Search Results

Search found 14861 results on 595 pages for 'high speed computing'.

Page 507/595 | < Previous Page | 503 504 505 506 507 508 509 510 511 512 513 514  | Next Page >

  • Implementation of ZipCrypto / Zip 2.0 encryption in java

    - by gomesla
    I'm trying o implement the zipcrypto / zip 2.0 encryption algoritm to deal with encrypted zip files as discussed in http://www.pkware.com/documents/casestudies/APPNOTE.TXT I believe I've followed the specs but just can't seem to get it working. I'm fairly sure the issue has to do with my interpretation of the crc algorithm. The documentation states CRC-32: (4 bytes) The CRC-32 algorithm was generously contributed by David Schwaderer and can be found in his excellent book "C Programmers Guide to NetBIOS" published by Howard W. Sams & Co. Inc. The 'magic number' for the CRC is 0xdebb20e3. The proper CRC pre and post conditioning is used, meaning that the CRC register is pre-conditioned with all ones (a starting value of 0xffffffff) and the value is post-conditioned by taking the one's complement of the CRC residual. Here is the snippet that I'm using for the crc32 public class PKZIPCRC32 { private static final int CRC32_POLYNOMIAL = 0xdebb20e3; private int crc = 0xffffffff; private int CRCTable[]; public PKZIPCRC32() { buildCRCTable(); } private void buildCRCTable() { int i, j; CRCTable = new int[256]; for (i = 0; i <= 255; i++) { crc = i; for (j = 8; j > 0; j--) if ((crc & 1) == 1) crc = (crc >>> 1) ^ CRC32_POLYNOMIAL; else crc >>>= 1; CRCTable[i] = crc; } } private int crc32(byte buffer[], int start, int count, int lastcrc) { int temp1, temp2; int i = start; crc = lastcrc; while (count-- != 0) { temp1 = crc >>> 8; temp2 = CRCTable[(crc ^ buffer[i++]) & 0xFF]; crc = temp1 ^ temp2; } return crc; } public int crc32(int crc, byte buffer) { return crc32(new byte[] { buffer }, 0, 1, crc); } } Below is my complete code. Can anyone see what I'm doing wrong. package org.apache.commons.compress.archivers.zip; import java.io.IOException; import java.io.InputStream; public class ZipCryptoInputStream extends InputStream { public class PKZIPCRC32 { private static final int CRC32_POLYNOMIAL = 0xdebb20e3; private int crc = 0xffffffff; private int CRCTable[]; public PKZIPCRC32() { buildCRCTable(); } private void buildCRCTable() { int i, j; CRCTable = new int[256]; for (i = 0; i <= 255; i++) { crc = i; for (j = 8; j > 0; j--) if ((crc & 1) == 1) crc = (crc >>> 1) ^ CRC32_POLYNOMIAL; else crc >>>= 1; CRCTable[i] = crc; } } private int crc32(byte buffer[], int start, int count, int lastcrc) { int temp1, temp2; int i = start; crc = lastcrc; while (count-- != 0) { temp1 = crc >>> 8; temp2 = CRCTable[(crc ^ buffer[i++]) & 0xFF]; crc = temp1 ^ temp2; } return crc; } public int crc32(int crc, byte buffer) { return crc32(new byte[] { buffer }, 0, 1, crc); } } private static final long ENCRYPTION_KEY_1 = 0x12345678; private static final long ENCRYPTION_KEY_2 = 0x23456789; private static final long ENCRYPTION_KEY_3 = 0x34567890; private InputStream baseInputStream = null; private final PKZIPCRC32 checksumEngine = new PKZIPCRC32(); private long[] keys = null; public ZipCryptoInputStream(ZipArchiveEntry zipEntry, InputStream inputStream, String passwd) throws Exception { baseInputStream = inputStream; // Decryption // ---------- // PKZIP encrypts the compressed data stream. Encrypted files must // be decrypted before they can be extracted. // // Each encrypted file has an extra 12 bytes stored at the start of // the data area defining the encryption header for that file. The // encryption header is originally set to random values, and then // itself encrypted, using three, 32-bit keys. The key values are // initialized using the supplied encryption password. After each byte // is encrypted, the keys are then updated using pseudo-random number // generation techniques in combination with the same CRC-32 algorithm // used in PKZIP and described elsewhere in this document. // // The following is the basic steps required to decrypt a file: // // 1) Initialize the three 32-bit keys with the password. // 2) Read and decrypt the 12-byte encryption header, further // initializing the encryption keys. // 3) Read and decrypt the compressed data stream using the // encryption keys. // Step 1 - Initializing the encryption keys // ----------------------------------------- // // Key(0) <- 305419896 // Key(1) <- 591751049 // Key(2) <- 878082192 // // loop for i <- 0 to length(password)-1 // update_keys(password(i)) // end loop // // Where update_keys() is defined as: // // update_keys(char): // Key(0) <- crc32(key(0),char) // Key(1) <- Key(1) + (Key(0) & 000000ffH) // Key(1) <- Key(1) * 134775813 + 1 // Key(2) <- crc32(key(2),key(1) >> 24) // end update_keys // // Where crc32(old_crc,char) is a routine that given a CRC value and a // character, returns an updated CRC value after applying the CRC-32 // algorithm described elsewhere in this document. keys = new long[] { ENCRYPTION_KEY_1, ENCRYPTION_KEY_2, ENCRYPTION_KEY_3 }; for (int i = 0; i < passwd.length(); ++i) { update_keys((byte) passwd.charAt(i)); } // Step 2 - Decrypting the encryption header // ----------------------------------------- // // The purpose of this step is to further initialize the encryption // keys, based on random data, to render a plaintext attack on the // data ineffective. // // Read the 12-byte encryption header into Buffer, in locations // Buffer(0) thru Buffer(11). // // loop for i <- 0 to 11 // C <- buffer(i) ^ decrypt_byte() // update_keys(C) // buffer(i) <- C // end loop // // Where decrypt_byte() is defined as: // // unsigned char decrypt_byte() // local unsigned short temp // temp <- Key(2) | 2 // decrypt_byte <- (temp * (temp ^ 1)) >> 8 // end decrypt_byte // // After the header is decrypted, the last 1 or 2 bytes in Buffer // should be the high-order word/byte of the CRC for the file being // decrypted, stored in Intel low-byte/high-byte order. Versions of // PKZIP prior to 2.0 used a 2 byte CRC check; a 1 byte CRC check is // used on versions after 2.0. This can be used to test if the password // supplied is correct or not. byte[] encryptionHeader = new byte[12]; baseInputStream.read(encryptionHeader); for (int i = 0; i < encryptionHeader.length; i++) { encryptionHeader[i] ^= decrypt_byte(); update_keys(encryptionHeader[i]); } } protected byte decrypt_byte() { byte temp = (byte) (keys[2] | 2); return (byte) ((temp * (temp ^ 1)) >> 8); } @Override public int read() throws IOException { // // Step 3 - Decrypting the compressed data stream // ---------------------------------------------- // // The compressed data stream can be decrypted as follows: // // loop until done // read a character into C // Temp <- C ^ decrypt_byte() // update_keys(temp) // output Temp // end loop int read = baseInputStream.read(); read ^= decrypt_byte(); update_keys((byte) read); return read; } private final void update_keys(byte ch) { keys[0] = checksumEngine.crc32((int) keys[0], ch); keys[1] = keys[1] + (byte) keys[0]; keys[1] = keys[1] * 134775813 + 1; keys[2] = checksumEngine.crc32((int) keys[2], (byte) (keys[1] >> 24)); } }

    Read the article

  • Computer science undergraduate project ideas

    - by Mehrdad Afshari
    Hopefully, I'm going to finish my undergraduate studies next semester and I'm thinking about the topic of my final project. And yes, I've read the questions with duplicate title. I'm asking this from a bit different viewpoint, so it's not an exact dupe. I've spent at least half of my life coding stuff in different languages and frameworks so I'm not looking at this project as a way to learn much about coding and preparing for real world apps or such. I've done lots of those already. But since I have to do it to complete my degree, I felt I should spend my time doing something useful instead of throwing the whole thing out. I'm planning to make it an open source project or a hosted Web app (depending on the type) if I can make a high quality thing out of it, so I decided to ask StackOverflow what could make a useful project. Situation I've plenty of freedom about the topic. They also require 30-40 pages of text describing the project. I have the following points in mind (the more satisfied, the better): Something useful for software development Something that benefits the community Having academic value is great Shouldn't take more than a month of development (I know I'm lazy). Shouldn't be related to advanced theoretical stuff (soft computing, fuzzy logic, neural networks, ...). I've been a business-oriented software developer. It should be software oriented. While I love hacking microcontrollers and other fun embedded electronic things, I'm not really good at soldering and things like that. I'm leaning toward a Web application (think StackOverflow, PasteBin, NerdDinner, things like those). Technology It's probably going to be done in .NET (C#, F#) and Windows platform. If I really like the project (cool low level hacking), I might actually slip to C/C++. But really, C# is what I'm efficient at. Ideas Programming language, parsing and compiler related stuff: Designing a domain specific programming language and compiler Templating language compiled to C# or IL Database tools and related code generation stuff Web related technologies: ASP.NET MVC View engine doing something cool (don't know what exactly...) Specific-purpose, small, fast ASP.NET-based Web framework Applications: Visual Studio plugin to integrate with Bazaar (it's too much work, I think). ASP.NET based, jQuery-powered issue tracker (and possibly, project lifecycle management as a whole - poor man's TFS) Others: Something related to GPGPU Looking forward for great ideas! Unfortunately, I can't help on a currently existing project. I need to start my own to prevent further problems (as it's an undergrad project, nevertheless).

    Read the article

  • How to use Koala Facebook Graph API?

    - by reko
    I am a Rails newbie. I want to use Koala's Graph API. In my controller @graph = Koala::Facebook::API.new('myFacebookAccessToken') @hello = @graph.get_object("my.Name") When I do this, I get something like this { "id"=>"123456", "name"=>"First Middle Last", "first_name"=>"First", "middle_name"=>"Middle", "last_name"=>"Last", "link"=>"http://www.facebook.com/MyName", "username"=>"my.name", "birthday"=>"12/12/1212", "hometown"=>{"id"=>"115200305133358163", "name"=>"City, State"}, "location"=>{"id"=>"1054648928202133335", "name"=>"City, State"}, "bio"=>"This is my awesome Bio.", "quotes"=>"I am the master of my fate; I am the captain of my soul. - William Ernest Henley\r\n\r\n"Don't go around saying the world owes you a living. The world owes you nothing. It was here first.\" - Mark Twain", "work"=>[{"employer"=>{"id"=>"100751133333", "name"=>"Company1"}, "position"=>{"id"=>"105763693332790962", "name"=>"Position1"}, "start_date"=>"2010-08", "end_date"=>"2011-07"}], "sports"=>[{"id"=>"104019549633137", "name"=>"Sport1"}, {"id"=>"103992339636529", "name"=>"Sport2"}], "favorite_teams"=>[{"id"=>"105467226133353743", "name"=>"Fav1"}, {"id"=>"19031343444432369133", "name"=>"Fav2"}, {"id"=>"98027790139333", "name"=>"Fav3"}, {"id"=>"104055132963393331", "name"=>"Fav4"}, {"id"=>"191744431437533310", "name"=>"Fav5"}], "favorite_athletes"=>[{"id"=>"10836600585799922", "name"=>"Fava1"}, {"id"=>"18995689436787722", "name"=>"Fava2"}, {"id"=>"11156342219404022", "name"=>"Fava4"}, {"id"=>"11169998212279347", "name"=>"Fava5"}, {"id"=>"122326564475039", "name"=>"Fava6"}], "inspirational_people"=>[{"id"=>"16383141733798", "name"=>"Fava7"}, {"id"=>"113529011990793335", "name"=>"fava8"}, {"id"=>"112032333138809855566", "name"=>"Fava9"}, {"id"=>"10810367588423324", "name"=>"Fava10"}], "education"=>[{"school"=>{"id"=>"13478880321332322233663", "name"=>"School1"}, "type"=>"High School", "with"=>[{"id"=>"1401052755", "name"=>"Friend1"}]}, {"school"=>{"id"=>"11482777188037224", "name"=>"School2"}, "year"=>{"id"=>"138383069535219", "name"=>"2005"}, "type"=>"High School"}, {"school"=>{"id"=>"10604484633093514", "name"=>"School3"}, "year"=>{"id"=>"142963519060927", "name"=>"2010"}, "concentration"=>[{"id"=>"10407695629335773", "name"=>"c1"}], "type"=>"College"}, {"school"=>{"id"=>"22030497466330708", "name"=>"School4"}, "degree"=>{"id"=>"19233130157477979", "name"=>"c3"}, "year"=>{"id"=>"201638419856163", "name"=>"2011"}, "type"=>"Graduate School"}], "gender"=>"male", "interested_in"=>["female"], "relationship_status"=>"Single", "religion"=>"Religion1", "political"=>"Political1", "email"=>"[email protected]", "timezone"=>-8, "locale"=>"en_US", "languages"=>[{"id"=>"10605952233759137", "name"=>"English"}, {"id"=>"10337617475934611", "name"=>"L2"}, {"id"=>"11296944428713061", "name"=>"L3"}], "verified"=>true, "updated_time"=>"2012-02-24T04:18:05+0000" } How do I show this entire hash in the view in a good format? This is what I did from what ever I learnt.. In my view <% @hello.each do |key, value| %> <li><%=h "#{key.to_s} : #{value.to_s}" %></li> <% end %> This will get the entire thing converted to a list... It works awesome if its just one key.. but how to work with multiple keys and show only the information... something like when it outputs hometown : City, State rather than something like hometown : {"id"=>"115200305133358163", "name"=>"City, State"} Also for education if I just say education[school][name] to display list of schools attended? The error i get is can't convert String into Integer I also tried to do this in my controller, but I get the same error.. @fav_teams = @hello["favorite_teams"]["name"] Also, how can I save all these to the database.. something like just the list of all schools.. not their id no's? Update: The way I plan to save to my database is.. lets say for a user model, i want to save to database as :facebook_id, :facebook_name, :facebook_firstname, ...., :facebook_hometown .. here I only want to save name... when it comes to education.. I want to save.. school, concentration and type.. I have no idea on how to achieve this.. Looking forward for help! thanks!

    Read the article

  • Problem with AquaTerm on Snow Leopard

    - by cheetah
    When i try to install AquaTerm on Snow leopard from MacPorts i got this: ---> Computing dependencies for aquaterm ---> Building aquaterm Error: Target org.macports.build returned: shell command "cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm" && /usr/bin/xcodebuild -target "AquaTerm" -configuration Deployment build OBJROOT=build/ SYMROOT=build/ MACOSX_DEPLOYMENT_TARGET=10.6 ARCHS=x86_64 SDKROOT= USER_APPS_DIR=/Applications/MacPorts FRAMEWORKS_DIR=/opt/local/Library/Frameworks" returned error 1 Command output: [WARN]Warning: The Copy Bundle Resources build phase contains this target's Info.plist file 'AquaTerm.framework-Info.plist'. CopyPlistFile build/Deployment/AquaTerm.framework/Versions/A/Resources/AquaTerm.framework-Info.plist AquaTerm.framework-Info.plist cd /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist AquaTerm.framework-Info.plist --outdir /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.framework/Versions/A/Resources error: can't exec '/Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist' (No such file or directory) Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist failed with exit code 71 Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist failed with exit code 71 === BUILD NATIVE TARGET AquaTerm OF PROJECT AquaTerm WITH CONFIGURATION Deployment === Check dependencies Warning: Multiple build commands for output file /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources/help.html [WARN]Warning: Multiple build commands for output file /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources/help.html CopyTiffFile build/Deployment/AquaTerm.app/Contents/Resources/Cross.tiff English.lproj/Cross.tiff cd /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff English.lproj/Cross.tiff --outdir /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources error: can't exec '/Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff' (No such file or directory) Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff failed with exit code 71 Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff failed with exit code 71 ** BUILD FAILED ** The following build commands failed: AQTFwk: CopyPlistFile /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.framework/Versions/A/Resources/AquaTerm.framework-Info.plist AquaTerm.framework-Info.plist AquaTerm: CopyTiffFile /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources/Cross.tiff English.lproj/Cross.tiff (2 failures) Error: Status 1 encountered during processing. Before reporting a bug, first run the command again with the -d flag to get complete output. How i can solve this problem?

    Read the article

  • Resizing QT's QTextEdit to Match Text Height: maximumViewportSize()

    - by Aaron
    I am trying to use a QTextEdit widget inside of a form containing several QT widgets. The form itself sits inside a QScrollArea that is the central widget for a window. My intent is that any necessary scrolling will take place in the main QScrollArea (rather than inside any widgets), and any widgets inside will automatically resize their height to hold their contents. I have tried to implement the automatic resizing of height with a QTextEdit, but have run into an odd issue. I created a sub-class of QTextEdit and reimplemented sizeHint() like this: QSize OperationEditor::sizeHint() const { QSize sizehint = QTextBrowser::sizeHint(); sizehint.setHeight(this->fitted_height); return sizehint; } this-fitted_height is kept up-to-date via this slot that is wired to the QTextEdit's "contentsChanged()" signal: void OperationEditor::fitHeightToDocument() { this->document()->setTextWidth(this->viewport()->width()); QSize document_size(this->document()->size().toSize()); this->fitted_height = document_size.height(); this->updateGeometry(); } The size policy of the QTextEdit sub-class is: this->setSizePolicy(QSizePolicy::MinimumExpanding, QSizePolicy::Preferred); I took this approach after reading this post. Here is my problem: As the QTextEdit gradually resizes to fill the window, it stops getting larger and starts scrolling within the QTextEdit, no matter what height is returned from sizeHint(). If I initially have sizeHint() return some large constant number, then the QTextEdit is very big and is contained nicely within the outer QScrollArea, as one would expect. However, if sizeHint gradually adjusts the size of the QTextEdit rather than just making it really big to start, then it tops out when it fills the current window and starts scrolling instead of growing. I have traced this problem to be that, no matter what my sizeHint() returns, it will never resize the QTextEdit larger than the value returned from maximumViewportSize(), which is inherited from QAbstractScrollArea. Note that this is not the same number as viewport()-maximumSize(). I am unable to figure out how to set that value. Looking at QT's source code, maximumViewportSize() is returning "the size of the viewport as if the scroll bars had no valid scrolling range." This value is basically computed as the current size of the widget minus (2 * frameWidth + margins) plus any scrollbar widths/heights. This does not make a lot of sense to me, and it's not clear to me why that number would be used anywhere in a way that supercede's the sub-class's sizeHint() implementation. Also, it does seem odd that the single "frameWidth" integer is used in computing both the width and the height. Can anyone please shed some light on this? I suspect that my poor understanding of QT's layout engine is to blame here.

    Read the article

  • WPF Data Binding won't work

    - by Tokk
    Hey, I have got an UserControll with a DependencyProperty called "Risikobewertung" whitch has the own Datatype "RisikoBewertung"(Datatype created by LINQ). So in my Controll I try to bind the Fields of RisikoBewertung to the TextBoxes on the Controll, but It won't work. I hope you can help me, and tell me why ;) Code: UserControl.xaml: <UserControl x:Class="Cis.Modules.RiskManagement.Views.Controls.RisikoBewertungEditor" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:gridtools="clr-namespace:TmgUnity.Common.Presentation.Controls.DataGridTools;assembly=TmgUnity.Common.Presentation" xmlns:converter="clr-namespace:Cis.Modules.RiskManagement.Views.Converter" xmlns:tmg="clr-namespace:TmgUnity.Common.Presentation.Controls.FilterDataGrid;assembly=TmgUnity.Common.Presentation" xmlns:validators="clr-namespace:TmgUnity.Common.Presentation.ValidationRules;assembly=TmgUnity.Common.Presentation" xmlns:toolkit="http://schemas.microsoft.com/wpf/2008/toolkit" xmlns:risikoControls="clr-namespace:Cis.Modules.RiskManagement.Views.Controls"> <UserControl.Resources> <converter:CountToArrowConverter x:Key="CountConverter" /> </UserControl.Resources> <Grid> <Grid.ColumnDefinitions> <ColumnDefinition Name="Veränderung"/> <ColumnDefinition Name="Volumen" /> <ColumnDefinition Name="Schadenshöhe" /> <ColumnDefinition Name="SchadensOrte" /> <ColumnDefinition Name="Wahrscheinlichkeit" /> <ColumnDefinition Name="Kategorie" /> <ColumnDefinition Name="Handlungsbedarf" /> </Grid.ColumnDefinitions> <Grid.RowDefinitions> <RowDefinition Height="20" /> <RowDefinition /> </Grid.RowDefinitions> <Image Source="{Binding Path=Entwicklung, Converter={StaticResource CountConverter}, UpdateSourceTrigger=PropertyChanged}" Grid.RowSpan="2" Grid.Row="0" Width="68" Height="68" Grid.Column="0" /> <TextBox Grid.Column="1" Grid.Row="0" Text="Volumen" /> <TextBox Grid.Column="1" Grid.Row="1"> <TextBox.Text> <Binding Path="Volumen" UpdateSourceTrigger="PropertyChanged" /> </TextBox.Text> </TextBox> <TextBox Grid.Column="2" Grid.Row="0" Text="Schadenshöhe" /> <TextBox Grid.Column="2" Grid.Row="1" Text="{Binding Path=Schadenshöhe, UpdateSourceTrigger=PropertyChanged}" /> <StackPanel Grid.Column="3" Grid.RowSpan="2" Grid.Row="0" Orientation="Horizontal"> <Grid> <Grid.RowDefinitions> <RowDefinition Height="20" /> <RowDefinition /> </Grid.RowDefinitions> <Grid.ColumnDefinitions> <ColumnDefinition /> <ColumnDefinition /> <ColumnDefinition /> </Grid.ColumnDefinitions> <TextBox Text ="Politik" Grid.Row="0" Grid.Column="0"/> <CheckBox Name="Politik" Grid.Row="1" Grid.Column="0" IsChecked="{Binding Path=Politik, UpdateSourceTrigger=PropertyChanged}" VerticalAlignment="Center" HorizontalAlignment="Center" /> <TextBox Text ="Vermögen" Grid.Row="0" Grid.Column="1" /> <CheckBox Name="Vermögen" Grid.Row="1" Grid.Column="1" IsChecked="{Binding Path=Vermögen, UpdateSourceTrigger=PropertyChanged}" VerticalAlignment="Center" HorizontalAlignment="Center" /> <TextBox Text ="Vertrauen" Grid.Row="0" Grid.Column="2" /> <CheckBox Name="Vertrauen" Grid.Row="1" Grid.Column="2" IsChecked="{Binding Path=Vertrauen, UpdateSourceTrigger=PropertyChanged}" VerticalAlignment="Center" HorizontalAlignment="Center" /> </Grid> </StackPanel> <TextBox Grid.Column="4" Grid.Row="0" Text="Wahrscheinlichkeit" /> <TextBox Grid.Column="4" Grid.Row="1" Text="{Binding Path=Wahrscheinlichkeit, UpdateSourceTrigger=PropertyChanged}"/> <risikoControls:RiskTrafficLightControl Grid.Column="5" Grid.Row="0" Grid.RowSpan="2" RiskValue="{Binding Path=Kategorie, Mode=TwoWay, UpdateSourceTrigger=PropertyChanged}" /> <StackPanel Grid.Column="6" Grid.RowSpan="2" Grid.Row="0" Orientation="Vertical"> <TextBox Text="Handlungsbedarf" /> <CheckBox VerticalAlignment="Center" HorizontalAlignment="Center" IsChecked="{Binding Path=Handlungsbedarf, UpdateSourceTrigger=PropertyChanged}" /> </StackPanel> </Grid> The CodeBehind: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Windows; using System.Windows.Controls; using System.Windows.Data; using System.Windows.Documents; using System.Windows.Input; using System.Windows.Media; using System.Windows.Media.Imaging; using System.Windows.Navigation; using System.Windows.Shapes; using System.ComponentModel; using Cis.Modules.RiskManagement.Data; using Cis.Modules.RiskManagement.Views.Models; namespace Cis.Modules.RiskManagement.Views.Controls { /// <summary> /// Interaktionslogik für RisikoBewertungEditor.xaml /// </summary> public partial class RisikoBewertungEditor : UserControl, INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public static readonly DependencyProperty RisikoBewertungProperty = DependencyProperty.Register("RisikoBewertung", typeof(RisikoBewertung), typeof(RisikoBewertungEditor), new PropertyMetadata(null, new PropertyChangedCallback(RisikoBewertungChanged))); // public static readonly DependencyProperty Readonly = DependencyProperty.Register("EditorReadonly", typeof(Boolean), typeof(RisikoBewertungEditor), new PropertyMetadata(null, new PropertyChangedCallback(ReadonlyChanged))); private static void RisikoBewertungChanged(DependencyObject dependencyObject, DependencyPropertyChangedEventArgs arguments) { var bewertungEditor = dependencyObject as RisikoBewertungEditor; bewertungEditor.RisikoBewertung = arguments.NewValue as RisikoBewertung; } /* private static void ReadonlyChanged(DependencyObject dependencyObject, DependencyPropertyChangedEventArgs arguments) { } */ public RisikoBewertung RisikoBewertung { get { return GetValue(RisikoBewertungProperty) as RisikoBewertung; } set { SetValue(RisikoBewertungProperty, value); if (PropertyChanged != null) { PropertyChanged(this, new PropertyChangedEventArgs("RisikoBewertung")); } } } /* public Boolean EditorReadonly { get; set; } */ public void mebosho(object sender, RoutedEventArgs e) { MessageBox.Show(RisikoBewertung.LfdNr.ToString()); } public RisikoBewertungEditor() { InitializeComponent(); RisikoBewertung = new RisikoBewertung(); this.DataContext = (GetValue(RisikoBewertungProperty) as RisikoBewertung); } } } and a little example of it's usage: <tmg:FilterDataGrid Grid.Row="0" AutoGenerateColumns="False" ItemsSource="{Binding TodoListe}" IsReadOnly="False" x:Name="TodoListeDataGrid" CanUserAddRows="False" SelectionUnit="FullRow" SelectedValuePath="." SelectedValue="{Binding CurrentTodoItem}" gridtools:DataGridStyle.SelectAllButtonTemplate="{DynamicResource CisSelectAllButtonTemplate}" CanUserResizeColumns="True" MinHeight="80" SelectionChanged="SelectionChanged" HorizontalAlignment="Stretch" VerticalAlignment="Stretch" diagnostics:PresentationTraceSources.TraceLevel="High" > <tmg:FilterDataGrid.RowDetailsTemplate> <DataTemplate> <risikoControls:RisikoBewertungEditor x:Name="BewertungEditor" RisikoBewertung="{Binding ElementName=TodoListeDataGrid, Path=SelectedValue}" diagnostics:PresentationTraceSources.TraceLevel="High"> </risikoControls:RisikoBewertungEditor> </DataTemplate> </tmg:FilterDataGrid.RowDetailsTemplate> <tmg:FilterDataGrid.Columns> <toolkit:DataGridTextColumn Binding="{Binding Path=LfdNr}" Header="LfdNr" /> </tmg:FilterDataGrid.Columns> </tmg:FilterDataGrid>

    Read the article

  • How do I verify a DKIM signature in PHP?

    - by angrychimp
    I'll admit I'm not very adept at key verification. What I have is a script that downloads messages from a POP3 server, and I'm attempting to verify the DKIM signatures in PHP. I've already figured out the body hash (bh) validation check, but I can't figure out the header validation. http://www.dkim.org/specs/rfc4871-dkimbase.html#rfc.section.6.1.3 Below is an example of my message headers. I've been able to use the Mail::DKIM package to validate the signature in Perl, so I know it's good. I just can't seem to figure out the instructions in the RFC and translate them into PHP code. DomainKey-Signature: q=dns; a=rsa-sha1; c=nofws; s=angrychimp-1.bh; d=angrychimp.net; h=From:X-Outgoing; b=RVkenibHQ7GwO5Y3tun2CNn5wSnooBSXPHA1Kmxsw6miJDnVp4XKmA9cUELwftf9 nGiRCd3rLc6eswAcVyNhQ6mRSsF55OkGJgDNHiwte/pP5Z47Lo/fd6m7rfCnYxq3 DKIM-Signature: v=1; a=rsa-sha1; d=angrychimp.net; s=angrychimp-1.bh; c=relaxed/simple; q=dns/txt; [email protected]; t=1268436255; h=From:Subject:X-Outgoing:Date; bh=gqhC2GEWbg1t7T3IfGMUKzt1NCc=; b=ZmeavryIfp5jNDIwbpifsy1UcavMnMwRL6Fy6axocQFDOBd2KjnjXpCkHxs6yBZn Wu+UCFeAP+1xwN80JW+4yOdAiK5+6IS8fiVa7TxdkFDKa0AhmJ1DTHXIlPjGE4n5; To: [email protected] Message-ID: From: DKIM Tester Reply-To: [email protected] Subject: Automated DKIM Testing (angrychimp.net) X-Outgoing: dhaka Date: Fri, 12 Mar 2010 15:24:15 -0800 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: quoted-printable Content-Disposition: inline MIME-Version: 1.0 Return-Path: [email protected] X-OriginalArrivalTime: 12 Mar 2010 23:25:50.0326 (UTC) FILETIME=[5A0ED160:01CAC23B] I can extract the public key from my DNS just fine, and I believe I'm canonicalizing the headers correctly, but I just can't get the signature validated. I don't think I'm preparing my key or computing the signature validation correctly. Is this something that's possible (do I need pear extensions or something?) or is manually validating a DKIM signature in PHP just not feasible?

    Read the article

  • Resultant of a polynomial with x^n–1

    - by devin.omalley
    Resultant of a polynomial with x^n–1 (mod p) I am implementing the NTRUSign algorithm as described in http://grouper.ieee.org/groups/1363/lattPK/submissions/EESS1v2.pdf , section 2.2.7.1 which involves computing the resultant of a polynomial. I keep getting a zero vector for the resultant which is obviously incorrect. private static CompResResult compResMod(IntegerPolynomial f, int p) { int N = f.coeffs.length; IntegerPolynomial a = new IntegerPolynomial(N); a.coeffs[0] = -1; a.coeffs[N-1] = 1; IntegerPolynomial b = new IntegerPolynomial(f.coeffs); IntegerPolynomial v1 = new IntegerPolynomial(N); IntegerPolynomial v2 = new IntegerPolynomial(N); v2.coeffs[0] = 1; int da = a.degree(); int db = b.degree(); int ta = da; int c = 0; int r = 1; while (db > 0) { c = invert(b.coeffs[db], p); c = (c * a.coeffs[da]) % p; IntegerPolynomial cb = b.clone(); cb.mult(c); cb.shift(da - db); a.sub(cb, p); IntegerPolynomial v2c = v2.clone(); v2c.mult(c); v2c.shift(da - db); v1.sub(v2c, p); if (a.degree() < db) { r *= (int)Math.pow(b.coeffs[db], ta-a.degree()); r %= p; if (ta%2==1 && db%2==1) r = (-r) % p; IntegerPolynomial temp = a; a = b; b = temp; temp = v1; v1 = v2; v2 = temp; ta = db; } da = a.degree(); db = b.degree(); } r *= (int)Math.pow(b.coeffs[0], da); r %= p; c = invert(b.coeffs[0], p); v2.mult(c); v2.mult(r); v2.mod(p); return new CompResResult(v2, r); } There is pseudocode in http://www.crypto.rub.de/imperia/md/content/texte/theses/da_driessen.pdf which looks very similar. Why is my code not working? Are there any intermediate results I can check? I am not posting the IntegerPolynomial code because it isn't too interesting and I have unit tests for it that pass. CompResResult is just a simple "Java struct".

    Read the article

  • Which mobile operating system should I code for?

    - by samgoody
    It seems as though mobile computing has fully arrived. I would like to rewrite two of our programs for mobile devices, but am a bit lost as to which platform to target. Complicating this decision: I would need to learn the relevant languages and IDEs - my coding to date has been almost all web based (PHP, JS, Actionscript, etc. Some ASPX). Most users seem to be religious about their mobile decision, so oral conversations leave me more confused then enlightened. I do not yet own a smartphone - will have to buy one once I know which platform to be aiming for. Both of my programs are more for business users, (one is only useful for C.P.A.s). I am a single developer, and cannot develop for more than one platform at a time. Getting it right is important. Based on what I've found on the web, I would've expected RIM to be a shoo-in, and the general order to be as follows: RIM Blackberry - More of them than any other brand. Despite naysayers, they've had double the sales (or perhaps 5X the sales) of any other smartphone, and have continued to grow. And, they have business users. Android - According to Schmidt, they have outsold everyone else except RIM (though I can't find where I read that now), and they are just getting started. According to Comscore, they are already at 8% of the market and expected to hit Shcmidt's claims within six months. Nokia - The largest worldwide. If they would just make up between Maemo or Symbian, I would be far less confused. iPhone - Much more competition by other apps, fewer sales to be had, and a overlord that can delay or cancel my app at any time. Is Cocoa hard to learn? Windows Mobile - Word is that version 7 will not be backwards compatible and losing market share. Palm WebOS - Perhaps this should go first, as it is the only one that offers tools to make my life easy as a web application developer. No competition in marketplace. But not very many users either. However, a search on StackOverflow shows a hugely disproportionate number of iPhone questions versus Blackberry. Likewise, there are clearly more apps on iPhone, so it must be getting developer love. What is the one platform I should develop for? Please back up your answer with the logic.

    Read the article

  • Unable to verify body hash for DKIM

    - by Joshua
    I'm writing a C# DKIM validator and have come across a problem that I cannot solve. Right now I am working on calculating the body hash, as described in Section 3.7 Computing the Message Hashes. I am working with emails that I have dumped using a modified version of EdgeTransportAsyncLogging sample in the Exchange 2010 Transport Agent SDK. Instead of converting the emails when saving, it just opens a file based on the MessageID and dumps the raw data to disk. I am able to successfully compute the body hash of the sample email provided in Section A.2 using the following code: SHA256Managed hasher = new SHA256Managed(); ASCIIEncoding asciiEncoding = new ASCIIEncoding(); string rawFullMessage = File.ReadAllText(@"C:\Repositories\Sample-A.2.txt"); string headerDelimiter = "\r\n\r\n"; int headerEnd = rawFullMessage.IndexOf(headerDelimiter); string header = rawFullMessage.Substring(0, headerEnd); string body = rawFullMessage.Substring(headerEnd + headerDelimiter.Length); byte[] bodyBytes = asciiEncoding.GetBytes(body); byte[] bodyHash = hasher.ComputeHash(bodyBytes); string bodyBase64 = Convert.ToBase64String(bodyHash); string expectedBase64 = "2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8="; Console.WriteLine("Expected hash: {1}{0}Computed hash: {2}{0}Are equal: {3}", Environment.NewLine, expectedBase64, bodyBase64, expectedBase64 == bodyBase64); The output from the above code is: Expected hash: 2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8= Computed hash: 2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8= Are equal: True Now, most emails come across with the c=relaxed/relaxed setting, which requires you to do some work on the body and header before hashing and verifying. And while I was working on it (failing to get it to work) I finally came across a message with c=simple/simple which means that you process the whole body as is minus any empty CRLF at the end of the body. (Really, the rules for Body Canonicalization are quite ... simple.) Here is the real DKIM email with a signature using the simple algorithm (with only unneeded headers cleaned up). Now, using the above code and updating the expectedBase64 hash I get the following results: Expected hash: VnGg12/s7xH3BraeN5LiiN+I2Ul/db5/jZYYgt4wEIw= Computed hash: ISNNtgnFZxmW6iuey/3Qql5u6nflKPTke4sMXWMxNUw= Are equal: False The expected hash is the value from the bh= field of the DKIM-Signature header. Now, the file used in the second test is a direct raw output from the Exchange 2010 Transport Agent. If so inclined, you can view the modified EdgeTransportLogging.txt. At this point, no matter how I modify the second email, changing the start position or number of CRLF at the end of the file I cannot get the files to match. What worries me is that I have been unable to validate any body hash so far (simple or relaxed) and that it may not be feasible to process DKIM through Exchange 2010.

    Read the article

  • ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to work?

    - by ?????
    It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

    Read the article

  • How to split HTML code with javascript or JQuery

    - by Dean
    Hi I'm making a website using JSP and servlets and I have to now break up a list of radio buttons to insert a textarea and a button. I have got the button and textarea to hide and show when you click on the radio button it shows the text area and button. But this only appears at the top and when there are hundreds on the page this will become awkward so i need a way for it to appear underneath. Here is what my HTML looks like when complied: <form action="addSpotlight" method="POST"> <table> <tr><td><input type="radio" value="29" name="publicationIDs" ></td><td>A System For Dynamic Server Allocation in Application Server Clusters, IEEE International Symposium on Parallel and Distributed Processsing with Applications, 2008</td> </tr> <tr><td><input type="radio" value="30" name="publicationIDs" ></td><td>Analysing BitTorrent's Seeding Strategies, 7th IEEE/IFIP International Conference on Embedded and Ubiquitous Computing (EUC-09), 2009</td> </tr> <tr><td><input type="radio" value="31" name="publicationIDs" ></td><td>The Effect of Server Reallocation Time in Dynamic Resource Allocation, UK Performance Engineering Workshop 2009, 2009</td> </tr> <tr><td><input type="radio" value="32" name="publicationIDs" ></td><td>idk, hello, 1992</td> </tr> <tr><td><input type="radio" value="33" name="publicationIDs" ></td><td>sad, safg, 1992</td> </tr> <div class="abstractWriteup"><textarea name="abstract"></textarea> <input type="submit" value="Add Spotlight"></div> </table> </form> Now here is what my JSP looks like: <form action="addSpotlight" method="POST"> <table> <%int i = 0; while(i<ids.size()){%> <tr><td><input type="radio" value="<%=ids.get(i)%>" name="publicationIDs" ></td><td><%=info.get(i)%></td> </tr> <%i++; }%> <div class="abstractWriteup"><textarea name="abstract"></textarea> <input type="submit" value="Add Spotlight"></div> </table> </form> Thanks in Advance Dean

    Read the article

  • Advice for Architecture Design Logic for software application

    - by Prasad
    Hi, I have a framework of basic to complex set of objects/classes (C++) running into around 500. With some rules and regulations - all these objects can communicate with each other and hence can cover most of the common queries in the domain. My Dream: I want to provide these objects as icons/glyphs (as I learnt recently) on a workspace. All these objects can be dragged/dropped into the workspace. They have to communicate only through their methods(interface) and in addition to few iterative and conditional statements. All these objects are arranged finally to execute a protocol/workflow/dataflow/process. After drawing the flow, the user clicks the Execute/run button. All the user interaction should be multi-touch enabled. The best way to show my dream is : Jeff Han's Multitouch Video. consider Jeff is playing with my objects instead of the google maps. :-) it should be like playing a jigsaw puzzle. Objective: how can I achieve the following while working on this final product: a) the development should be flexible to enable provision for web services b) the development should enable easy web application development c) The development should enable client-server architecture - d) further it should also enable mouse based drag/drop desktop application like Adobe programs etc. I mean to say: I want to economize on investments. Now I list my efforts till now in design : a) Created an Editor (VB) where the user writes (manually) the object / class code b) On Run/Execute, the code is copied into a main() function and passed to interpreter. c) Catch the output and show it in the console. The interpreter can be separated to become a server and the Editor can become the client. This needs lot of standard client-server architecture work. But some how I am not comfortable in the tightness of this system. Without interpreter is there much faster and better embeddable solution to this? - other than writing a special compiler for these objects. Recently learned about AXIS-C++ can help me - looks like - a friend suggested. Is that the way to go ? Here are my questions: (pl. consider me a self taught programmer and NOT my domain) a) From the stage of C++ objects to multi-touch product, how can I make sure I will develop the parallel product/service models as well.? What should be architecture aspects I should consider ? b) What technologies are best suited for this? c) If I am thinking of moving to Cloud Computing, how difficult/ how redundant / how unnecessary my efforts will be ? d) How much time in months would it take to get the first beta ? I take the liberty to ask if any of the experts here are interested in this project, please email me: [email protected] Thank you for any help. Looking forward.

    Read the article

  • fit a ellipse in Python given a set of points xi=(xi,yi)

    - by Gianni
    I am computing a series of index from a 2D points (x,y). One index is the ratio between minor and major axis. To fit the ellipse i am using the following post when i run these function the final results looks strange because the center and the axis length are not in scale with the 2D points center = [ 560415.53298363+0.j 6368878.84576771+0.j] angle of rotation = (-0.0528033467597-5.55111512313e-17j) axes = [0.00000000-557.21553487j 6817.76933256 +0.j] thanks in advance for help import numpy as np from numpy.linalg import eig, inv def fitEllipse(x,y): x = x[:,np.newaxis] y = y[:,np.newaxis] D = np.hstack((x*x, x*y, y*y, x, y, np.ones_like(x))) S = np.dot(D.T,D) C = np.zeros([6,6]) C[0,2] = C[2,0] = 2; C[1,1] = -1 E, V = eig(np.dot(inv(S), C)) n = np.argmax(np.abs(E)) a = V[:,n] return a def ellipse_center(a): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] num = b*b-a*c x0=(c*d-b*f)/num y0=(a*f-b*d)/num return np.array([x0,y0]) def ellipse_angle_of_rotation( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] return 0.5*np.arctan(2*b/(a-c)) def ellipse_axis_length( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] up = 2*(a*f*f+c*d*d+g*b*b-2*b*d*f-a*c*g) down1=(b*b-a*c)*( (c-a)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) down2=(b*b-a*c)*( (a-c)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) res1=np.sqrt(up/down1) res2=np.sqrt(up/down2) return np.array([res1, res2]) if __name__ == '__main__': points = [(560036.4495758876, 6362071.890493258), (560036.4495758876, 6362070.890493258), (560036.9495758876, 6362070.890493258), (560036.9495758876, 6362070.390493258), (560037.4495758876, 6362070.390493258), (560037.4495758876, 6362064.890493258), (560036.4495758876, 6362064.890493258), (560036.4495758876, 6362063.390493258), (560035.4495758876, 6362063.390493258), (560035.4495758876, 6362062.390493258), (560034.9495758876, 6362062.390493258), (560034.9495758876, 6362061.390493258), (560032.9495758876, 6362061.390493258), (560032.9495758876, 6362061.890493258), (560030.4495758876, 6362061.890493258), (560030.4495758876, 6362061.390493258), (560029.9495758876, 6362061.390493258), (560029.9495758876, 6362060.390493258), (560029.4495758876, 6362060.390493258), (560029.4495758876, 6362059.890493258), (560028.9495758876, 6362059.890493258), (560028.9495758876, 6362059.390493258), (560028.4495758876, 6362059.390493258), (560028.4495758876, 6362058.890493258), (560027.4495758876, 6362058.890493258), (560027.4495758876, 6362058.390493258), (560026.9495758876, 6362058.390493258), (560026.9495758876, 6362057.890493258), (560025.4495758876, 6362057.890493258), (560025.4495758876, 6362057.390493258), (560023.4495758876, 6362057.390493258), (560023.4495758876, 6362060.390493258), (560023.9495758876, 6362060.390493258), (560023.9495758876, 6362061.890493258), (560024.4495758876, 6362061.890493258), (560024.4495758876, 6362063.390493258), (560024.9495758876, 6362063.390493258), (560024.9495758876, 6362064.390493258), (560025.4495758876, 6362064.390493258), (560025.4495758876, 6362065.390493258), (560025.9495758876, 6362065.390493258), (560025.9495758876, 6362065.890493258), (560026.4495758876, 6362065.890493258), (560026.4495758876, 6362066.890493258), (560026.9495758876, 6362066.890493258), (560026.9495758876, 6362068.390493258), (560027.4495758876, 6362068.390493258), (560027.4495758876, 6362068.890493258), (560027.9495758876, 6362068.890493258), (560027.9495758876, 6362069.390493258), (560028.4495758876, 6362069.390493258), (560028.4495758876, 6362069.890493258), (560033.4495758876, 6362069.890493258), (560033.4495758876, 6362070.390493258), (560033.9495758876, 6362070.390493258), (560033.9495758876, 6362070.890493258), (560034.4495758876, 6362070.890493258), (560034.4495758876, 6362071.390493258), (560034.9495758876, 6362071.390493258), (560034.9495758876, 6362071.890493258), (560036.4495758876, 6362071.890493258)] a_points = np.array(points) x = a_points[:, 0] y = a_points[:, 1] from pylab import * plot(x,y) show() a = fitEllipse(x,y) center = ellipse_center(a) phi = ellipse_angle_of_rotation(a) axes = ellipse_axis_length(a) print "center = ", center print "angle of rotation = ", phi print "axes = ", axes from pylab import * plot(x,y) plot(center[0:1],center[1:], color = 'red') show() each vertex is a xi,y,i point plot of 2D point and center of fit ellipse

    Read the article

  • ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to compile and run?

    - by ?????
    It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap Now here's something interesting. The error message shows it's looking in /opt/local/lib/libiconv.2.dylib. otools -L shows that this does implement 8.0.0: tppllc-Mac-Pro:.libs swirsky$ otool -L /opt/local/lib/libiconv.2.dylib /opt/local/lib/libiconv.2.dylib: /usr/local/lib/libiconv.2.dylib (compatibility version 8.0.0, current version 8.0.0) /usr/lib/libSystem.B.dylib (compatibility version 1.0.0, current version 125.0.0) tppllc-Mac-Pro:.libs swirsky$ And, for good measure, I set the DYLD_LIBRARY_PATH to make sure this directory is the one for dynamic libraries. So even though I do have a library that provides 8.0.0, it's being seen as 7.0.0! Any ideas why this would happen? So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

    Read the article

  • http server implentation, the page does not show properly

    - by none
    well, as i am doing a small project of coding an http server. the code is at http://code.google.com/p/reactor/ the current puzzle is when asked to parse a page with java script and css. As an http server it just sends a page (copied from another website) and it parsed inproperly. when a simple html page is been parse , by my firefox, it shows ok, however when parsing a more complex page(css+javascript) the page is all wired like this : ???? ????? if(getCookie('pais999')==null){varisToplayerDouble="True";isToplayerDouble=(isToplayerDouble=="True")?true:falsevarToplayerCookieName='pais999';varTopLayerCookieExpiredDays=1;varToplayerLink='http://xads.zedo.com/ads2/c?a=239671;g=0;c=455000000;i=0;x=7168;n=455;s=0;k=http://www.pais.co.il/Pais/Games/Lotto/';varToplayerImpression='http://l4.zedo.com/log/p.gif?a=239671;c=455000000;x=7168;n=455;e=i;i=0;s=0;z='+Math.random();varToplayerBigPath='pais/January2007/98one_toplayer.swf';varToplayerSmallPath='pais/January2007/98one_reminder.swf';varToplayerBigWidth=1005;varToplayerBigHeight=500;varToplayerSmallWidth=100;varToplayerSmallHeight=100;varToplayerBigLeft=(0==0)?resWidth/2-ToplayerBigWidth/2:resWidth/2-ToplayerBigWidth/2+0varToplayerBigTop=0;varToplayerSmallLeft=resWidth-ToplayerSmallWidth-0;varToplayerSmallTop=0;varSecondsToChangeBigToSmall=15;}elseif(getCookie('NF999')==null){varisToplayerDouble="True";isToplayerDouble=(isToplayerDouble=="True")?true:falsevarToplayerCookieName='NF999';varTopLayerCookieExpiredDays=1;varToplayerLink='http://xads.zedo.com/ads2/c?a=238663;g=0;c=455000000;i=0;x=7168;n=455;s=0;k=http://www.new-pharm.co.il/SkiGame/?ToolID=OLJD8O';varToplayerImpression='http://l4.zedo.com/log/p.gif?a=238663;c=455000000;x=7168;n=455;e=i;i=0;s=0;z='+Math.random();varToplayerBigPath='NewFarm/Ski/995ONE_TopLayer_550x360.swf';varToplayerSmallPath='NewFarm/Ski/995ONE_Reminder_100x100.swf';varToplayerBigWidth=550;varToplayerBigHeight=360;varToplayerSmallWidth=100;varToplayerSmallHeight=100;varToplayerBigLeft=(0==0)?resWidth/2-ToplayerBigWidth/2:resWidth/2-ToplayerBigWidth/2+0varToplayerBigTop=0;varToplayerSmallLeft=resWidth-ToplayerSmallWidth-0;varToplayerSmallTop=0;varSecondsToChangeBigToSmall=15;}elseif(1==0){}$("divToplayerBig").style.width=ToplayerBigWidth;$("divToplayerBig").style.height=ToplayerBigHeight;$("divToplayerBig").style.left=resWidth/2-ToplayerBigWidth/2;$("divToplayerSmall").style.width=ToplayerSmallWidth;$("divToplayerSmall").style.height=ToplayerSmallHeight;$("divToplayerSmall").style.right=ToplayerSmallWidthvartopOff=0;if(ToplayerBigTop0)topOff=resHeight-ToplayerBigHeight+ToplayerBigTop;varisMain=false;#divToplayerBig{position:absolute;right:20px;bottom:1px;}bodydiv#divToplayerBig{position:fixed;}#divToplayerSmall{position:absolute;right:20px;bottom:10px;}bodydiv#divToplayerSmall{position:fixed;}????|??????LIVE|???????????|ONE???????|ONETV |????'??|BigONE|?????????| CrazyONE | where the source code of the html is : ONE:???:??????????????????????????? ????  ????? if(getCookie('pais999')==null){varisToplayerDouble="True";isToplayerDouble=(isToplayerDouble=="True")?true:falsevarToplayerCookieName='pais999';varTopLayerCookieExpiredDays=1;varToplayerLink='http://xads.zedo.com/ads2/c?a=239671;g=0;c=455000000;i=0;x=7168;n=455;s=0;k=http://www.pais.co.il/Pais/Games/Lotto/';varToplayerImpression='http://l4.zedo.com/log/p.gif?a=239671;c=455000000;x=7168;n=455;e=i;i=0;s=0;z='+Math.random();varToplayerBigPath='pais/January2007/98one_toplayer.swf';varToplayerSmallPath='pais/January2007/98one_reminder.swf';varToplayerBigWidth=1005;varToplayerBigHeight=500;varToplayerSmallWidth=100;varToplayerSmallHeight=100;varToplayerBigLeft=(0==0)?resWidth/2-ToplayerBigWidth/2:resWidth/2-ToplayerBigWidth/2+0varToplayerBigTop=0;varToplayerSmallLeft=resWidth-ToplayerSmallWidth-0;varToplayerSmallTop=0;varSecondsToChangeBigToSmall=15;}elseif(getCookie('NF999')==null){varisToplayerDouble="True";isToplayerDouble=(isToplayerDouble=="True")?true:falsevarToplayerCookieName='NF999';varTopLayerCookieExpiredDays=1;varToplayerLink='http://xads.zedo.com/ads2/c?a=238663;g=0;c=455000000;i=0;x=7168;n=455;s=0;k=http://www.new-pharm.co.il/SkiGame/?ToolID=OLJD8O';varToplayerImpression='http://l4.zedo.com/log/p.gif?a=238663;c=455000000;x=7168;n=455;e=i;i=0;s=0;z='+Math.random();varToplayerBigPath='NewFarm/Ski/995ONE_TopLayer_550x360.swf';varToplayerSmallPath='NewFarm/Ski/995ONE_Reminder_100x100.swf';varToplayerBigWidth=550;varToplayerBigHeight=360;varToplayerSmallWidth=100;varToplayerSmallHeight=100;varToplayerBigLeft=(0==0)?resWidth/2-ToplayerBigWidth/2:resWidth/2-ToplayerBigWidth/2+0varToplayerBigTop=0;varToplayerSmallLeft=resWidth-ToplayerSmallWidth-0;varToplayerSmallTop=0;varSecondsToChangeBigToSmall=15;}elseif(1==0){}$("divToplayerBig").style.width=ToplayerBigWidth;$("divToplayerBig").style.height=ToplayerBigHeight;$("divToplayerBig").style.left=resWidth/2-ToplayerBigWidth/2;$("divToplayerSmall").style.width=ToplayerSmallWidth;$("divToplayerSmall").style.height=ToplayerSmallHeight;$("divToplayerSmall").style.right=ToplayerSmallWidthvartopOff=0;if(ToplayerBigTop0)topOff=resHeight-ToplayerBigHeight+ToplayerBigTop;varisMain=false;#divToplayerBig{position:absolute;right:20px;bottom:1px;}bodydiv#divToplayerBig{position:fixed;}div#divToplayerBig{right:auto;bottom:auto;left:expression((-20-divToplayerBig.offsetWidth+(document.documentElement.clientWidth?document.documentElement.clientWidth:document.body.clientWidth)+(ignoreMe2=document.documentElement.scrollLeft?document.documentElement.scrollLeft:document.body.scrollLeft))+'px');top:expression((0-divToplayerBig.offsetHeight-topOff+(document.documentElement.clientHeight?document.documentElement.clientHeight:document.body.clientHeight)+(ignoreMe=document.documentElement.scrollTop?document.documentElement.scrollTop:document.body.scrollTop))+'px');}#divToplayerSmall{position:absolute;right:20px;bottom:10px;}bodydiv#divToplayerSmall{position:fixed;}div#divToplayerSmall{right:auto;bottom:auto;left:expression((-20-divToplayerSmall.offsetWidth+(document.documentElement.clientWidth?document.documentElement.clientWidth:document.body.clientWidth)+(ignoreMe2=document.documentElement.scrollLeft?document.documentElement.scrollLeft:document.body.scrollLeft))+'px');top:expression((0-divToplayerSmall.offsetHeight+(document.documentElement.clientHeight?document.documentElement.clientHeight:document.body.clientHeight)+(ignoreMe=document.documentElement.scrollTop?document.documentElement.scrollTop:document.body.scrollTop))+'px');}varisTopTrans=(ToplayerBigPath.indexOf("transparent")-1)?false:true;varisRemTrans=(ToplayerSmallPath.indexOf("transparent")-1)?false:true;vartop1session=3;vartop2session=5;InitToplayer(isTopTrans,isRemTrans);window.onload=StartToplayer;????|??????LIVE|???????????|ONE???????|ONETV |????'??|BigONE|?????????|  CrazyONE |????????????????????????????????????????????????????????19/01/07  19:30?????????????????????-?????:?????????????????????????19/01/07  18:43??????????????:??????????????????????19/01/07  17:41???:??????????????????????????????????19/01/07  16:49?????:??????"?????????????/?????1:2,??????"??????19/01/07  16:45????????????????????????????,?????2.5???????????????19/01/07  16:37???????:???"?????????????????-19:30?????????????19/01/07  14:32?????"?????????-18:30?????????"????????,????'??????19/01/07  14:45????????????????????????????????"?:??????????????19/01/07  14:37??????????:??????????????????????????????0:019/01/07  13:46varswfPeleSmall=newSWFObject("http://images.one.co.il/images/PeleEmulator/emulator_pelephone_01a.swf","peleSmall",160,470,"6","#FFFFFF");swfPeleSmall.addParam("quality","high");swfPeleSmall.addParam("wmode","transparent");swfPeleSmall.write("divPeleSmall");varswfPeleBig=newSWFObject("http://images.one.co.il/images/PeleEmulator/emulator_pelephone_02d.swf","peleBig",400,470,"6","#FFFFFF");swfPeleBig.addParam("quality","high");swfPeleBig.addParam("wmode","transparent");swfPeleBig.write("divWithBig");???:???????????????????????????????????????-ONE????????????????????????????????????????????.????????,???????????1:2,?????????????:"???????????"DisplayFlash("W_S_round_border_pic.swf","156","201","1","style=position:absolute");?????????????????????????(??????)?????????                          19/01/20077:26???????????????(????)????????????????????????????6:3,5:7?-5:7???????????????????????,???????23?????.?????,????????????????????????????????,???????????????????????????????????????????,????????????????????.??????????????????????????,??????????????????????????.????????????????????????????-1:1?????????.?????????????????????????????'?????????????????????????????.?????????????.???????????????????????????????(16???????),???????????????????????????????????????3???????,???????????????????????.????????- (only part of of the page presentation in firefox and page source html) why is it happening? what is midding in the http response? StringBuffer tResponse = new StringBuffer(); tResponse.append("HTTP/1.1 200 OK\n"); tResponse.append("Date: "+new Date().toString() +'\n'); tResponse.append("server: http-reactor/0.1-dev\n"); tResponse.append("last-Modified:"+ d.toString() +'\n'); tResponse.append("Content-Type: text/html; charset=windows-1255\n"); tResponse.append("Accept-Language: he; q=1.0, en; q=0.5:); tResponse.append("Content-Length: "+tFileContent.length()+'\n'); tResponse.append('\n'); tResponse.append(tFileContent); public StringBuffer FetchData(String FileName) throws FileNotFoundException{ StringBuffer tFileContent = new StringBuffer(); if (FileName.contains("../")) throw new SecurityException(); if (FileName.equals("/")) FileName = "\\index.html"; FileName.replace('/', '\\'); File f = new File(_root + FileName); Scanner scanner = new Scanner(f); while(scanner.hasNext()) tFileContent.append(scanner.next()); return generateResponse(tFileContent,f.lastModified()); } private StringBuffer generateResponse(StringBuffer tFileContent, long l) { StringBuffer tResponse = new StringBuffer(); Date d = new Date(l); tResponse.append("HTTP/1.1 200 OK\n"); tResponse.append("Date: "+new Date().toString() +'\n'); tResponse.append("server: http-reactor/0.1-dev\n"); tResponse.append("last-Modified:"+ d.toString() +'\n'); tResponse.append("Content-Type: text/html; charset=windows-1255\n"); tResponse.append("Accept-Language: he; q=1.0, en; q=0.5:); tResponse.append("Content-Length: "+tFileContent.length()+'\n'); tResponse.append('\n'); tResponse.append(tFileContent); return tResponse; }

    Read the article

  • segmented reduction with scattered segments

    - by Christian Rau
    I got to solve a pretty standard problem on the GPU, but I'm quite new to practical GPGPU, so I'm looking for ideas to approach this problem. I have many points in 3-space which are assigned to a very small number of groups (each point belongs to one group), specifically 15 in this case (doesn't ever change). Now I want to compute the mean and covariance matrix of all the groups. So on the CPU it's roughly the same as: for each point p { mean[p.group] += p.pos; covariance[p.group] += p.pos * p.pos; ++count[p.group]; } for each group g { mean[g] /= count[g]; covariance[g] = covariance[g]/count[g] - mean[g]*mean[g]; } Since the number of groups is extremely small, the last step can be done on the CPU (I need those values on the CPU, anyway). The first step is actually just a segmented reduction, but with the segments scattered around. So the first idea I came up with, was to first sort the points by their groups. I thought about a simple bucket sort using atomic_inc to compute bucket sizes and per-point relocation indices (got a better idea for sorting?, atomics may not be the best idea). After that they're sorted by groups and I could possibly come up with an adaption of the segmented scan algorithms presented here. But in this special case, I got a very large amount of data per point (9-10 floats, maybe even doubles if the need arises), so the standard algorithms using a shared memory element per thread and a thread per point might make problems regarding per-multiprocessor resources as shared memory or registers (Ok, much more on compute capability 1.x than 2.x, but still). Due to the very small and constant number of groups I thought there might be better approaches. Maybe there are already existing ideas suited for these specific properties of such a standard problem. Or maybe my general approach isn't that bad and you got ideas for improving the individual steps, like a good sorting algorithm suited for a very small number of keys or some segmented reduction algorithm minimizing shared memory/register usage. I'm looking for general approaches and don't want to use external libraries. FWIW I'm using OpenCL, but it shouldn't really matter as the general concepts of GPU computing don't really differ over the major frameworks.

    Read the article

  • MacPorts 1.8.2 fails to build db46 on Mac OS X 1.6.3

    - by themoch
    I'm trying to put a development environment on my Mac, and to do so I need to install several packages which require db46. When running sudo port install db46 I get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. I have removed my /usr/local folder completely and it does not seem to help.

    Read the article

  • Macports 1.8.2 fails to build db46 on os x 1.6.3

    - by themoch
    i'm trying to put a dev environment on my mac, and to do so i need to install several packages which require db46 when running sudo port install db46 i get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. i have removed my /usr/local folder completely and it does not seem to help

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • jQuery: Giving each matched element an unique ID

    - by AnGafraidh
    I am writing an 'inline translator' application to be used with a cloud computing platform to extend non-supported languages. The majority of this uses jQuery to find the text value, replace it with the translation, then append the element with a span tag that has an unique ID, to be used elsewhere within the application. The problem arises however, when there are more than one element, say , that have the exact same value to be translated (matched elements). What happens in the function in question is that it puts all matched elements in the same span, taking the second, third, fourth, etc. out of their parent tags. My code is pretty much like this example: <script src='jquery-1.4.2.js'></script> <script> jQuery.noConflict(); var uniqueID='asdfjkl'; jQuery(window).ready(function() { var myQ1 = jQuery("input[id~=test1]"); myClone=myQ1.clone(); myClone.val('Replaced this button'); myQ1.replaceWith('<span id='+uniqueID+'></span>'); jQuery('#'+uniqueID).append(myClone); }); </script> <table> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> &nbsp; <input id='test2' type='button' value="And so am I"></input> </tr></td> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> </tr></td> </table> As a workaround, I've experimented with using a loop to create a class for each span, rising in increment until jQuery("input[id~=test1]").length, but I can't seem to get anything I do to work. Is there any way to give each matched element an unique ID? My fluency in jQuery is being put to the test! Thanks for any help in advance. Aaron

    Read the article

  • Akka framework support for finding duplicate messages

    - by scala_is_awesome
    I'm trying to build a high-performance distributed system with Akka and Scala. If a message requesting an expensive (and side-effect-free) computation arrives, and the exact same computation has already been requested before, I want to avoid computing the result again. If the computation requested previously has already completed and the result is available, I can cache it and re-use it. However, the time window in which duplicate computation can be requested may be arbitrarily small. e.g. I could get a thousand or a million messages requesting the same expensive computation at the same instant for all practical purposes. There is a commercial product called Gigaspaces that supposedly handles this situation. However there seems to be no framework support for dealing with duplicate work requests in Akka at the moment. Given that the Akka framework already has access to all the messages being routed through the framework, it seems that a framework solution could make a lot of sense here. Here is what I am proposing for the Akka framework to do: 1. Create a trait to indicate a type of messages (say, "ExpensiveComputation" or something similar) that are to be subject to the following caching approach. 2. Smartly (hashing etc.) identify identical messages received by (the same or different) actors within a user-configurable time window. Other options: select a maximum buffer size of memory to be used for this purpose, subject to (say LRU) replacement etc. Akka can also choose to cache only the results of messages that were expensive to process; the messages that took very little time to process can be re-processed again if needed; no need to waste precious buffer space caching them and their results. 3. When identical messages (received within that time window, possibly "at the same time instant") are identified, avoid unnecessary duplicate computations. The framework would do this automatically, and essentially, the duplicate messages would never get received by a new actor for processing; they would silently vanish and the result from processing it once (whether that computation was already done in the past, or ongoing right then) would get sent to all appropriate recipients (immediately if already available, and upon completion of the computation if not). Note that messages should be considered identical even if the "reply" fields are different, as long as the semantics/computations they represent are identical in every other respect. Also note that the computation should be purely functional, i.e. free from side-effects, for the caching optimization suggested to work and not change the program semantics at all. If what I am suggesting is not compatible with the Akka way of doing things, and/or if you see some strong reasons why this is a very bad idea, please let me know. Thanks, Is Awesome, Scala

    Read the article

  • Double Layer DVD+R burning problem - I/O Error

    - by Mehper C. Palavuzlar
    I have a modern PC (Quad Core CPU, 4 GB RAM, Win7 Home Premium 64-bit) but I have a problem with burning .dvd images to Double Layer (8.5 GB) DVDs. I wasted too many DVD+R DL discs but to no avail. Here is a short explanation of what I did: I'm using ImgBurn v2.5.0.0 (latest version). I'm trying to burn an image file (.dvd) which is together with the related .iso file in the same folder. In ImgBurn, I select the file with .dvd extension, and set writing speed to 2.4x. Burning process starts normally, but around 7% of the process, it gives a I/O Write Error, which is as follows: I wasted 3 discs (Magic, Made in Taiwan, DVD+R DL, 8.5 GB) trying the same thing. My DVD writer is LG GH22NP20 with IDE connection type. I updated its firmware from 1.04 to 2.00 but no success in burning again. Then my cousin brought his LG (an older model) which, he claims, was successful in writing DL discs with the same brand (Magic). I plugged off my LG and plugged the older one in, and tried to burn the image again. It also gave an I/O Error even without standing till 7%. I tried another burning program (CloneCD), but failed again. Then I bought other brands (TDK and VERBATIM) and tried to burn the image. Burning process started successfully, but around 14% (for Verbatim) and 25% (for TDK) failed again. Here is a screeny from ImgBurn: I've burned lots of 4.7 GB DVD+Rs and DVD-Rs successfully, even without a single error, with this LG DVD writer, but this case is very bothering for me. What should I do? Should I buy a new DVD writer other than LG? Could this be related to Windows or my hardware configuration? Thanks for your help. Edit: My burner works on my cousin's machine. So the problem must be related to my system. What could be the reason? Latest news: I borrowed an external USB DVD writer from a friend, which is PHILIPS SPD3000CC (an old model). Guess what! It's burning DVD+R DLs successfully! How come an internal DVD writer of a brand new computer system cannot burn DL DVDs? Now I'm considering buying a new internal DVD writer with not IDE, but SATA connection...

    Read the article

  • Windows 7 extremely slow login, exchange performance, printer enumeration, etc...

    - by Jeff
    Background: I have a fresh copy of Windows 7 Professional x64 on a Dell Latitude E6500. The laptop has 8GB RAM, 250GB drive, and all Intel peripherals (net/wifi/graphics). All available Windows updates, as well as hardware drivers are installed. The IT folks where I work joined the computer to our Windows 2003-based Active Directory domain. There are no errors in any logs that we've looked at, and Group Policy templates appear to have applied properly. Problem: Every time I turn on or reboot the computer, it takes between 2 to 10 (all times are actual) minutes after successfully typing my username/password to get to my desktop. My login script does not always run. Sometimes I get a black screen, and a couple of minutes later the login script will pop up and take up to 10 minutes to complete. I can get around this by hitting cntrl-shift-esc and running explorer.exe from the Task Manager. The login script continues to hang, but I can minimize it and go on about my business. Either way, it generally throws errors prior to completing. I often get slow or failed connectivity to Exchange via Outlook. When I bring up printer dialogs, they take several minutes to populate, and block the calling app while doing so. Copies to SMB shares are very slow. On my home network, everything works fine. On both the work network and home network, I can use remote internet resources just fine. Web pages pull up, remote VPN's are fine, I can max out bandwidth on SpeakEasy Speed Test. I can get almost max bandwidth transferring FTP/HTTP over a LAN. Another symptom of the problem is that when I first log in, the work network shows as "Identifying" for a long time in the Network and Sharing Center, and will often then change to the name of the work domain, but say "Unauthenticated Network". Note that this computer previously ran Windows Vista with none of these problems. Attempts to Fix: Installed the Win7 admin pack Uninstalled/reinstalled all hardware drivers Verified Active Directory DNS settings (Vista works relatively well on the same network) Reset all TCP/IP settings on all adapters using the netsh commands to do so Disabled ipv6 on all adapters Disable wifi adapter while on work network Locked the network card to 100/Full, 1000/Full; also tried Auto Added various important addresses to hosts file (exchange, dns, ad) -- removed when didn't help My background is a jpeg (sounds unrelated but there is apparently a win7 login bug related to solid color background) More I have forgotten The IT staff at my company indicated they believe this is due to having Windows 2003 AD servers and not having any Windows 2008 R2 AD servers. Other than that, they have no advice or assistance to offer other than a rebuild (already tried that once with similar symptoms), or downgrade to Vista. Any thoughts out there?

    Read the article

  • Pulseaudio is no longer working in Debian Squeeze: 'Failed to open module "module-combine-sink": file not found'

    - by mattalexx
    I'm having a problem with pulseaudio. My machine crashed, and when I rebooted and ran pavucontrol, I got a "Connection Failed: Connection refused" dialog. When I run pulseaudio --log-level=info --log-target=stderr from the command line, I get the following output: [...] I: alsa-util.c: Error opening PCM device front:1: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC1D0c' failed (-2) I: alsa-util.c: Error opening PCM device hw:1: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC1D0c' failed (-2) I: alsa-util.c: Error opening PCM device iec958:1: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC1D0c' failed (-2) I: alsa-util.c: Error opening PCM device iec958:1: No such file or directory I: alsa-util.c: Failed to set hardware parameters on plug:iec958:1: Invalid argument I: alsa-util.c: Failed to set hardware parameters on plug:iec958:1: Invalid argument I: alsa-util.c: Failed to set hardware parameters on plug:iec958:1: Invalid argument I: alsa-util.c: Failed to set hardware parameters on plug:iec958:1: Invalid argument I: alsa-util.c: Failed to set hardware parameters on plug:iec958:1: Invalid argument I: (alsa-lib)pcm.c: Unknown PCM a52:1 I: alsa-util.c: Error opening PCM device a52:1: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:1 I: alsa-util.c: Error opening PCM device a52:1: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:1 I: alsa-util.c: Error opening PCM device a52:1: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:1 I: alsa-util.c: Error opening PCM device a52:1: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:1 I: alsa-util.c: Error opening PCM device a52:1: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:1 I: alsa-util.c: Error opening PCM device a52:1: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:1 I: alsa-util.c: Error opening PCM device a52:1: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:1 I: alsa-util.c: Error opening PCM device a52:1: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:1 I: alsa-util.c: Error opening PCM device a52:1: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:1 I: alsa-util.c: Error opening PCM device a52:1: No such file or directory I: (alsa-lib)confmisc.c: Unable to find definition 'cards.USB-Audio.pcm.hdmi.0:CARD=1,AES0=4,AES1=130,AES2=0,AES3=2' I: (alsa-lib)conf.c: function snd_func_refer returned error: No such file or directory I: (alsa-lib)conf.c: Evaluate error: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM hdmi:1 I: alsa-util.c: Error opening PCM device hdmi:1: No such file or directory I: (alsa-lib)confmisc.c: Unable to find definition 'cards.USB-Audio.pcm.hdmi.0:CARD=1,AES0=4,AES1=130,AES2=0,AES3=2' I: (alsa-lib)conf.c: function snd_func_refer returned error: No such file or directory I: (alsa-lib)conf.c: Evaluate error: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM hdmi:1 I: alsa-util.c: Error opening PCM device hdmi:1: No such file or directory I: (alsa-lib)confmisc.c: Unable to find definition 'cards.USB-Audio.pcm.hdmi.0:CARD=1,AES0=4,AES1=130,AES2=0,AES3=2' I: (alsa-lib)conf.c: function snd_func_refer returned error: No such file or directory I: (alsa-lib)conf.c: Evaluate error: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM hdmi:1 I: alsa-util.c: Error opening PCM device hdmi:1: No such file or directory I: (alsa-lib)confmisc.c: Unable to find definition 'cards.USB-Audio.pcm.hdmi.0:CARD=1,AES0=4,AES1=130,AES2=0,AES3=2' I: (alsa-lib)conf.c: function snd_func_refer returned error: No such file or directory I: (alsa-lib)conf.c: Evaluate error: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM hdmi:1 I: alsa-util.c: Error opening PCM device hdmi:1: No such file or directory I: (alsa-lib)confmisc.c: Unable to find definition 'cards.USB-Audio.pcm.hdmi.0:CARD=1,AES0=4,AES1=130,AES2=0,AES3=2' I: (alsa-lib)conf.c: function snd_func_refer returned error: No such file or directory I: (alsa-lib)conf.c: Evaluate error: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM hdmi:1 I: alsa-util.c: Error opening PCM device hdmi:1: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC1D0c' failed (-2) I: alsa-util.c: Error opening PCM device hw:1: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC1D0c' failed (-2) I: alsa-util.c: Error opening PCM device front:1: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC1D0c' failed (-2) I: alsa-util.c: Error opening PCM device hw:1: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC1D0c' failed (-2) I: alsa-util.c: Error opening PCM device iec958:1: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC1D0c' failed (-2) I: alsa-util.c: Error opening PCM device iec958:1: No such file or directory I: card.c: Created 0 "alsa_card.usb-FiiO_DigiHug_USB_Audio-01-Audio" I: alsa-sink.c: Successfully opened device front:1. I: alsa-sink.c: Selected mapping 'Analog Stereo' (analog-stereo). I: alsa-sink.c: Successfully enabled mmap() mode. I: alsa-sink.c: Successfully enabled timer-based scheduling mode. I: (alsa-lib)control.c: Invalid CTL front:1 I: alsa-mixer.c: Unable to attach to mixer front:1: No such file or directory I: alsa-mixer.c: Successfully attached to mixer 'hw:1' W: alsa-mixer.c: Your kernel driver is broken: it reports a volume range from 0.00 dB to 0.00 dB which makes no sense. I: module-device-restore.c: Restoring volume for sink alsa_output.usb-FiiO_DigiHug_USB_Audio-01-Audio.analog-stereo. I: sink.c: Created sink 0 "alsa_output.usb-FiiO_DigiHug_USB_Audio-01-Audio.analog-stereo" with sample spec s16le 2ch 44100Hz and channel map front-left,front-right I: sink.c: alsa.resolution_bits = "16" I: sink.c: device.api = "alsa" I: sink.c: device.class = "sound" I: sink.c: alsa.class = "generic" I: sink.c: alsa.subclass = "generic-mix" I: sink.c: alsa.name = "USB Audio" I: sink.c: alsa.id = "USB Audio" I: sink.c: alsa.subdevice = "0" I: sink.c: alsa.subdevice_name = "subdevice #0" I: sink.c: alsa.device = "0" I: sink.c: alsa.card = "1" I: sink.c: alsa.card_name = "DigiHug USB Audio" I: sink.c: alsa.long_card_name = "FiiO DigiHug USB Audio at usb-0000:00:1a.0-1.2, full speed" I: sink.c: alsa.driver_name = "snd_usb_audio" I: sink.c: device.bus_path = "pci-0000:00:1a.0-usb-0:1.2:1.1" I: sink.c: sysfs.path = "/devices/pci0000:00/0000:00:1a.0/usb1/1-1/1-1.2/1-1.2:1.1/sound/card1" I: sink.c: udev.id = "usb-FiiO_DigiHug_USB_Audio-01-Audio" I: sink.c: device.bus = "usb" I: sink.c: device.vendor.id = "1852" I: sink.c: device.vendor.name = "GYROCOM C&C Co., LTD" I: sink.c: device.product.id = "7022" I: sink.c: device.product.name = "DigiHug_USB_Audio" I: sink.c: device.serial = "FiiO_DigiHug_USB_Audio" I: sink.c: device.string = "front:1" I: sink.c: device.buffering.buffer_size = "352800" I: sink.c: device.buffering.fragment_size = "176400" I: sink.c: device.access_mode = "mmap+timer" I: sink.c: device.profile.name = "analog-stereo" I: sink.c: device.profile.description = "Analog Stereo" I: sink.c: device.description = "DigiHug_USB_Audio Analog Stereo" I: sink.c: alsa.mixer_name = "USB Mixer" I: sink.c: alsa.components = "USB1852:7022" I: sink.c: module-udev-detect.discovered = "1" I: sink.c: device.icon_name = "audio-card-usb" I: source.c: Created source 0 "alsa_output.usb-FiiO_DigiHug_USB_Audio-01-Audio.analog-stereo.monitor" with sample spec s16le 2ch 44100Hz and channel map front-left,front-right I: source.c: device.description = "Monitor of DigiHug_USB_Audio Analog Stereo" I: source.c: device.class = "monitor" I: source.c: alsa.card = "1" I: source.c: alsa.card_name = "DigiHug USB Audio" I: source.c: alsa.long_card_name = "FiiO DigiHug USB Audio at usb-0000:00:1a.0-1.2, full speed" I: source.c: alsa.driver_name = "snd_usb_audio" I: source.c: device.bus_path = "pci-0000:00:1a.0-usb-0:1.2:1.1" I: source.c: sysfs.path = "/devices/pci0000:00/0000:00:1a.0/usb1/1-1/1-1.2/1-1.2:1.1/sound/card1" I: source.c: udev.id = "usb-FiiO_DigiHug_USB_Audio-01-Audio" I: source.c: device.bus = "usb" I: source.c: device.vendor.id = "1852" I: source.c: device.vendor.name = "GYROCOM C&C Co., LTD" I: source.c: device.product.id = "7022" I: source.c: device.product.name = "DigiHug_USB_Audio" I: source.c: device.serial = "FiiO_DigiHug_USB_Audio" I: source.c: device.string = "1" I: source.c: module-udev-detect.discovered = "1" I: source.c: device.icon_name = "audio-card-usb" I: alsa-sink.c: Using 2.0 fragments of size 176400 bytes (1000.00ms), buffer size is 352800 bytes (2000.00ms) I: alsa-sink.c: Time scheduling watermark is 20.00ms I: alsa-sink.c: Hardware volume ranges from 0 to 110. I: alsa-sink.c: Using hardware volume control. Hardware dB scale not supported. I: alsa-sink.c: Using hardware mute control. I: core-util.c: Successfully enabled SCHED_RR scheduling for thread, with priority 5. I: alsa-sink.c: Starting playback. I: module.c: Loaded "module-alsa-card" (index: #4; argument: "device_id="1" name="usb-FiiO_DigiHug_USB_Audio-01-Audio" card_name="alsa_card.usb-FiiO_DigiHug_USB_Audio-01-Audio" tsched=yes ignore_dB=no card_properties="module-udev-detect.discovered=1""). I: module-udev-detect.c: Card /devices/pci0000:00/0000:00:1a.0/usb1/1-1/1-1.2/1-1.2:1.1/sound/card1 (alsa_card.usb-FiiO_DigiHug_USB_Audio-01-Audio) module loaded. I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device hw:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device hw:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device hw:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device hw:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device hw:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device front:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device hw:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device front:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device hw:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device front:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device hw:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device front:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device hw:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device front:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device hw:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround40:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround40:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround40:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround40:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround40:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround41:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround41:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround41:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround41:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround41:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround50:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround50:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround50:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround50:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround50:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround51:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround51:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround51:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround51:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround51:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround71:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround71:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround71:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround71:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device surround71:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device iec958:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device iec958:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device iec958:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device iec958:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device iec958:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device iec958:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device iec958:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device iec958:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device iec958:2: No such file or directory I: (alsa-lib)pcm_hw.c: open '/dev/snd/pcmC2D0p' failed (-2) I: alsa-util.c: Error opening PCM device iec958:2: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:2 I: alsa-util.c: Error opening PCM device a52:2: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:2 I: alsa-util.c: Error opening PCM device a52:2: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:2 I: alsa-util.c: Error opening PCM device a52:2: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:2 I: alsa-util.c: Error opening PCM device a52:2: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:2 I: alsa-util.c: Error opening PCM device a52:2: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:2 I: alsa-util.c: Error opening PCM device a52:2: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:2 I: alsa-util.c: Error opening PCM device a52:2: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:2 I: alsa-util.c: Error opening PCM device a52:2: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:2 I: alsa-util.c: Error opening PCM device a52:2: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM a52:2 I: alsa-util.c: Error opening PCM device a52:2: No such file or directory I: (alsa-lib)confmisc.c: Unable to find definition 'cards.USB-Audio.pcm.hdmi.0:CARD=2,AES0=4,AES1=130,AES2=0,AES3=2' I: (alsa-lib)conf.c: function snd_func_refer returned error: No such file or directory I: (alsa-lib)conf.c: Evaluate error: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM hdmi:2 I: alsa-util.c: Error opening PCM device hdmi:2: No such file or directory I: (alsa-lib)confmisc.c: Unable to find definition 'cards.USB-Audio.pcm.hdmi.0:CARD=2,AES0=4,AES1=130,AES2=0,AES3=2' I: (alsa-lib)conf.c: function snd_func_refer returned error: No such file or directory I: (alsa-lib)conf.c: Evaluate error: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM hdmi:2 I: alsa-util.c: Error opening PCM device hdmi:2: No such file or directory I: (alsa-lib)confmisc.c: Unable to find definition 'cards.USB-Audio.pcm.hdmi.0:CARD=2,AES0=4,AES1=130,AES2=0,AES3=2' I: (alsa-lib)conf.c: function snd_func_refer returned error: No such file or directory I: (alsa-lib)conf.c: Evaluate error: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM hdmi:2 I: alsa-util.c: Error opening PCM device hdmi:2: No such file or directory I: (alsa-lib)confmisc.c: Unable to find definition 'cards.USB-Audio.pcm.hdmi.0:CARD=2,AES0=4,AES1=130,AES2=0,AES3=2' I: (alsa-lib)conf.c: function snd_func_refer returned error: No such file or directory I: (alsa-lib)conf.c: Evaluate error: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM hdmi:2 I: alsa-util.c: Error opening PCM device hdmi:2: No such file or directory I: (alsa-lib)confmisc.c: Unable to find definition 'cards.USB-Audio.pcm.hdmi.0:CARD=2,AES0=4,AES1=130,AES2=0,AES3=2' I: (alsa-lib)conf.c: function snd_func_refer returned error: No such file or directory I: (alsa-lib)conf.c: Evaluate error: No such file or directory I: (alsa-lib)pcm.c: Unknown PCM hdmi:2 I: alsa-util.c: Error opening PCM device hdmi:2: No such file or directory I: alsa-util.c: Device hw:2 doesn't support 44100 Hz, changed to 8000 Hz. I: alsa-util.c: Failed to set hardware parameters on plug:front:2: Invalid argument I: alsa-util.c: Failed to set hardware parameters on plug:hw:2: Invalid argument I: alsa-util.c: Failed to set hardware parameters on plug:iec958:2: Invalid argument I: alsa-util.c: Failed to set hardware parameters on plug:iec958:2: Invalid argument I: module-card-restore.c: Restoring profile for card alsa_card.usb-046d_08d7-01-U0x46d0x8d7. I: card.c: Created 1 "alsa_card.usb-046d_08d7-01-U0x46d0x8d7" I: module.c: Loaded "module-alsa-card" (index: #5; argument: "device_id="2" name="usb-046d_08d7-01-U0x46d0x8d7" card_name="alsa_card.usb-046d_08d7-01-U0x46d0x8d7" tsched=yes ignore_dB=no card_properties="module-udev-detect.discovered=1""). I: module-udev-detect.c: Card /devices/pci0000:00/0000:00:1a.0/usb1/1-1/1-1.6/1-1.6:1.1/sound/card2 (alsa_card.usb-046d_08d7-01-U0x46d0x8d7) module loaded. I: module-udev-detect.c: Found 3 cards. I: module.c: Loaded "module-udev-detect" (index: #6; argument: ""). I: module.c: Loaded "module-esound-protocol-unix" (index: #7; argument: ""). I: module.c: Loaded "module-native-protocol-unix" (index: #8; argument: ""). I: module-default-device-restore.c: Saved default sink 'alsa_output.pci-0000_00_1b.0.analog-surround-41' not existant, not restoring default sink setting. I: module-default-device-restore.c: Saved default source 'alsa_output.pci-0000_00_1b.0.analog-surround-41.monitor' not existant, not restoring default source setting. I: module.c: Loaded "module-default-device-restore" (index: #9; argument: ""). I: module.c: Loaded "module-rescue-streams" (index: #10; argument: ""). I: module.c: Loaded "module-always-sink" (index: #11; argument: ""). I: module.c: Loaded "module-intended-roles" (index: #12; argument: ""). I: module.c: Loaded "module-suspend-on-idle" (index: #13; argument: ""). I: client.c: Created 0 "ConsoleKit Session /org/freedesktop/ConsoleKit/Session2" I: module.c: Loaded "module-console-kit" (index: #14; argument: ""). I: module.c: Loaded "module-position-event-sounds" (index: #15; argument: ""). I: module.c: Loaded "module-cork-music-on-phone" (index: #16; argument: ""). E: module.c: Failed to open module "module-combine-sink": file not found E: main.c: Module load failed. E: main.c: Failed to initialize daemon. I: module.c: Unloading "module-device-restore" (index: #0). I: module.c: Unloaded "module-device-restore" (index: #0). I: module.c: Unloading "module-stream-restore" (index: #1). I: module.c: Unloaded "module-stream-restore" (index: #1). I: module.c: Unloading "module-card-restore" (index: #2). I: module.c: Unloaded "module-card-restore" (index: #2). I: module.c: Unloading "module-augment-properties" (index: #3). I: module.c: Unloaded "module-augment-properties" (index: #3). I: module.c: Unloading "module-alsa-card" (index: #4). I: sink.c: Freeing sink 0 "alsa_output.usb-FiiO_DigiHug_USB_Audio-01-Audio.analog-stereo" I: source.c: Freeing source 0 "alsa_output.usb-FiiO_DigiHug_USB_Audio-01-Audio.analog-stereo.monitor" I: card.c: Freed 0 "alsa_card.usb-FiiO_DigiHug_USB_Audio-01-Audio" I: module.c: Unloaded "module-alsa-card" (index: #4). I: module.c: Unloading "module-alsa-card" (index: #5). I: card.c: Freed 1 "alsa_card.usb-046d_08d7-01-U0x46d0x8d7" I: module.c: Unloaded "module-alsa-card" (index: #5). I: module.c: Unloading "module-udev-detect" (index: #6). I: module.c: Unloaded "module-udev-detect" (index: #6). I: module.c: Unloading "module-esound-protocol-unix" (index: #7). I: module.c: Unloaded "module-esound-protocol-unix" (index: #7). I: module.c: Unloading "module-native-protocol-unix" (index: #8). I: module.c: Unloaded "module-native-protocol-unix" (index: #8). I: module.c: Unloading "module-default-device-restore" (index: #9). I: module.c: Unloaded "module-default-device-restore" (index: #9). I: module.c: Unloading "module-rescue-streams" (index: #10). I: module.c: Unloaded "module-rescue-streams" (index: #10). I: module.c: Unloading "module-always-sink" (index: #11). I: module.c: Unloaded "module-always-sink" (index: #11). I: module.c: Unloading "module-intended-roles" (index: #12). I: module.c: Unloaded "module-intended-roles" (index: #12). I: module.c: Unloading "module-suspend-on-idle" (index: #13). I: module.c: Unloaded "module-suspend-on-idle" (index: #13). I: module.c: Unloading "module-console-kit" (index: #14). I: client.c: Freed 0 "ConsoleKit Session /org/freedesktop/ConsoleKit/Session2" I: module.c: Unloaded "module-console-kit" (index: #14). I: module.c: Unloading "module-position-event-sounds" (index: #15). I: module.c: Unloaded "module-position-event-sounds" (index: #15). I: module.c: Unloading "module-cork-music-on-phone" (index: #16). I: module.c: Unloaded "module-cork-music-on-phone" (index: #16). I: main.c: Daemon terminated. I believe the relevant part is this: E: module.c: Failed to open module "module-combine-sink": file not found E: main.c: Module load failed. E: main.c: Failed to initialize daemon. I tried uninstalling and reinstalling pulseaudio, I tried to find a way to install module-combine-sink. Nothing worked. I'm on a Debian Squeeze 32-bit machine. What can I do to fix this?

    Read the article

< Previous Page | 503 504 505 506 507 508 509 510 511 512 513 514  | Next Page >