Search Results

Search found 55276 results on 2212 pages for 'eicar test string'.

Page 502/2212 | < Previous Page | 498 499 500 501 502 503 504 505 506 507 508 509  | Next Page >

  • Why does this MSDN example for Func<> delegate have a superfluous Select() call?

    - by Dan
    The MSDN gives this code example in the article on the Func Generic Delegate: Func<String, int, bool> predicate = ( str, index) => str.Length == index; String[] words = { "orange", "apple", "Article", "elephant", "star", "and" }; IEnumerable<String> aWords = words.Where(predicate).Select(str => str); foreach (String word in aWords) Console.WriteLine(word); I understand what all this is doing. What I don't understand is the Select(str => str) bit. Surely that's not needed? If you leave it out and just have IEnumerable<String> aWords = words.Where(predicate); then you still get an IEnumerable back that contains the same results, and the code prints the same thing. Am I missing something, or is the example misleading?

    Read the article

  • Jquery form Ajax Submit

    - by user1766080
    I want to submit a form using ajax in the background. I tried: <div class="form-horizontal" id="form"> <label for="name" class="control-label">Username</label> <div class="controls"> <span id="name_input"><input type="text" name="name" id="medium" class='input-medium input-square'></span> <span class="help-inline" id = "ajax_load"></span> </div> <div class="form-actions"> <button class="btn btn-red5" onclick="resolve()">Login</button> <input type="reset" class='btn btn-danger' value="Reset"> </div> </div> And the Javascript: <script type="text/javascript"> var resolve = function () { jAlert('test', 'test'); $('#ajax_load').html('<a href="#" class="btn btn-mini btn-square tip" title="Reloading"><img src="templates/img/ajax-loader.gif" alt=""></a>'); $.ajax( { url : 'plugin.php?plugin=test', type : 'post', data: $("#form").serialize(), success : function( resp ) { if(resp.ajax_success == false) { } else { jAlert('test', 'test'); } } }); }; </script> I get an alert, but there is no form submit. I checked that with Live http headers. Why does it not submit the form?

    Read the article

  • Passing parameters among views in a navigation frame INSIDE a custom control

    - by NetWriter
    I created a silverlight 3 application with a navigation frame and 3 views: search, add and edit. I used the app file to pass parameters among the 3 pages, eg: ((App)Application.Current).SNIPSELECTED = currentSnip; Then in the receiving page: currentSnip = ((App)Application.Current).SNIPSELECTED; currentSnip is a SnipItem object: public class SnipItem { public string itemID {get;set;} public string category {get;set;} public string itemDescription {get;set;} public string codeSnip {get;set;} } This worked fine until I decided to make this entire application into a user control and put that inside a second silverlight application with its own navigation frame and app file. The app files are getting confused. The first app file with all my parameter passing is not being read. I know how to pass a simple parameter between views in the first application without the app file (in a query string), but how about these custom types like my currentSnip above?

    Read the article

  • Why is Private Accessor deprecated?

    - by user3918598
    It used to be the number one reason for us to choose MSTest from others that we could access and test private methods. Now that Private accessors are deprecated in Visual Studio 2012. Does anyone know why Microsoft make such decision? Is it because it's not a good practice to test private methods? Also, if I still need to unit test my private methods, how could I do that in VS 2012 and later versions?

    Read the article

  • Delete an (exact) element from an array in php

    - by Holian
    Hi Masters! For example i have an array like this: $test= array("0" => "412", "1" => "2"); I would like to delete the element if its = 2 $delete=2; for($j=0;$j<$dbj;$j++) { if (in_array($delete, $test)) { unset($test[$j]); } } print_r($test); But with this, unfortunatelly the array will empty... How can i delete an exact element from the array? Thank you

    Read the article

  • @echo off in DOS (cmd)

    - by Rayne
    I'm trying to write a BAT script and I have the following: @echo off REM Comments here SETLOCAL ENABLEDELAYEDEXPANSION set PROG_ROOT=C:\Prog set ONE=1 echo 1>> %PROG_ROOT\test.txt echo %ONE%>> %PROG_ROOT\test.txt for /f "tokens=*" %%f in (folders.txt) do ( echo %%f>> %PROG_ROOT\test.txt ) ENDLOCAL My folders.txt contains the number "5". My test.txt output is ECHO is off ECHO is off 5 I don't understand why the first 2 lines of output has "ECHO is off", while the third line is printed out correctly. How do I print the correct output?

    Read the article

  • Is it bad practice to initialize a variable to a dummy value?

    - by froadie
    This question is a result of the answers to this question that I just asked. It was claimed that this code is "ugly" because it initializes a variable to a value that will never be read: String tempName = null; try{ tempName = buildFileName(); } catch(Exception e){ ... System.exit(1); } FILE_NAME = tempName; Is this indeed bad practice? Should one avoid initializing variables to dummy values that will never actually be used? (EDIT - And what about initializing a String variable to "" before a loop that will concatenate values to the String...? Or is this in a separate category? e.g. String whatever = ""; for(String str : someCollection){ whatever += str; } )

    Read the article

  • Methods specific only to an instance? What are they called in Ruby?

    - by daremarkovic
    I know there are "instance methods", "class methods" but what are these types of methods called, for eg: s1 = "This is my STRING!" def s1.m1 downcase end p s1 # => "This is my STRING!" p s1.m1 # => "this is my string!" What type of method is the "m1" method called on the s1 "instance" of the "string" class? It's really weird because I didn't know this was possible at all if I try: s2 = "This is ANOTHER string" s2.m1 # => Won't work! Which kind of makes sense, but not sure why defining methods like m1 on instances on a class are useful at all.

    Read the article

  • Reloading an object not working in rspec

    - by Eric Baldwin
    I am trying to test a controller method with the following code: it "should set an approved_at date and email the campaign's client" do @campaign = Campaign.create(valid_attributes) post :approve, id: @campaign.id.to_s @campaign.reload @campaign.approved_at.should_not be(nil) end However, when I run this test, I get the following error: Failure/Error: @campaign.reload ActiveRecord::RecordNotFound: Couldn't find Campaign without an ID When I run the analagous lines in the rails console, the reload works and the value is set as I need it to be. Why isn't reload working for me when I run the code in an rspec test?

    Read the article

  • replace \n and \r\n with <br /> in java

    - by Bala R
    This has been asked several times for several languages but I can't get it to work. I have a string like this String str = "This is a string.\nThis is a long string."; And I'm trying to replace the \n with <br /> using str = str.replaceAll("(\r\n|\n)", "<br />"); but the \n is not getting replaced. I tried to use this RegEx Tool to verify and I see the same result. The input string does not have a match for "(\r\n|\n)". What am i doing wrong ?

    Read the article

  • Generic Dictionary - Getting Conversion Error

    - by pm_2
    The following code is giving me an error: // GetDirectoryList() returns Dictionary<string, DirectoryInfo> Dictionary<string, DirectoryInfo> myDirectoryList = GetDirectoryList(); // The following line gives a compile error foreach (Dictionary<string, DirectoryInfo> eachItem in myDirectoryList) The error it gives is as follows: Cannot convert type 'System.Collections.Generic.KeyValuePair<string,System.IO.DirectoryInfo>' to 'System.Collections.Generic.Dictionary<string,System.IO.DirectoryInfo>’ My question is: why is it trying to perform this conversion? Can I not use a foreach loop on this type of object?

    Read the article

  • How to determine number of function arguments dynamically

    - by Kam
    I have the following code: #include <iostream> #include <functional> class test { public: typedef std::function<bool(int)> Handler; void handler(Handler h){h(5);} }; class test2 { public: template< typename Ret2, typename Ret, typename Class, typename Param> inline Ret2 MemFn(Ret (Class::*f)(Param), int arg_num) { if (arg_num == 1) return std::bind(f, this, std::placeholders::_1); } bool f(int x){ std::cout << x << std::endl; return true;} }; int main() { test t; test2 t2; t.handler(t2.MemFn<test::Handler>(&test2::f, 1)); return 0; } It works as expected. I would like to be able to call this: t.handler(t2.MemFn<test::Handler>(&test2::f)); instead of t.handler(t2.MemFn<test::Handler>(&test2::f, 1)); Basically I need MemFn to determine in runtime what Handler expects as the number of arguments. Is that even possible?

    Read the article

  • Printing a list using reflection

    - by TFool
    public class Service{ String serviceName; //setter and getter } public class Version{ String VersionID; //setter and getter } public void test(Object list){ //it shd print the obtained list } List< Service list1; //Service is a Bean List< Version list2; //Version is a Bean test(list1); test(list2); Now the test method shd print the obtained list - (i.e) If the list is of type Service ,then serviceName should be printed using its getter. If the list type is Version versionID should be printed. Is it possible to achieve this without using Interface or abstract class?

    Read the article

  • USB device Set Attribute in C#

    - by p19lord
    I have this bit of code: DriveInfo[] myDrives = DriveInfo.GetDrives(); foreach (DriveInfo myDrive in myDrives) { if (myDrive.DriveType == DriveType.Removable) { string path = Convert.ToString(myDrive.RootDirectory); DirectoryInfo mydir = new DirectoryInfo(path); String[] dirs = new string[] {Convert.ToString(mydir.GetDirectories())}; String[] files = new string[] {Convert.ToString(mydir.GetFiles())}; foreach (var file in files) { File.SetAttributes(file, ~FileAttributes.Hidden); File.SetAttributes(file, ~FileAttributes.ReadOnly); } foreach (var dir in dirs) { File.SetAttributes(dir, ~FileAttributes.Hidden); File.SetAttributes(dir, ~FileAttributes.ReadOnly); } } } I have a problem. It is trying the code for Floppy Disk drive first which and because no Floppy disk in it, it threw the error The device is not ready. How can I prevent that?

    Read the article

  • ActionScript Reading Static Const Array

    - by TheDarkIn1978
    how can i evaluate weather my test array is equal to my static constant DEFAULT_ARRAY? shouldn't my output be returning true? public class myClass extends Sprite { private static const DEFAULT_ARRAY:Array = new Array(1, 2, 3); public function myClass() { var test:Array = new Array(1, 2, 3); trace (test == DEFAULT_ARRAY); } //traces false

    Read the article

  • Multithreaded ActiveRecord requests in rspec

    - by jeem
    I'm trying to recreate a race condition in a test, so I can try out some solutions. I find that in the threads I create in my test, ActiveRecord always returns 0 for counts and nil for finds. For example, with 3 rows in the table "foos": it "whatever" do puts Foo.count 5.times do Thread.new do puts Foo.count end end end will print 3 0 0 0 0 0 test.log shows the expected query, the expected 6 times: SELECT count(*) AS count_all FROM `active_agents` Any idea what's going on here?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Jquery ajax load not working

    - by Slay
    This is my code: test.html <html> <head> <title>test</title> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.8.2/jquery.min.js"></script> <script> $(document).ready(function(){ $(window).bind('hashchange', function(){ $('#result').load('test2.html', function(){ alert('Load was performed.'); }); }); }); </script> </head> <body> <a href="#Test1">Test 1</a> <a href="#Test2">Test 2</a> <div id="result"></div> </body> </html> test2.html <h3>This is content from test2.html</h3> I want to detect the specific page to load using window.hash in change. For instance if user go to http://localhost/test.html#test2 The main container(result) in the page will do an ajax load call to test2.html to get the content. I can't manage to get this simple code working. Appreciate if someone can guide me in the right direction. Thanks.

    Read the article

  • How to split the definition of template friend funtion within template class?

    - by ~joke
    The following example compiles fine but I can't figure out how to separate declaration and definition of operator<<() is this particular case. Every time I try to split the definition friend is causing trouble and gcc complains the operator<<() definition must take exactly one argument. #include <iostream> template <typename T> class Test { public: Test(const T& value) : value_(value) {} template <typename STREAM> friend STREAM& operator<<(STREAM& os, const Test<T>& rhs) { os << rhs.value_; return os; } private: T value_; }; int main() { std::cout << Test<int>(5) << std::endl; }

    Read the article

  • DataSet.GetChanges - Save the updated record in a different table than the source one

    - by John Dev
    I'm doing operation on a dataset containing data from a sql table named Test_1 and then get the updated records using the DataSet.GetChanges(DataRowState.Modified) function. Then i try to save the dataset containing the updated records on a different table than the source one (the table is names Test and has the same structure as Test_1) using the following statement: sqlDataAdapter.Update(changesDataSet,"Test"); I'm getting the following error : Update unable to find TableMapping['Test'] or DataTable 'Test' I'm new to ado.net and don't even know if it"s something possible. Any advice is welcome. Just to provide a bit of context. ETL jobs are importing data in temp table with same structure as the original but with _jobid suffix. Right after a rule engine is doing validation before updating the original table.

    Read the article

  • error message fix

    - by user1722654
    for (int i = 0; i < dataGridView1.Rows.Count; i++) { //bool sleected = false; if (dataGridView1.Rows[i].Cells[3].Value != null) { selected.Add(i); } } //string donew = ""; // line off error textBox1.Text = ((String)dataGridView1.Rows[1].Cells[2].Value); /* for (int i = 0; i < selected.Count; i++) { textAdded.Add((String)dataGridView1.Rows[0].Cells[2].Value); // donew += (String)dataGridView1.Rows[selected[i]].Cells[2].Value; }*/ I keep getting the error Unable to cast object of type 'System.Double' to type 'System.String' What can I do to overcome this?

    Read the article

  • Problem in populating a dictionary object using Enumerable.Range() (C#3.0)

    - by Newbie
    If I do for (int i = 0; i < appSettings.Count; i++) { string key = appSettings.Keys[i]; euFileDictionary.Add(key, appSettings[i]); } It is working fine. When I am trying the same thing using Enumerable.Range(0, appSettings.Count).Select(i => { string Key = appSettings.Keys[i]; string Value = appSettings[i]; euFileDictionary.Add(Key, Value); }).ToDictionary<string,string>(); I am getting a compile time error The type arguments for method 'System.Linq.Enumerable.Select(System.Collections.Generic.IEnumerable, System.Func)' cannot be inferred from the usage. Try specifying the type arguments explicitly. Any idea? Using C#3.0 Thanks

    Read the article

  • Is read-only auto-imlemented property possible?

    - by abatishchev
    Hello. I found a topic on MSDN that talks that yes, this is possible. I did a test that seems to break this statement: using System; namespace Test { class Program { static void Main(string[] args) { Foo f = new Foo("1"); Console.WriteLine(f.Bar); // prints 1 f.Test("2"); Console.WriteLine(f.Bar);// successfully prints 2 } } class Foo { public Foo(string b) { this.Bar = b; } public string Bar { get; private set; } public void Test(string b) { // this would be impossible for readonly field! // next error would be occur: CS0191 or CS0191 // A readonly field cannot be assigned to (except in a constructor or a variable initializer) this.Bar = b; } } } Where am I wrong?

    Read the article

  • get first parent of iframe javascript

    - by baaroz
    I have a iframe inside test.aspx,when the user click on a pay button inside the Iframe,the iframe redirct to check.aspx that has same iframe if payment was success on first time, then window.parent.location.href==test.aspx if payment was failed the iframe redirect again to check.aspx,so now the window.parent.location.href==check.aspx while the payement was failed the the iframe keep redirect to check.aspx and the parent location keep changing ,so for example if the client failed 3 time,inside check.aspx I need to do window.parent.parent.parent.location.href to get test.aspx redirect. when the user payment was success ,then I want to redirect the test.aspx but I can't know how much child iframe window he has! I need something like window.parent[0].location.href=success.aspx,so I will be able to redirect the first father window. Thanks for any Help Baaroz

    Read the article

< Previous Page | 498 499 500 501 502 503 504 505 506 507 508 509  | Next Page >