Search Results

Search found 19480 results on 780 pages for 'do your own homework'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 50/780 | < Previous Page | 46 47 48 49 50 51 52 53 54 55 56 57  | Next Page >

  • display multiple errors via bool flag c++

    - by igor
    Been a long night, but stuck on this and now am getting "segmentation fault" in my compiler.. Basically I'm trying to display all the errors (the cout) needed. If there is more than one error, I am to display all of them. bool validMove(const Square board[BOARD_SIZE][BOARD_SIZE], int x, int y, int value) { int index; bool moveError = true; const int row_conflict(0), column_conflict(1), grid_conflict(2); int v_subgrid=x/3; int h_subgrid=y/3; getCoords(x,y); for(index=0;index<9;index++) if(board[x][index].number==value){ cout<<"That value is in conflict in this row\n"; moveError=false; } for(index=0;index<9;index++) if(board[index][y].number==value){ cout<<"That value is in conflict in this column\n"; moveError=false; } for(int i=v_subgrid*3;i<(v_subgrid*3 +3);i++){ for(int j=h_subgrid*3;j<(h_subgrid*3+3);j++){ if(board[i][j].number==value){ cout<<"That value is in conflict in this subgrid\n"; moveError=false; } } } return true; }

    Read the article

  • Problem with python class

    - by Tasbeer
    Hi I am new to Python and as a part of my assignment I have written the following class import nltk.stem.api class BanglaStemmer(nltk.stem.api.StemmerI): suffixList = ['\xef\xbb\xbf\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa7\x87\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x8b\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa7\x87\n', '\xe0\xa7\x87\xe0\xa6\x9b\n', '\xe0\xa6\xa4\xe0\xa7\x87\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa7\x87\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa6\x9b\xe0\xa6\xbf\n', '\xe0\xa6\x9b\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\x9b\n', '\xe0\xa6\xa4\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa6\xa4\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xa4\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xac\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa7\x81\xe0\xa6\xa8\n', '\xe0\xa7\x81\xe0\xa6\x95\n', '\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa6\xac\xe0\xa7\x87\n', '\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa6\xac\xe0\xa6\xbf\n', '\xe0\xa6\xa4\xe0\xa6\xbf\n', '\xe0\xa6\xb2\n', '\xe0\xa6\xa4\n', '\xe0\xa7\x8b\n', '\xe0\xa6\xbf\n', '\xe0\xa7\x87\n', '\xe0\xa7\x8d\n', '\xe0\xa6\x87\n', '\xe0\xa6\xac\n', '\xe0\xa6\xb8\n', '\xe0\xa6\xa8\n', '\xe0\xa6\x95\n', '\xe0\xa6\x93\n', '\xe0\xa7\x9f\n'] def stem(self,token): for suffix in suffixList: if token.endswith(suffix): return token[:-len(suffix)] return token The problem is that when I try to compile run it by creating an instance and calling the stem() function with a parameter , it says that the suffixList is not defined. Couldn't figure out what's the problem. Is there a different way in which the class variables have to be declared ? please help

    Read the article

  • from loop to Nested loops ?

    - by WM
    I have this program that returns a factorial of N. For example, when entering 4,,, it will give 1! , 2! , 3! How could I convert this to use nested loops? public class OneForLoop { public static void main(String[] args) { Scanner input = new Scanner(System.in); System.out.print("Enter a number : "); int N = input.nextInt(); int factorial = 1; for(int i = 1; i < N; i++) { factorial *= i; System.out.println(i + "! = " + factorial); } } }

    Read the article

  • Need help with basic optimization problem

    - by ??iu
    I know little of optimization problems, so hopefully this will be didactic for me: rotors = [1, 2, 3, 4...] widgets = ['a', 'b', 'c', 'd' ...] assert len(rotors) == len(widgets) part_values = [ (1, 'a', 34), (1, 'b', 26), (1, 'c', 11), (1, 'd', 8), (2, 'a', 5), (2, 'b', 17), .... ] Given a fixed number of widgets and a fixed number of rotors, how can you get a series of widget-rotor pairs that maximizes the total value where each widget and rotor can only be used once?

    Read the article

  • Spinning a circle in J2ME using a Canvas.

    - by JohnQPublic
    Hello all! I have a problem where I need to make a multi-colored wheel spin using a Canvas in J2ME. What I need to do is have the user increase the speed of the spin or slow the spin of the wheel. I have it mostly worked out (I think) but can't think of a way for the wheel to spin without causing my cellphone to crash. Here is what I have so far, it's close but not exactly what I need. class MyCanvas extends Canvas{ //wedgeOne/Two/Three define where this particular section of circle begins to be drawn from int wedgeOne; int wedgeTwo; int wedgeThree; int spinSpeed; MyCanvas(){ wedgeOne = 0; wedgeTwo = 120; wedgeThree = 240; spinSpeed = 0; } //Using the paint method to public void paint(Graphics g){ //Redraw the circle with the current wedge series. g.setColor(255,0,0); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeOne, 120); g.setColor(0,255,0); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeTwo, 120); g.setColor(0,0,255); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeThree, 120); } protected void keyPressed(int keyCode){ switch (keyCode){ //When the 6 button is pressed, the wheel spins forward 5 degrees. case KEY_NUM6: wedgeOne += 5; wedgeTwo += 5; wedgeThree += 5; repaint(); break; //When the 4 button is pressed, the wheel spins backwards 5 degrees. case KEY_NUM4: wedgeOne -= 5; wedgeTwo -= 5; wedgeThree -= 5; repaint(); } } I have tried using a redraw() method that adds the spinSpeed to each of the wedge values while(spinSpeed0) and calls the repaint() method after the addition, but it causes a crash and lockup (I assume due to an infinite loop). Does anyone have any tips or ideas how I could automate the spin so you do not have the press the button every time you want it to spin? (P.S - I have been lurking for a while, but this is my first post. If it's too general or asking for too much info (sorry if it is) and I either remove it or fix it. Thank you!)

    Read the article

  • how to fix protocol violation in c#

    - by Jeremy Styers
    I have a c# "client" and a Java "server". The java server has a wsdl it serves to the client. So far it works for c# to make a request for the server to perform a soap action. My server gets the soap request executes the method and tries to return the result back to the client. When I send the response to c# however, I get "The server committed a protocol violation. Section=ResponseStatusLine". I have spent all day trying to fix this and have come up with nothing that works. If I explain what i did, this post would be very long, so I'll keep it brief. i Googled for hours and everything tells me my "response line" is correct. I tried shutting down Skype, rearranging the response line, adding things, taking things away, etc, etc. All to no avail. This is for a class assignment so no, I can not use apis to help. I must do everything manually on the server side. That means parsing by hand, creating the soap response and the http response by hand. Just thought you'd like to know that before you say to use something that does it for me. I even tried making sure my server was sending the correct header by creating a java client that "mimicked" the c# one so I could see what the server returned. However, it's returning exactly what i told it to send. I tried telling my java client to do the same thing but to an actuall running c# service, to see what a real service returns, and it returned basically the same thing. To be safe, I copied it's response and tried sending it to the c# client and it still threw the error. Can anyone help? I've tried all i can think of, including adding the useUnsafeHeaderParsing to my app config. Nothing is working though. I send it exactly what a real service sends it and it yells at me. I send it what i want and it yells. I'm sending this: "200 OK HTTP/1.0\r\n" + "Content-Length: 201\r\n" + "Cache-Control: private\r\n" + "Content-Type: text/xml; charset=utf-8\r\n\r\n";

    Read the article

  • toString() Method question

    - by cdominguez13
    I've been working on this assignemnt here's code: public class Student { private String fname; private String lname; private String studentId; private double gpa; public Student(String studentFname,String studentLname,String stuId,double studentGpa) { fname = studentFname; lname = studentLname; studentId = stuId; gpa = studentGpa; } public double getGpa() { return gpa; } public String getStudentId() { return studentId; } public String getName() { return lname + ", " + fname; } public void setGpa(double gpaReplacement) { if (gpaReplacement >= 0.0 && gpaReplacement <= 4.0) gpa = gpaReplacement; else System.out.println("Invalid GPA! Please try again."); System.exit(0); } } Now I need to create a toString() method that returns a String formatted something like this: Name: Wilson, Mary Ann ID number: 12345 GPA: 3.5

    Read the article

  • fprintf() within a subprogram

    - by sergio
    Im stuck when trying to write to my file within my subprogram. void new_page(float *a, float *b, float *c, int *d){ fprintf(results,"\nPage Totals: %f\t%f\t%f\t%d", *a,*b,*c,*d); } I get a warning saying "Warning: incompatible implicit declaration of built-in function 'fprinf' [enabled by default]" "error: 'results' undeclared (first use in this function)" in main fprintf works fine, its just when it comes to the subprogram/function it wont work. from my understanding it thinks that results is undeclared, so do i have to pass the name or location of the file to make it work?

    Read the article

  • VB.net Network Graph code/algorithm

    - by Jens
    For a school project we need to visualise a computer network graph. The number of computers with specific properties are read from an XML file, and then a graph should be created. Ad random computers are added and removed. Is there any open source project or algorithm that could help us visualising this in VB.net? Or would you suggest us to switch to java. Update: We eventually switched java and used the Jung libraries because this was easier for us to understand and implement.

    Read the article

  • Getter/Setter (composition, Java, HW)

    - by Crystal
    I have one class called Person that basically looks like: public class Person { String firstName; String lastName; String telephone; String email; public Person() { firstName = ""; lastName = ""; telephone = ""; email = ""; } public Person(String firstName, String lastName, String telephone, String email) { this.firstName = firstName; this.lastName = lastName; this.telephone = telephone; this.email = email; } public String getFirstName() { return firstName; } public void setFirstName(String firstName) { this.firstName = firstName; } .... Using that class, I setup an abstract class called Loan that looks like: public abstract class Loan { public void setClient(Person client) { this.client = client; } public Person getClient() { return client; } public void setLoanId(int nextId) { loanId = nextId; nextId++; } public int getLoanId() { return loanId; } public void setInterestRate(double interestRate) { this.interestRate = interestRate; } public double getInterestRate() { return interestRate; } public void setLoanLength(int loanLength) { this.loanLength = loanLength; } public int getLoanLength() { return loanLength; } public void setLoanAmount(double loanAmount) { this.loanAmount = loanAmount; } public double getLoanAmount(double loanAmount) { return loanAmount; } private Person client; private int loanId; private double interestRate; private int loanLength; private double loanAmount; private static int nextId = 1; } I have to extend the Loan class with CarLoan and it looks like: public class CarLoan extends Loan { public CarLoan(Person client, double vehiclePrice, double downPayment, double salesTax, double interestRate, CAR_LOAN_TERMS length) { super.setClient(client); super.setInterestRate(interestRate); this.client = client; this.vehiclePrice = vehiclePrice; this.downPayment = downPayment; this.salesTax = salesTax; this.length = length; } public void setVehiclePrice(double vehiclePrice) { this.vehiclePrice = vehiclePrice; } public double getVehiclePrice() { return vehiclePrice; } public void setDownPayment(double downPayment) { this.downPayment = downPayment; } public double getDownPayment() { return downPayment; } public void setSalesTax(double salesTax) { this.salesTax = salesTax; } public double getSalesTax() { return salesTax; } public String toString() { return getClass().getName() + "[vehiclePrice = " + vehiclePrice + '\n' + "downPayment = " + downPayment + '\n' + "salesTax = " + salesTax + "]"; } public enum CAR_LOAN_TERMS {TWO_YEAR, THREE_YEAR, SIX_YEAR}; private double vehiclePrice; private double downPayment; private double salesTax; Few questions. (a) Is what I did in the Loan class to setClient correct given what I have in the Person class? (e.g.this.client = client) (b) Can I call super twice in a method? I have to set two attributes from the Loan class from the constructor in the CarLoan class and I thought that would be a way to do it. (c) Do you have to set attributes for enumeration types differently in a constructor or getter/setter methods? I get an error for (this.length = length) in my CarLoan class and I was unsure of how enumeration values should be set. Thanks!

    Read the article

  • Sum of even fibonacci numbers

    - by user300484
    This is a Project Euler problem. If you don't want to see candidate solutions don't look here. Hello you all! im developping an application that will find the sum of all even terms of the fibonacci sequence. The last term of this sequence is 4,000,000 . There is something wrong in my code but I cannot find the problem since it makes sense to me. Can you please help me? using System.Collections.Generic; using System.Linq; using System.Text; namespace ConsoleApplication1 { class Program { static void Main(string[] args) { long[] arr = new long [1000000] ; long i= 2; arr[i-2]=1; arr[i-1]=2; long n= arr[i]; long s=0; for (i=2 ; n <= 4000000; i++) { arr[i] = arr[(i - 1)] + arr[(i - 2)]; } for (long f = 0; f <= arr.Length - 1; f++) { if (arr[f] % 2 == 0) s += arr[f]; } Console.Write(s); Console.Read(); } } }

    Read the article

  • Termite colony simulator using java

    - by ashii
    hi everyone, i hve to design a simulator that will maintain an environment, which consists of a collection of patches arranged in a rectangular grid of arbitrary size. Each patch contains zero or more wood chips. A patch may be occupied by one or more termites or predators, which are mobile entities that live within the world and behave according to simple rules. A TERMITE can pick up a wood chip from the patch that it is currently on, or drop a wood chip that it is carrying. Termites travel around the grid by moving randomly from their current patch to a neighbouring patch, in one of four possible directions. New termites may hatch from eggs, and this is simulated by the appearance of a new termite at a random patch within the environment. A PREDATOR moves in a similar way to termites, and if a predator moves onto a patch that is occupied by a termite, then the predator eats the termite. At initialization, the termites, predators, and wood chips are distributed randomly in the environment. Simulation then proceeds in a loop, and the new state of the environment is obtained at each iteration. i have designed the arena using jpanel but im not able to randomnly place wood,termite and predator in that arena. can any one help me out?? my code for the arena is as following: 01 import java.awt.*; 02 import javax.swing.*; 03 04 public class Arena extends JPanel 05 { 06 private static final int Rows = 8; 07 private static final int Cols = 8; 08 public void paint(Graphics g) 09 { 10 Dimension d = this.getSize(); 11 // don't draw both sets of squares, when you can draw one 12 // fill in the entire thing with one color 13 g.setColor(Color.WHITE); 14 // make the background 15 g.fillRect(0,0,d.width,d.height); 16 // draw only black 17 g.setColor(Color.BLACK); 18 // pick a square size based on the smallest dimension 19 int sqsize = ((d.width<d.height) ? d.width/Cols : d.height/Rows); 20 // loop for rows 21 for (int row=0; row<Rows; row++) 22 { 23 int y = row*sqsize; // y stays same for entire row, set here 24 int x = (row%2)*sqsize; // x starts at 0 or one square in 25 for (int i=0; i<Cols/2; i++) 26 { 27 // you will only be drawing half the squares per row 28 // draw square 29 g.fillRect(x,y,sqsize,sqsize); 30 // move two square sizes over 31 x += sqsize*2; 32 } 33 } 34 35 } 36 37 38 39 public void update(Graphics g) { paint(g); } 40 41 42 43 public static void main (String[] args) 44 { 45 46 JFrame frame = new JFrame("Arena"); 47 frame.setSize(600,400); 48 frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); 49 frame.setContentPane(new Arena()); 50 frame.setVisible(true); 51 } 52 53 }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • plane bombing problems- help

    - by peiska
    I'm training code problems, and on this one I am having problems to solve it, can you give me some tips how to solve it please. The problem is something like this: Your task is to find the sequence of points on the map that the bomber is expected to travel such that it hits all vital links. A link from A to B is vital when its absence isolates completely A from B. In other words, the only way to go from A to B (or vice versa) is via that link. Notice that if we destroy for example link (d,e), it becomes impossible to go from d to e,m,l or n in any way. A vital link can be hit at any point that lies in its segment (e.g. a hit close to d is as valid as a hit close to e). Of course, only one hit is enough to neutralize a vital link. Moreover, each bomb affects an exact circle of radius R, i.e., every segment that intersects that circle is considered hit. Due to enemy counter-attack, the plane may have to retreat at any moment, so the plane should follow, at each moment, to the closest vital link possible, even if in the end the total distance grows larger. Given all coordinates (the initial position of the plane and the nodes in the map) and the range R, you have to determine the sequence of positions in which the plane has to drop bombs. This sequence should start (takeoff) and finish (landing) at the initial position. Except for the start and finish, all the other positions have to fall exactly in a segment of the map (i.e. it should correspond to a point in a non-hit vital link segment). The coordinate system used will be UTM (Universal Transverse Mercator) northing and easting, which basically corresponds to a Euclidian perspective of the world (X=Easting; Y=Northing). Input Each input file will start with three floating point numbers indicating the X0 and Y0 coordinates of the airport and the range R. The second line contains an integer, N, indicating the number of nodes in the road network graph. Then, the next N (<10000) lines will each contain a pair of floating point numbers indicating the Xi and Yi coordinates (1 No two links will ever cross with each other. Output The program will print the sequence of coordinates (pairs of floating point numbers with exactly one decimal place), each one at a line, in the order that the plane should visit (starting and ending in the airport). Sample input 1 102.3 553.9 0.2 14 342.2 832.5 596.2 638.5 479.7 991.3 720.4 874.8 744.3 1284.1 1294.6 924.2 1467.5 659.6 1802.6 659.6 1686.2 860.7 1548.6 1111.2 1834.4 1054.8 564.4 1442.8 850.1 1460.5 1294.6 1485.1 17 1 2 1 3 2 4 3 4 4 5 4 6 6 7 7 8 8 9 8 10 9 10 10 11 6 11 5 12 5 13 12 13 13 14 Sample output 1 102.3 553.9 720.4 874.8 850.1 1460.5 102.3 553.9

    Read the article

  • java programming

    - by Baiba
    ok i have version of t code, please tell me what i need to do when i need to get out of program The INDEX NUMBER OF COLUMN IN WHICH ARE LEAST ZEROS? class Uzd{ public static void main(String args[]){ int mas[][]= {{3,4,7,5,0}, {4,5,3,0,1}, {8,2,4,0,3}, {7,0,2,0,1}, {0,0,1,3,0}}; int nul_mas[] = new int[5]; int nul=0; for(int j=0;j<5;j++){// nul=0; for(int i=0;i<5;i++){ if(mas[i][j]==0){ nul++; } } nul_mas[j]=nul; } for(int i=0;i<5;i++){ for(int j=0;j<5;j++){ System.out.print(mas[i][j]); } System.out.println(); } System.out.println();// atstarpe System.out.println("///zeros in each column///"); for(int i=0;i<5;i++){System.out.print(nul_mas[i]);} System.out.println(); }} and after running it shows: 34750 45301 82403 70201 00130 ///zeros in each column/// But i need not in each column but i need to get out index of column in which zeros are least! in this situation it is column nubmer 2!! 12032

    Read the article

  • Sorting arrays in java

    - by user360706
    Write a static method in Java : public static void sortByFour (int[] arr) That receives as a paramater an array full of non-negative numbers (zero or positive) and sorts the array in the following way : In the beginning of the array all the numbers that devide by four without a remainder will appear. After them all the numbers in the array that devide by 4 with a remainder of 1 will appear. After them all the numbers in the array that devide by 4 with a remainder of 2 will appear. In the end of the array all the rest numbers (those who divide by 4 with the remainder 3) will appear. (The order of the numbers in each group doesn't matter) The method must be the most efficient it can. This is what I wrote but unfortunately it doesn't work well... :( public static void swap( int[] arr, int left, int right ) { int temp = arr[left]; arr[left] = arr[right]; arr[right] = temp; } public static void sortByFour( int[] arr ) { int left = 0; int right = ( arr.length - 1 ); int mid = ( arr.length / 2 ); while ( left < right ) { if ( ( arr[left] % 4 ) > ( arr[right] % 4 ) ) { swap( arr, left, right ); right--; } if ( ( arr[left] % 4 ) == ( arr[right] % 4 ) ) left++; else left++; } } Can someone please help me by fixing my code so that it will work well or rewriting it?

    Read the article

  • How do you determine using stat() whether a file is a symbolic link?

    - by hora
    I basically have to write a clone of the UNIX ls command for a class, and I've got almost everything working. One thing I can't seem to figure out how to do is check whether a file is a symbolic link or not. From the man page for stat(), I see that there is a mode_t value defined, S_IFLNK. This is how I'm trying to check whether a file is a sym-link, with no luck (note, stbuf is the buffer that stat() returned the inode data into): switch(stbuf.st_mode & S_IFMT){ case S_IFLNK: printf("this is a link\n"); break; case S_IFREG: printf("this is not a link\n"); break; } My code ALWAYS prints this is not a link even if it is, and I know for a fact that the said file is a symbolic link since the actual ls command says so, plus I created the sym-link... Can anyone spot what I may be doing wrong? Thanks for the help!

    Read the article

  • Passing an array of structs in C

    - by lelouch
    I'm having trouble passing an array of structs to a function in C. I've created the struct like this in main: int main() { struct Items { char code[10]; char description[30]; int stock; }; struct Items MyItems[10]; } I then access it like: MyItems[0].stock = 10; etc. I want to pass it to a function like so: ReadFile(MyItems); The function should read the array, and be able to edit it. Then I should be able to access the same array from other functions. I've tried heaps of declarations but none of them work. e.g. void ReadFile(struct Items[10]) I've had a look around for other questions, but the thing is they're all done different, with typedefs and asterisks. My teacher hasn't taught us pointers yet, so I'd like to do it with what I know. Any ideas? :S EDIT: Salvatore's answer is working after I fixed my prototype to: void ReadFile(struct Items[9]);

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 46 47 48 49 50 51 52 53 54 55 56 57  | Next Page >