Search Results

Search found 19480 results on 780 pages for 'do your own homework'.

Page 52/780 | < Previous Page | 48 49 50 51 52 53 54 55 56 57 58 59  | Next Page >

  • Creating ActionEvent object for CustomButton in Java

    - by Crystal
    For a hw assignment, we were supposed to create a custom button to get familiar with swing and responding to events. We were also to make this button an event source which confuses me. I have an ArrayList to keep track of listeners that would register to listen to my CustomButton. What I am getting confused on is how to notify the listeners. My teacher hinted at having a notify and overriding actionPerformed which I tried doing, but then I wasn't sure how to create an ActionEvent object looking at the constructor documentation. The source, id, string all confuses me. Any help would be appreciated. Thanks! code: import java.awt.*; import java.awt.event.*; import javax.swing.*; import java.util.List; import java.util.ArrayList; public class CustomButton { public static void main(String[] args) { EventQueue.invokeLater(new Runnable() { public void run() { CustomButtonFrame frame = new CustomButtonFrame(); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.setVisible(true); } }); } public void addActionListener(ActionListener al) { listenerList.add(al); } public void removeActionListener(ActionListener al) { listenerList.remove(al); } public void actionPerformed(ActionEvent e) { System.out.println("Button Clicked!"); } private void notifyListeners() { ActionEvent event = new ActionEvent(CONFUSED HERE!!!!; for (ActionListener action : listenerList) { action.actionPerfomed(event); } } List<ActionListener> listenerList = new ArrayList<ActionListener>(); } class CustomButtonFrame extends JFrame { // constructor for CustomButtonFrame public CustomButtonFrame() { setTitle("Custom Button"); CustomButtonSetup buttonSetup = new CustomButtonSetup(); this.add(buttonSetup); this.pack(); } } class CustomButtonSetup extends JComponent { public CustomButtonSetup() { ButtonAction buttonClicked = new ButtonAction(); this.addMouseListener(buttonClicked); } // because frame includes borders and insets, use this method public Dimension getPreferredSize() { return new Dimension(200, 200); } public void paintComponent(Graphics g) { Graphics2D g2 = (Graphics2D) g; // first triangle coords int x[] = new int[TRIANGLE_SIDES]; int y[] = new int[TRIANGLE_SIDES]; x[0] = 0; y[0] = 0; x[1] = 200; y[1] = 0; x[2] = 0; y[2] = 200; Polygon firstTriangle = new Polygon(x, y, TRIANGLE_SIDES); // second triangle coords x[0] = 0; y[0] = 200; x[1] = 200; y[1] = 200; x[2] = 200; y[2] = 0; Polygon secondTriangle = new Polygon(x, y, TRIANGLE_SIDES); g2.drawPolygon(firstTriangle); g2.setColor(firstColor); g2.fillPolygon(firstTriangle); g2.drawPolygon(secondTriangle); g2.setColor(secondColor); g2.fillPolygon(secondTriangle); // draw rectangle 10 pixels off border int s1[] = new int[RECT_SIDES]; int s2[] = new int[RECT_SIDES]; s1[0] = 5; s2[0] = 5; s1[1] = 195; s2[1] = 5; s1[2] = 195; s2[2] = 195; s1[3] = 5; s2[3] = 195; Polygon rectangle = new Polygon(s1, s2, RECT_SIDES); g2.drawPolygon(rectangle); g2.setColor(thirdColor); g2.fillPolygon(rectangle); } private class ButtonAction implements MouseListener { public void mousePressed(MouseEvent e) { System.out.println("Click!"); firstColor = Color.GRAY; secondColor = Color.WHITE; repaint(); } public void mouseReleased(MouseEvent e) { System.out.println("Released!"); firstColor = Color.WHITE; secondColor = Color.GRAY; repaint(); } public void mouseEntered(MouseEvent e) {} public void mouseExited(MouseEvent e) {} public void mouseClicked(MouseEvent e) {} } public static final int TRIANGLE_SIDES = 3; public static final int RECT_SIDES = 4; private Color firstColor = Color.WHITE; private Color secondColor = Color.DARK_GRAY; private Color thirdColor = Color.LIGHT_GRAY; }

    Read the article

  • Decrypt PHP encrypted string in C#

    - by NotDan
    I have a string encrypted in PHP that I would like to decrypt in C#. I used the tutorial below to do the encryption, but am having problems decrypting. Can anyone post an example on how to do this? http://www.sanity-free.org/131/triple_des_between_php_and_csharp.html

    Read the article

  • What data stucture should I use for BigInt class

    - by user1086004
    I would like to implement a BigInt class which will be able to handle really big numbers. I want only to add and multiply numbers, however the class should also handle negative numbers. I wanted to represent the number as a string, but there is a big overhead with converting string to int and back for adding. I want to implement addition as on the high school, add corresponding order and if the result is bigger than 10, add the carry to next order. Then I thought that it would be better to handle it as a array of unsigned long long int and keep the sign separated by bool. With this I'm afraid of size of the int, as C++ standard as far as I know guarantees only that int < float < double. Correct me if I'm wrong. So when I reach some number I should move in array forward and start adding number to the next array position. Is there any data structure that is appropriate or better for this? Thanks in advance.

    Read the article

  • Constructor/Destructor involving a class and a struct

    - by Bogdan Maier
    I am working on a program and need to make an array of objects, specifically I have a 31x1 array where each position is an object, (each object is basically built out of 6 ints). Here is what I have but something is wrong and i could use some help thank you. 31x1 struct header" const int days=31; struct Arr{ int days; int *M; }; typedef Arr* Array; 31x1 matrix constructor: void constr(){ int *M; M = new Expe[31]; // Expe is the class class header: class Expe { private: //0-HouseKeeping, 1-Food, 2-Transport, 3-Clothing, 4-TelNet, 5-others int *obj; } Class object constructor: Expe::Expe() { this->obj=new int[6]; } help please... because i`m pretty lost.

    Read the article

  • How do I make software that preserves database integrity and correctness? Please help, confused.

    - by user287745
    i have made an application project in vs 08 c#, sql server from vs 08. the database has like 20 tables and many fields in each have made an interface for adding deleting editting and retrieving data according to predefined needs of the users. now i have to 1) make to project in to a software which i can deliver to professor. that is he can just double click the icon and the software simply starts. no vs 08 needed to start the debugging 2) the database will be on one powerful computer (dual core latest everything win xp) and the user will access it from another computer connected using LAN i am able to change the connection string to the shared database using vs 08/ debugger whenever the server changes but how am i supposed to do that when its a software? 3)there will by many clients am i supposed to give the same software to every one, so they all can connect to the database, how will the integrity and correctness of the database be maintained? i mean the db.mdf file will be in a folder which will be shared with read and write access. so its not necessary that only one user will write at a time. so is there any coding for this or? please help me out here i am stuck do not know what to do i have no practical experience, would appreciate all the help thank you

    Read the article

  • How is it possible to legally write ::: in C++ and ??? in C#?

    - by daveny
    These questions are a kind of game, and I did not find the solution for them. It is possible to write ::: in C++ without using quotes or anything like this and the compiler will accept it (macros are prohibited too). And the same is true for C# too, but in C#, you have to write ???. I think C++ will use the :: scope operator and C# will use ? : , but I do not know the answers to them. Any idea?

    Read the article

  • Writing an Eval Procedure in Scheme?

    - by Planeman
    My problem isn't with the built-in eval procedure but how to create a simplistic version of it. Just for starters I would like to be able to take this in '(+ 1 2) and have it evaluate the expression + where the quote usually takes off the evaluation. I have been thinking about this and found a couple things that might be useful: Unquote: , (quasiquote) (apply) My main problem is regaining the value of + as a procedure and not a symbol. Once I get that I think I should just be able to use it with the other contents of the list. Any tips or guidance would be much appreciated.

    Read the article

  • m:n relationship must have properties?

    - by nax
    I'm doing a E/R model for a project. I finished the ER model and, for me, all is okay. Maybe not perfect, but it's okay. When I gave the ER model to my teacher, he told me this: "the m:n relations MUST HAVE some properties" He said if the m:n relationship doesn't have the properties it will be wrong. In my opinion m:n doesn't need forcer attributes to the relationship, but if you have someone that can fit in it, just put there. What do you think? Who is wrong in this, me, or my teacher? NOTE: Reading again, it seems what he said was not due to my ER diagram, but was a general statement. The diagram I gave him doesn't have relations yet, so there where just entities and atributes.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • toString() Method question

    - by cdominguez13
    I've been working on this assignemnt here's code: public class Student { private String fname; private String lname; private String studentId; private double gpa; public Student(String studentFname,String studentLname,String stuId,double studentGpa) { fname = studentFname; lname = studentLname; studentId = stuId; gpa = studentGpa; } public double getGpa() { return gpa; } public String getStudentId() { return studentId; } public String getName() { return lname + ", " + fname; } public void setGpa(double gpaReplacement) { if (gpaReplacement >= 0.0 && gpaReplacement <= 4.0) gpa = gpaReplacement; else System.out.println("Invalid GPA! Please try again."); System.exit(0); } } Now I need to create a toString() method that returns a String formatted something like this: Name: Wilson, Mary Ann ID number: 12345 GPA: 3.5

    Read the article

  • Lexical Analyzer(Scanner) for Language G by using C/C++

    - by udsha
    int a = 20; int b =30; float c; c = 20 + a; if(c) { a = c*b + a; } else { c = a - b + c; } use C++ / C to Implement a Lexer. 1. Create Unambiguous grammer for language G. 2. Create Lexical Analyzer for Language G. 3. It should identified tokens and lexemes for that language. 4. create a parse tree. 5. to use attribute grammer on a parse tree the values of the intrinsic attributes should be available on the symbol table.

    Read the article

  • what is the best algorithm to use for this problem

    - by slim
    Equilibrium index of a sequence is an index such that the sum of elements at lower indexes is equal to the sum of elements at higher indexes. For example, in a sequence A: A[0]=-7 A[1]=1 A[2]=5 A[3]=2 A[4]=-4 A[5]=3 A[6]=0 3 is an equilibrium index, because: A[0]+A[1]+A[2]=A[4]+A[5]+A[6] 6 is also an equilibrium index, because: A[0]+A[1]+A[2]+A[3]+A[4]+A[5]=0 (sum of zero elements is zero) 7 is not an equilibrium index, because it is not a valid index of sequence A. If you still have doubts, this is a precise definition: the integer k is an equilibrium index of a sequence if and only if and . Assume the sum of zero elements is equal zero. Write a function int equi(int[] A); that given a sequence, returns its equilibrium index (any) or -1 if no equilibrium indexes exist. Assume that the sequence may be very long.

    Read the article

  • Why does this code sample produce a memory leak?

    - by citronas
    In the university we were given the following code sample and we were being told, that there is a memory leak when running this code. The sample should demonstrate that this is a situation where the garbage collector can't work. As far as my object oriented programming goes, the only codeline able to create a memory leak would be items=Arrays.copyOf(items,2 * size+1); The documentation says, that the elements are copied. Does that mean the reference is copied (and therefore another entry on the heap is created) or the object itself is being copied? As far as I know, Object and therefore Object[] are implemented as a reference type. So assigning a new value to 'items' would allow the garbage collector to find that the old 'item' is no longer referenced and can therefore be collected. In my eyes, this the codesample does not produce a memory leak. Could somebody prove me wrong? =) import java.util.Arrays; public class Foo { private Object[] items; private int size=0; private static final int ISIZE=10; public Foo() { items= new Object[ISIZE]; } public void push(final Object o){ checkSize(); items[size++]=o; } public Object pop(){ if (size==0) throw new ///... return items[--size]; } private void checkSize(){ if (items.length==size){ items=Arrays.copyOf(items,2 * size+1); } } }

    Read the article

  • Help with shopping cart in javascript

    - by user228390
    Hey guys, I'm having problems with my shopping cart. What I am trying to do is make a function that will add an item the cart and then and function that will view the cart and show the details. But what I have got so far does not do that, it just simply adds and goes straight to view cart. Also I wanted to store the name of each items in different global arrays (name, price and sum) but I can't get it work that way. Can any help me overcome this problem? Edit: I've tried to get it to work by adding some more items and attaching it to another html page, but now the code does not seem to work at all , before it showed the price and total and now I get nothing . javascript code function round_total (c) { var pennies = c * 100; pennies = Math.round(pennies); var strPennies = "" + pennies; var len = strPennies.length; return parseFloat(strPennies.substring(0, len - 2) + "." + strPennies.substring(len - 2, len)); } // End of round_total function. /* Start of generate_page function. */ function generate_page (form) { tax = 0.08; delivery_p = 2.99; var odate = new Date(); var qty = form.quantity.value; var product_v = new String(form.product.value); var total_price = product_v.substr(product_v.indexOf("$") + 1, product_v.length - product_v.indexOf("$")); var price_without_tax = round_total(qty * total_price); var ttax = round_total(price_without_tax * tax); var delivery = round_total(qty * delivery_p); var total_p = round_total(price_without_tax + ttax + delivery); document.writeln("Quantity: " + qty + "<br>"); document.writeln("Price: $" + total_price + "<br>"); document.writeln("Delivery: $" + delivery + "<br>"); document.writeln("Total: $" + total_p + "<br>"); document.writeln("Order placed on: " + odate.toGMTString()); } function calculate() { round_total (c)(); generate_page (form)(); } HTML code: Shopping cart Welcome, Guest Login Sign Up Stay Updated: Subscribe via RSS Email Updates <div id="header"> <div id="branding" class="container"> <h1>The Finest Toy<br /> Store Online</h1> <p class="desc">If you're looking for a toy shop then look no further.<br/> Go on, treat the kids with our huge selection of<br/>online toy shops selling toys for all ages.</p> </div><!-- end branding --> <div id="navigation"> <ul id="menu" class="container"> <li><a href="#">HOME</a></li> <li><a href="#">ABOUT</a></li> <li><a href="#">Online Store</a></li> <li><a href="#">CONTACT</a></li> </ul> </div><!-- end navigation --> </div><!-- end header --> Shopping Cart Nintendo DS Xbox Product: Console £149.99 Console + Games £169.99 Quantity: Product: Console £149.99 Console + Games £169.99 Quantity:     Playstation 3 Wii Product: Console £149.99 Console + Games £169.99 Quantity:   Product: Console £149.99 Console + Games £169.99 Quantity:        <input type="submit" value="Add to cart" name="submit" onClick="cart()";/><input , type="reset" value="Reset" name="reset" Copyright © 2010 shopping cart. Content and Header © |Back to top Do I need to show my CSS as well? (Sorry about the coding its not working properly for me, its not showing up the way it should be)

    Read the article

  • Is there a work around for invalid octal digit in an array?

    - by sircrisp
    I'm trying to create an array which will hold the hours in a day so I can loop through it for a clock. I have: int hourArray[24] = {12, 01, 02, 03, 04, 05, 06, 07, 08, 09, 10, 11, 12, 01, 02, 03, 04, 05, 06, 07, 08, 09, 10, 11}; I am getting the error on the following numbers in order 08, 09, 08, 09. It tells me: Error: invalid octal digit I've never run into this before and I'm wondering if there is any way around it?

    Read the article

  • My PHP script for sending emails wont send

    - by James
    Well I'm working on a school project, and I uploaded my script to send emails. I'm pretty much using whats defined here: http://www.webcheatsheet.com/PHP/send_email_text_html_attachment.php . Now, all I really changed(other than the contents), is the receiver, to my email address. However, I'm not getting it in my inbox. Is there something else I need? Do I need to do something with the settings on the server(or have my school enable something)?

    Read the article

  • java programming

    - by Baiba
    ok i have version of t code, please tell me what i need to do when i need to get out of program The INDEX NUMBER OF COLUMN IN WHICH ARE LEAST ZEROS? class Uzd{ public static void main(String args[]){ int mas[][]= {{3,4,7,5,0}, {4,5,3,0,1}, {8,2,4,0,3}, {7,0,2,0,1}, {0,0,1,3,0}}; int nul_mas[] = new int[5]; int nul=0; for(int j=0;j<5;j++){// nul=0; for(int i=0;i<5;i++){ if(mas[i][j]==0){ nul++; } } nul_mas[j]=nul; } for(int i=0;i<5;i++){ for(int j=0;j<5;j++){ System.out.print(mas[i][j]); } System.out.println(); } System.out.println();// atstarpe System.out.println("///zeros in each column///"); for(int i=0;i<5;i++){System.out.print(nul_mas[i]);} System.out.println(); }} and after running it shows: 34750 45301 82403 70201 00130 ///zeros in each column/// But i need not in each column but i need to get out index of column in which zeros are least! in this situation it is column nubmer 2!! 12032

    Read the article

  • Finding the heaviest of N objects using M scales

    - by cpprulez
    We have N objects and M scales. It's up to us what the objects are, and we need to position the objects on the scales so that it is undoubtful which is the heaviest object. For example, if we have 3 objects: "a", "b", "c" and 2 scales, one possible solution is "a" "b", "b" = "c" (here "a" is the heaviest). I need an algorithm which generates such solutions given N and M. Also let's assume that "a" is always the heaviest object. I've lost a few hours figuring out how to do it, but no matter what I figure out, there's always cases which I miss. For example, another solution is: "a" + "c" = 2 * "b", "a" "c".

    Read the article

  • Does python have a session variable concept???

    - by gizgok
    I have a datetime.date variable in python.I need to pass it to a function do operations according to the date given and then increment the date for the next set of operations.The problem is I have to do the operations in diff pages and hence I need the date as a variable which can go from page to page. Can we do this in python.......

    Read the article

< Previous Page | 48 49 50 51 52 53 54 55 56 57 58 59  | Next Page >