06 10:37:08 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu5 2012-10-06 10:37:08 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu5 2012-10-06 10:37:08 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu5 2012-10-06 10:37:08 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu5 2012-10-06 10:37:09 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu5 2012-10-06 10:37:09 status unpacked network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-06 10:37:09 status unpacked network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-06 10:39:50 configure network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-06 10:39:50 status unpacked network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-06 10:39:50 status unpacked network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-06 10:39:50 status half-configured network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-06 10:39:50 status installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-28 22:27:23 status installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-28 22:27:23 remove network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-28 22:27:23 status half-configured network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-28 22:27:23 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-28 22:27:23 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-28 22:27:23 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-28 22:27:23 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-28 22:27:23 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-28 22:27:23 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-28 22:27:23 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-28 22:27:23 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-28 22:27:23 status config-files network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-28 22:27:23 status config-files network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-31 19:58:03 install network-manager-gnome:amd64 0.9.6.2-0ubuntu6 0.9.6.2-0ubuntu6 2012-10-31 19:58:03 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-31 19:58:03 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-31 19:58:03 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-31 19:58:03 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-31 19:58:03 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-31 19:58:03 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-31 19:58:03 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-31 19:58:03 status half-installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-31 19:58:03 status unpacked network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-31 19:58:03 status unpacked network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-31 19:58:06 configure network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-31 19:58:06 status unpacked network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-31 19:58:07 status unpacked network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-31 19:58:07 status half-configured network-manager-gnome:amd64 0.9.6.2-0ubuntu6 2012-10-31 19:58:07 status installed network-manager-gnome:amd64 0.9.6.2-0ubuntu6 ? ~ Unfortunately, I cannot find network-manager-applet package at all: ? ~ apt-cache search network-manager-applet ? ~ Here are the contents of /etc/apt/sources.list: ? ~ cat /etc/apt/sources.list # deb cdrom:[Ubuntu 12.04 LTS _Precise Pangolin_ - Release amd64 (20120425)]/ dists/precise/main/binary-i386/ # deb cdrom:[Ubuntu 12.04 LTS _Precise Pangolin_ - Release amd64 (20120425)]/ dists/precise/restricted/binary-i386/ # deb cdrom:[Ubuntu 12.04 LTS _Precise Pangolin_ - Release amd64 (20120425)]/ precise main restricted # See http://help.ubuntu.com/community/UpgradeNotes for how to upgrade to # newer versions of the distribution. deb http://gb.archive.ubuntu.com/ubuntu/ quantal main restricted deb-src http://gb.archive.ubuntu.com/ubuntu/ quantal main restricted ## Major bug fix updates produced after the final release of the ## distribution. deb http://gb.archive.ubuntu.com/ubuntu/ quantal-updates main restricted deb-src http://gb.archive.ubuntu.com/ubuntu/ quantal-updates main restricted ## N.B. software from this repository is ENTIRELY UNSUPPORTED by the Ubuntu ## team. Also, please note that software in universe WILL NOT receive any ## review or updates from the Ubuntu security team. deb http://gb.archive.ubuntu.com/ubuntu/ quantal universe deb-src http://gb.archive.ubuntu.com/ubuntu/ quantal universe deb http://gb.archive.ubuntu.com/ubuntu/ quantal-updates universe deb-src http://gb.archive.ubuntu.com/ubuntu/ quantal-updates universe ## N.B. software from this repository is ENTIRELY UNSUPPORTED by the Ubuntu ## team, and may not be under a free licence. Please satisfy yourself as to ## your rights to use the software. Also, please note that software in ## multiverse WILL NOT receive any review or updates from the Ubuntu ## security team. deb http://gb.archive.ubuntu.com/ubuntu/ quantal multiverse deb-src http://gb.archive.ubuntu.com/ubuntu/ quantal multiverse deb http://gb.archive.ubuntu.com/ubuntu/ quantal-updates multiverse deb-src http://gb.archive.ubuntu.com/ubuntu/ quantal-updates multiverse ## N.B. software from this repository may not have been tested as ## extensively as that contained in the main release, although it includes ## newer versions of some applications which may provide useful features. ## Also, please note that software in backports WILL NOT receive any review ## or updates from the Ubuntu security team. deb http://gb.archive.ubuntu.com/ubuntu/ quantal-backports main restricted universe multiverse deb-src http://gb.archive.ubuntu.com/ubuntu/ quantal-backports main restricted universe multiverse deb http://security.ubuntu.com/ubuntu quantal-security main restricted deb-src http://security.ubuntu.com/ubuntu quantal-security main restricted deb http://security.ubuntu.com/ubuntu quantal-security universe deb-src http://security.ubuntu.com/ubuntu quantal-security universe deb http://security.ubuntu.com/ubuntu quantal-security multiverse deb-src http://security.ubuntu.com/ubuntu quantal-security multiverse ## Uncomment the following two lines to add software from Canonical's ## 'partner' repository. ## This software is not part of Ubuntu, but is offered by Canonical and the ## respective vendors as a service to Ubuntu users. # deb http://archive.canonical.com/ubuntu precise partner # deb-src http://archive.canonical.com/ubuntu precise partner ## This software is not part of Ubuntu, but is offered by third-party ## developers who want to ship their latest software. deb http://extras.ubuntu.com/ubuntu quantal main deb-src http://extras.ubuntu.com/ubuntu quantal main ? ~ Right now, I can't think of anything else. Happy to provide more info upon request.

    Read the article

  • Mapping of memory addresses to physical modules in Windows XP

    - by Josef Grahn
    I plan to run 32-bit Windows XP on a workstation with dual processors, based on Intel's Nehalem microarchitecture, and triple channel RAM. Even though XP is limited to 4 GB of RAM, my understanding is that it will function with more than 4 GB installed, but will only expose 4 GB (or slightly less). My question is: Assuming that 6 GB of RAM is installed in six 1 GB modules, which physical 4 GB will Windows actually map into its address space? In particular: Will it use all six 1 GB modules, taking advantage of all memory channels? (My guess is yes, and that the mapping to individual modules within a group happens in hardware.) Will it map 2 GB of address space to each of the two NUMA nodes (as each processor has it's own memory interface), or will one processor get fast access to 3 GB of RAM, while the other only has 1 GB? Thanks!

    Read the article

  • EFI - GPT dual-boot quantal AMD64 - impossible boot windows 7

    - by Matt
    I tried to install Ubuntu Quantal AM64 on a EFI - GPT notebook (asus X501U) in dualboot. Ubuntu works fine, but i can't boot windows anymore. HDD is partitioned in this way: sda1 0.2 Gb boot efi sda2 0.128 Gb sda3 60 Gb Windows sda4 210 Gb Data sda5 15 Gb Ubuntu sda6 4 Gb swap sda7 25 Gb recovery image Booting pc, grub2 runs, but if i try to select "windows 7 loader on sda3" i receive this message: "error: invalid EFI file path." If i select "windows recovery Environment on sda7" i receive: "error: impossible find command "drivemap" - error: invalid EFI file path." I installed dualboot ubuntu many times, but this is the first time on a EFI - GPT system.

    Read the article

  • Grub - multiple distros

    - by kveidem
    I had Ubuntu 12.04 BETA installed on my entire HD. Then I decided to also install Linux Mint Debian Edition 121204 (LMDE). With gparted I shrunk my /home to make room for one more distro I created the partitions needed for LMDE, but figured I could use the same swap I installed LMDE - no errors. During install I selected to install GRUB to /dev/sda Grub shows Linux Mint Debian Edition, but no sign of Ubuntu The new LMDE install will not boot I can use LMDE from USB stick, which is what I use right now My Ubuntu /home has data that is not backed up (must recover) If I can boot back into Ubuntu to back up I am OK again. Please help. From gparted (sda8 and sda9 is the new ones after shrinking sda7) /dev/sda1 ext4 20 GB Flags: boot /dev/sda2 extended 912 GB dev/sda5 ext4 20 GB dev/sda6 linux-swap 4 GB dev/sda7 ext4 585 GB dev/sda8 ext4 20 GB dev/sda9 ext4 285 GB

    Read the article

  • 0.00006103515625 GB of RAM. Is .NET MicroFramework part of Windows CE?

    - by Rocket Surgeon
    The .NET MicroFramework claims to work on 64K RAM and has list of compatible targets vendors. At the same time, same vendors who ship hardware and create Board Support Packages (vendors like Adeneo) keep releasing something named Windows 7 CE BSP for the same hardware targets. Obviously the OS as heavy as WinCE needs more than 64K RAM. So, somehow .NET MicroFramework is relevant to WinCE, but how ? Is it part of bigger OS or is it base of it, or are both mutually exclusive ? Background: 0.00006103515625 GByte of RAM is same as 64Kbyte of RAM. I am looking for possiblity to use Microsoft development tools for small target like BeagleBone. http://www.adeneo-embedded.com/About-Us/News/Release-of-TI-BeagleBone Nice. Now .. where is a MicroFramework for the same beaglebone ? Is it inside the released pile ?

    Read the article

  • Can't Remove Logical Drive/Array from HP P400

    - by Myles
    This is my first post here. Thank you in advance for any assistance with this matter. I'm trying to remove a logical drive (logical drive 2) and an array (array "B") from my Smart Array P400. The host is a DL580 G5 running 64-bit Red Hat Enterprise Linux Server release 5.7 (Tikanga). I am unable to remove the array using either hpacucli or cpqacuxe. I believe it is because of "OS Status: LOCKED". The file system that lives on this array has been unmounted. I do not want to reboot the host. Is there some way to "release" this logical drive so I can remove the array? Note that I do not need to preserve the data on logical drive 2. I intend to physically remove the drives from the machine and replace them with larger drives. I'm using the cciss kernel module that ships with Red Hat 5.7. Here is some information pertaining to the host and the P400 configuration: [root@gort ~]# cat /etc/redhat-release Red Hat Enterprise Linux Server release 5.7 (Tikanga) [root@gort ~]# uname -a Linux gort 2.6.18-274.el5 #1 SMP Fri Jul 8 17:36:59 EDT 2011 x86_64 x86_64 x86_64 GNU/Linux [root@gort ~]# rpm -qa | egrep '^(hp|cpq)' cpqacuxe-9.30-15.0 hp-health-9.25-1551.7.rhel5 hpsmh-7.1.2-3 hpdiags-9.3.0-466 hponcfg-3.1.0-0 hp-snmp-agents-9.25-2384.8.rhel5 hpacucli-9.30-15.0 [root@gort ~]# hpacucli HP Array Configuration Utility CLI 9.30.15.0 Detecting Controllers...Done. Type "help" for a list of supported commands. Type "exit" to close the console. => ctrl all show config detail Smart Array P400 in Slot 0 (Embedded) Bus Interface: PCI Slot: 0 Cache Serial Number: PA82C0J9SVW34U RAID 6 (ADG) Status: Enabled Controller Status: OK Hardware Revision: D Firmware Version: 7.22 Rebuild Priority: Medium Expand Priority: Medium Surface Scan Delay: 15 secs Surface Scan Mode: Idle Wait for Cache Room: Disabled Surface Analysis Inconsistency Notification: Disabled Post Prompt Timeout: 0 secs Cache Board Present: True Cache Status: OK Cache Ratio: 25% Read / 75% Write Drive Write Cache: Disabled Total Cache Size: 256 MB Total Cache Memory Available: 208 MB No-Battery Write Cache: Disabled Cache Backup Power Source: Batteries Battery/Capacitor Count: 1 Battery/Capacitor Status: OK SATA NCQ Supported: True Logical Drive: 1 Size: 136.7 GB Fault Tolerance: RAID 1 Heads: 255 Sectors Per Track: 32 Cylinders: 35132 Strip Size: 128 KB Full Stripe Size: 128 KB Status: OK Caching: Enabled Unique Identifier: 600508B100184A395356573334550002 Disk Name: /dev/cciss/c0d0 Mount Points: /boot 101 MB, /tmp 7.8 GB, /usr 3.9 GB, /usr/local 2.0 GB, /var 3.9 GB, / 2.0 GB, /local 113.2 GB OS Status: LOCKED Logical Drive Label: A0027AA78DEE Mirror Group 0: physicaldrive 1I:1:2 (port 1I:box 1:bay 2, SAS, 146 GB, OK) Mirror Group 1: physicaldrive 1I:1:1 (port 1I:box 1:bay 1, SAS, 146 GB, OK) Drive Type: Data Array: A Interface Type: SAS Unused Space: 0 MB Status: OK Array Type: Data physicaldrive 1I:1:1 Port: 1I Box: 1 Bay: 1 Status: OK Drive Type: Data Drive Interface Type: SAS Size: 146 GB Rotational Speed: 10000 Firmware Revision: HPDE Serial Number: 3NM57RF40000983878FX Model: HP DG146BB976 Current Temperature (C): 29 Maximum Temperature (C): 35 PHY Count: 2 PHY Transfer Rate: Unknown, Unknown physicaldrive 1I:1:2 Port: 1I Box: 1 Bay: 2 Status: OK Drive Type: Data Drive Interface Type: SAS Size: 146 GB Rotational Speed: 10000 Firmware Revision: HPDE Serial Number: 3NM55VQC000098388524 Model: HP DG146BB976 Current Temperature (C): 29 Maximum Temperature (C): 36 PHY Count: 2 PHY Transfer Rate: Unknown, Unknown Logical Drive: 2 Size: 546.8 GB Fault Tolerance: RAID 5 Heads: 255 Sectors Per Track: 32 Cylinders: 65535 Strip Size: 64 KB Full Stripe Size: 256 KB Status: OK Caching: Enabled Parity Initialization Status: Initialization Completed Unique Identifier: 600508B100184A395356573334550003 Disk Name: /dev/cciss/c0d1 Mount Points: None OS Status: LOCKED Logical Drive Label: A5C9C6F81504 Drive Type: Data Array: B Interface Type: SAS Unused Space: 0 MB Status: OK Array Type: Data physicaldrive 1I:1:3 Port: 1I Box: 1 Bay: 3 Status: OK Drive Type: Data Drive Interface Type: SAS Size: 146 GB Rotational Speed: 10000 Firmware Revision: HPDE Serial Number: 3NM2H5PE00009802NK19 Model: HP DG146ABAB4 Current Temperature (C): 30 Maximum Temperature (C): 37 PHY Count: 1 PHY Transfer Rate: Unknown physicaldrive 1I:1:4 Port: 1I Box: 1 Bay: 4 Status: OK Drive Type: Data Drive Interface Type: SAS Size: 146 GB Rotational Speed: 10000 Firmware Revision: HPDE Serial Number: 3NM28YY400009750MKPJ Model: HP DG146ABAB4 Current Temperature (C): 31 Maximum Temperature (C): 36 PHY Count: 1 PHY Transfer Rate: 3.0Gbps physicaldrive 2I:1:5 Port: 2I Box: 1 Bay: 5 Status: OK Drive Type: Data Drive Interface Type: SAS Size: 146 GB Rotational Speed: 10000 Firmware Revision: HPDE Serial Number: 3NM2FGYV00009802N3GN Model: HP DG146ABAB4 Current Temperature (C): 30 Maximum Temperature (C): 38 PHY Count: 1 PHY Transfer Rate: Unknown physicaldrive 2I:1:6 Port: 2I Box: 1 Bay: 6 Status: OK Drive Type: Data Drive Interface Type: SAS Size: 146 GB Rotational Speed: 10000 Firmware Revision: HPDE Serial Number: 3NM8AFAK00009920MMV1 Model: HP DG146BB976 Current Temperature (C): 31 Maximum Temperature (C): 41 PHY Count: 2 PHY Transfer Rate: Unknown, Unknown physicaldrive 2I:1:7 Port: 2I Box: 1 Bay: 7 Status: OK Drive Type: Data Drive Interface Type: SAS Size: 146 GB Rotational Speed: 10000 Firmware Revision: HPDE Serial Number: 3NM2FJQD00009801MSHQ Model: HP DG146ABAB4 Current Temperature (C): 29 Maximum Temperature (C): 39 PHY Count: 1 PHY Transfer Rate: Unknown

    Read the article

  • Windows, why 8 GB of RAM feel like a few MB?

    - by Desmond Hume
    I'm on Windows 7 x64 with 4-core Intel i7 and 8 GB of RAM, but lately it feels like my computer's "RAM" is located solely on the hard drive. Here is what the task manager shows: The total amount of memory used by the processes in the list is just about 1 GB. And what is happening on my computer for a few days now is that one program (Cataloger.exe) is continually processing large quantities of (rather big) files, repeatedly opening and reading them for the purposes of cataloging. But it doesn't grow too much in memory and stays about that size, about 90 MB. However, the amount of data it processes in, say, 30 minutes can be measured in gigabytes. So my guess was that Windows file caching has something to do with it. And after some research on the topic, I came across this program, called RamMap, that displays detailed info on a computer's RAM. Here is the screenshot: So to me it looks like Windows keeps in RAM huge amounts of data that is no longer needed, redirecting any RAM allocation requests to the pagefile on the hard drive. Even when I close Cataloger.exe, the RamMap reports the size of the mapped file as about the same for a long time on. And it's not just this particular program. Earlier I noticed that similar slowdown occurred after some massive file operations with other programs. So it's really not an exception. Whatever it is, it slows down the computer by like 50 times. Opening a new tab in Chrome takes 20-30 seconds, opening a new program can take up to a minute. Due to the slowdown, some programs even crash. So what do you think, is the problem hiding in file caching or somewhere else? How do I solve it?

    Read the article

  • I am receiving a message saying I have duplicate sources but I can't seem to find a duplicate of the line described, any ideas?

    - by David Griffiths
    I receive this meassage when I run sudo apt-get update in the terminal:- Duplicate sources.list entry http://archive.canonical.com/ubuntu/ precise/partner i386 Packages (/var/lib/apt/lists/archive.canonical.com_ubuntu_dists_precise_partner_binary-i386_Packages) So i ran the command gksu gedit /etc/apt/sources.list and checked the source to find there was no duplicate, not that I can see anyway. Here is the source:- # deb cdrom:[Ubuntu 12.04 LTS _Precise Pangolin_ - Release i386 (20120423)]/ precise main restricted deb-src http://archive.ubuntu.com/ubuntu precise main restricted #Added by software-properties # See http://help.ubuntu.com/community/UpgradeNotes for how to upgrade to # newer versions of the distribution. deb http://gb.archive.ubuntu.com/ubuntu/ precise main restricted deb-src http://gb.archive.ubuntu.com/ubuntu/ precise restricted main multiverse universe #Added by software-properties ## Major bug fix updates produced after the final release of the ## distribution. deb http://gb.archive.ubuntu.com/ubuntu/ precise-updates main restricted deb-src http://gb.archive.ubuntu.com/ubuntu/ precise-updates restricted main multiverse universe #Added by software-properties ## N.B. software from this repository is ENTIRELY UNSUPPORTED by the Ubuntu ## team. Also, please note that software in universe WILL NOT receive any ## review or updates from the Ubuntu security team. deb http://gb.archive.ubuntu.com/ubuntu/ precise universe deb http://gb.archive.ubuntu.com/ubuntu/ precise-updates universe ## N.B. software from this repository is ENTIRELY UNSUPPORTED by the Ubuntu ## team, and may not be under a free licence. Please satisfy yourself as to ## your rights to use the software. Also, please note that software in ## multiverse WILL NOT receive any review or updates from the Ubuntu ## security team. deb http://gb.archive.ubuntu.com/ubuntu/ precise multiverse deb http://gb.archive.ubuntu.com/ubuntu/ precise-updates multiverse ## N.B. software from this repository may not have been tested as ## extensively as that contained in the main release, although it includes ## newer versions of some applications which may provide useful features. ## Also, please note that software in backports WILL NOT receive any review ## or updates from the Ubuntu security team. deb http://gb.archive.ubuntu.com/ubuntu/ precise-backports main restricted universe multiverse deb-src http://gb.archive.ubuntu.com/ubuntu/ precise-backports main restricted universe multiverse #Added by software-properties deb http://security.ubuntu.com/ubuntu precise-security main restricted deb-src http://security.ubuntu.com/ubuntu precise-security restricted main multiverse universe #Added by software-properties deb http://security.ubuntu.com/ubuntu precise-security universe deb http://security.ubuntu.com/ubuntu precise-security multiverse ## Uncomment the following two lines to add software from Canonical's ## 'partner' repository. ## This software is not part of Ubuntu, but is offered by Canonical and the ## respective vendors as a service to Ubuntu users. deb http://archive.canonical.com/ubuntu precise partner # deb-src http://archive.canonical.com/ubuntu precise partner ## Uncomment the following two lines to add software from Ubuntu's ## 'extras' repository. ## This software is not part of Ubuntu, but is offered by third-party ## developers who want to ship their latest software. # deb http://extras.ubuntu.com/ubuntu precise main # deb-src http://extras.ubuntu.com/ubuntu precise main deb http://repository.spotify.com stable non-free I can see there are two lines of deb http://archive.canonical.com/ubuntu precise partner but one has #deb-src at the beginning of it. Hashed out no? I'm quite new to linux OS and have little to none sourced editing skills so any help would be most appreciated. Thank you:)

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >