Search Results

Search found 13716 results on 549 pages for 'kevin little'.

Page 507/549 | < Previous Page | 503 504 505 506 507 508 509 510 511 512 513 514  | Next Page >

  • Specializating a template function that takes a universal reference parameter

    - by David Stone
    How do I specialize a template function that takes a universal reference parameter? foo.hpp: template<typename T> void foo(T && t) // universal reference parameter foo.cpp template<> void foo<Class>(Class && class) { // do something complicated } Here, Class is no longer a deduced type and thus is Class exactly; it cannot possibly be Class &, so reference collapsing rules will not help me here. I could perhaps create another specialization that takes a Class & parameter (I'm not sure), but that implies duplicating all of the code contained within foo for every possible combination of rvalue / lvalue references for all parameters, which is what universal references are supposed to avoid. Is there some way to accomplish this? To be more specific about my problem in case there is a better way to solve it: I have a program that can connect to multiple game servers, and each server, for the most part, calls everything by the same name. However, they have slightly different versions for a few things. There are a few different categories that these things can be: a move, an item, etc. I have written a generic sort of "move string to move enum" set of functions for internal code to call, and my server interface code has similar functions. However, some servers have their own internal ID that they communicate with, some use strings, and some use both in different situations. Now what I want to do is make this a little more generic. I want to be able to call something like ServerNamespace::server_cast<Destination>(source). This would allow me to cast from a Move to a std::string or ServerMoveID. Internally, I may need to make a copy (or move from) because some servers require that I keep a history of messages sent. Universal references seem to be the obvious solution to this problem. The header file I'm thinking of right now would expose simply this: namespace ServerNamespace { template<typename Destination, typename Source> Destination server_cast(Source && source); } And the implementation file would define all legal conversions as template specializations.

    Read the article

  • How to discover classes with [Authorize] attributes using Reflection in C#? (or How to build Dynamic

    - by Pretzel
    Maybe I should back-up and widen the scope before diving into the title question... I'm currently writing a web app in ASP.NET MVC 1.0 (although I do have MVC 2.0 installed on my PC, so I'm not exactly restricted to 1.0) -- I've started with the standard MVC project which has your basic "Welcome to ASP.NET MVC" and shows both the [Home] tab and [About] tab in the upper-right corner. Pretty standard, right? I've added 4 new Controller classes, let's call them "Astronomer", "Biologist", "Chemist", and "Physicist". Attached to each new controller class is the [Authorize] attribute. For example, for the BiologistController.cs [Authorize(Roles = "Biologist,Admin")] public class BiologistController : Controller { public ActionResult Index() { return View(); } } These [Authorize] tags naturally limit which user can access different controllers depending on Roles, but I want to dynamically build a Menu at the top of my website in the Site.Master Page based on the Roles the user is a part of. So for example, if JoeUser was a member of Roles "Astronomer" and "Physicist", the navigation menu would say: [Home] [Astronomer] [Physicist] [About] And naturally, it would not list links to "Biologist" or "Chemist" controller Index page. Or if "JohnAdmin" was a member of Role "Admin", links to all 4 controllers would show up in the navigation bar. Ok, you prolly get the idea... Starting with the answer from this StackOverflow topic about Dynamic Menu building in ASP.NET, I'm trying to understand how I would fully implement this. (I'm a newbie and need a little more guidance, so please bare with me.) The answer proposes Extending the Controller class (call it "ExtController") and then have each new WhateverController inherit from ExtController. My conclusion is that I would need to use Reflection in this ExtController Constructor to determine which Classes and Methods have [Authorize] attributes attached to them to determine the Roles. Then using a Static Dictionary, store the Roles and Controllers/Methods in key-value pairs. I imagine it something like this: public class ExtController : Controller { protected static Dictionary<Type,List<string>> ControllerRolesDictionary; protected override void OnActionExecuted(ActionExecutedContext filterContext) { // build list of menu items based on user's permissions, and add it to ViewData IEnumerable<MenuItem> menu = BuildMenu(); ViewData["Menu"] = menu; } private IEnumerable<MenuItem> BuildMenu() { // Code to build a menu SomeRoleProvider rp = new SomeRoleProvider(); foreach (var role in rp.GetRolesForUser(HttpContext.User.Identity.Name)) { } } public ExtController() { // Use this.GetType() to determine if this Controller is already in the Dictionary if (!ControllerRolesDictionary.ContainsKey(this.GetType())) { // If not, use Reflection to add List of Roles to Dictionary // associating with Controller } } } Is this doable? If so, how do I perform Reflection in the ExtController constructor to discover the [Authorize] attribute and related Roles (if any) ALSO! Feel free to go out-of-scope on this question and suggest an alternate way of solving this "Dynamic Site.Master Menu based on Roles" problem. I'm the first to admit that this may not be the best approach.

    Read the article

  • HTML-like GUI Framework in Java

    - by wintermute
    I was recently brought onto a project where we are developing a lot GUI elements for BlackBerry devices. The standard RIM APIs are pretty basic, almost never do what is required and are difficult or impossible to extend, so we end up re-implementing chunks of it. Currently the code we have isn't super organized and factored so there are lots of little tricks that get implemented over and over again. I had a thought about how to aid development efforts on this platform and wanted to see if the community could tell me if I'm still sane or if I've gone totally nuts. By far, the biggest organizational problem I've run into is making sure that each screen is laid out properly with proper padding and such. The current approach is to manually keep track of padding like so: protected void sublayout(int width, int height) { final int padding = 5; int y = padding; int x = padding; layoutChild(_someChild, width - padding * 2, height / 3 - padding * 2); setPositionChild(_someChild, x, y); y += _someChild.getHeight() + padding; // Calculate where to start drawing next. /* ... snipped ... */ } As you can see, positioning elements on a screen is a nightmare due to the tedium. I have investigated other GUI frameworks but, for a variety of reasons, it is difficult to find one that suites our purposes. One potential solution that came to me is to create a GUI framework who's API resembles HTML/CSS. This would allow for things like padding, margins, borders and colours to be handled through a sort of CSS API while the content would be organized using the HTML part of the API. It might look something like this: public class OptionsScreen extends Document { public OptionsScreen() { // You would set the style (like CSS style) through the constructor. Div content = new Div(new Style(new Padding(5), Color.BLACK)); // Then build up a tree of elements which can each have their own style's. // Each element knows how to draw itself, but it doesn't have to worry about // manually handling things like padding. // content.addChild(new P("This is a paragraph", new Style(new Padding(), Color.RED))); Ul list = new Ul(); list.addChild(new Li("item 1")); list.addChild(new Li("item 2")); content.addChild(list); addChild(content); } } I can imagine this making it easier to customize the UI of our app (which is very important) with different fonts, colours and layouts. Does this idea belong on The Daily WTF or do you think there is some promise?

    Read the article

  • Is it possible to create a service like Feed My Inbox on my own server?

    - by Mark Bowen
    I was just wondering if it's at all possible to create a service like Feed My Inbox on my own server using PHP? Basically I have a site which has RSS feeds which are dynamic in nature and can search from thousands of posts based on many different criteria. I have the RSS feed working fine and bringing back data dynamically for whatever criteria I want so that bits fine. I am using the ExpressionEngine CMS to handle the site and there will be thousands of users on the site (currently there are around 2,0000) but that number is exponentially growing every single day. What I want to be able to do is allow the users to choose from certain criteria which will then build a dynamic RSS URL which will then be stored in a database table (one row for each user). This bit I will be able to do myself but then I want to be able to send out new RSS feed items via e-mail to each user. This is the part I'm a little stuck on. I'm guessing I would somehow need to run a cron job to hit a page which would check each users RSS feed and then if there are new items to send them to the user via e-mail. That's where I am totally stuck though and I'm just wondering what the best way to go about it would be? That or any software in PHP that already does this sort of thing would be great. I tried out phpList but it has severe problems working with RSS and I only ever got it to work once and now never again and I've read that lots of people have had this same problem so unfortunately it's not just me :-( I know there are services such as Feed My Inbox which I could easily set up so that users click a link and their RSS feed URL is added to go and use that service but I want to keep users from seeing the dynamic nature of the feed or they will easily be able to modify it to get at other items in the feed. I need this so that I can charge for access to the feeds but if people can see the URL of the feed then I will be totally unstuck as they will be able to get at whatever they want very easily. Therefore I'd like to be able to send the items out to them. Would really love to hear if anyone knows if this kind of thing is possible at all and what would be involved?

    Read the article

  • Thoughts on streamlining multiple .Net apps

    - by John Virgolino
    We have a series of ASP.Net applications that have been written over the course of 8 years. Mostly in the first 3-4 years. They have been running quite well with little maintenance, but new functionality is being requested and we are running into IDE and platform issues. The apps were written in .Net 1.x and 2.x and run in separate spaces but are presented as a single suite of applications which use a common navigation toolbar (implemented as a user control). Every time we want to add something to a menu in the nav we have to modify it in all the apps which is a pain. Also, the various versions of Crystal reports and that we used tables to organize the visual elements and we end up with a mess, especially with all the multi-platform .Net versions running. We need to streamline the suite of apps and make it easier to add on new apps without a hassle. We also need to bring all these apps under one .Net platform and IDE. In addition, there is a WordPress blog styled to match the style of the application suite "integrated" into the UI and a link to a MediaWiki Wiki application as well. My current thinking is to use an open source content management system (CMS) like Joomla (PHP based unfortunately, but it works well) as the user interface framework for style templating and menu management. Joomla's article management would allow us to migrate the Wiki content into articles which could be published without interfering with the .Net apps. Then essentially use an IFrame within an "article" to "host" the .Net application, then... Upgrade the .Net apps to VS2010, strip out all the common header/footer controls and migrate the styles to use the style sheets used in the CMS. As I write this, I certainly realize this is a lot of work and there are optimization issues which this may cause as well as using IFrames seems a bit like cheating and I've read about issues with IFrames. I know that we could use .Net application styling, but it seems like a lot more work (not sure really). Also, the use of a CMS to handle the blog and wiki also seems appealing, unless there is a .Net CMS out there that can handle all of these requirements. Given this information, I am looking to know if I am totally going in the wrong direction? We tried to use open source and integrate it over time, but not this has become hard to maintain. Am I not aware of some technology out there that will meet our requirements? Did we do this right and should we just focus on getting the .Net streamlined? I understand that no matter what we do, it's going to be a lot of work. The communities considerable experience would be helpful. Thanks!! PS - A complete rewrite is not an option.

    Read the article

  • Mixing .NET versions between website and virtual directories and the "server application unavailable" error Message

    - by Doug Chamberlain
    Backstory Last month our development team created a new asp.net 3.5 application to place out on our production website. Once we had the work completed, we requested from the group that manages are server to copy the app out to our production site, and configure the virtual directory as a new application. On 12/27/2010, two public 'Gineau Pigs' were selected to use the app, and it worked great. On 12/30/2010, We received notification by internal staff, that when that staff member tried to access the application (this was the Business Process Owner) they recieved the 'Server Application Unavailable' message. When I called the group that does our server support, I was told that it probably failed, because I didn't close the connections in my code. However, the same group went in and then created a separate app pool for this Extension Request application. It has had no issues since. I did a little googling, since I do not like being blamed for things. I found that the 'Server Application Unavailable' message will also appear when you have multiple applications using different frameworks and you do not put them in different application pools. Technical Details - Tree of our website structure Main Website <-- ASP Classic +-Virtual Directory(ExtensionRequest) <-- ASP 3.5 From our server support group: 'Reviewed server logs and website setup in IIS. Had to reset the application pool as it was not working properly. This corrected the website and it is now back online. We went ahead and created a application pool for the extension web so it is isolated from the main site pool. In the past we have seen other application do this when there is a connection being left open and the pool fills up. Would recommend reviewing site code to make sure no connections are being left open.' The Real Question: What really caused the failure? Isn't the connection being left open issue an ASP Classic issue? Wouldn't the ExtensionRequest application have to be used (more than twice) in the first place to have the connections left open? Is it more likely the failure is caused by them not bothering to setup the new Application in it's own App Pool in the first place? Sorry for the long windedness

    Read the article

  • Newbie - what do I need to do with httpd.conf to make CakePHP work correctly?

    - by EmmyS
    (Not sure if this belongs here or on webmasters; please move if necessary.) I'm a total newbie to Cake and not much better with apache; I've done a lot of PHP but always with a server that's already been set up by someone else. So I'm going through the basic blog tutorial, and it says: A Note On mod_rewrite Occasionally a new user will run in to mod_rewrite issues, so I'll mention them marginally here. If the Cake welcome page looks a little funny (no images or css styles), it probably means mod_rewrite isn't functioning on your system. Here are some tips to help get you up and running: Make sure that an .htaccess override is allowed: in your httpd.conf, you should have a section that defines a section for each Directory on your server. Make sure the AllowOverride is set to All for the correct Directory. Make sure you are editing the system httpd.conf rather than a user- or site-specific httpd.conf. For some reason or another, you might have obtained a copy of CakePHP without the needed .htaccess files. This sometimes happens because some operating systems treat files that start with '.' as hidden, and don't copy them. Make sure your copy of CakePHP is from the downloads section of the site or our SVN repository. Make sure you are loading up mod_rewrite correctly! You should see something like LoadModule rewrite_module libexec/httpd/mod_rewrite.so and AddModule mod_rewrite.c in your httpd.conf." I'm using XAMPP on linux. I've found my httpd.conf file in opt/lampp/ etc, but am not sure what I need to do with it. I've searched for "rewrite", and there's only one line: LoadModule rewrite_module modules/mod_rewrite.so There's nothing about AddModule mod_rewrite.c. Do I just create a Directory section for the directory I've installed Cake in and set AlllowOverride to All? (I created a separate subdirectory of my wwwroot and installed in there, since I also have installs of Joomla and CodeIgniter.) Is there anything else I need to do? My download of Cake did come with two htaccess-type files (._.htaccess and .htaccess) - do I need to do anything with them? Thanks for any help you can provide to this non-server-admin. EDIT TO ADD virtual host sample: <VirtualHost *:80> ServerAdmin [email protected] DocumentRoot /www/docs/dummy-host.example.com ServerName dummy-host.example.com ServerAlias www.dummy-host.example.com ErrorLog logs/dummy-host.example.com-error_log CustomLog logs/dummy-host.example.com-access_log common </VirtualHost>

    Read the article

  • What database table structure should I use for versions, codebases, deployables?

    - by Zac Thompson
    I'm having doubts about my table structure, and I wonder if there is a better approach. I've got a little database for version control repositories (e.g. SVN), the packages (e.g. Linux RPMs) built therefrom, and the versions (e.g. 1.2.3-4) thereof. A given repository might produce no packages, or several, but if there are more than one for a given repository then a particular version for that repository will indicate a single "tag" of the codebase. A particular version "string" might be used to tag a version of the source code in more than one repository, but there may be no relationship between "1.0" for two different repos. So if packages P and Q both come from repo R, then P 1.0 and Q 1.0 are both built from the 1.0 tag of repo R. But if package X comes from repo Y, then X 1.0 has no relationship to P 1.0. In my (simplified) model, I have the following tables (the x_id columns are auto-incrementing surrogate keys; you can pretend I'm using a different primary key if you wish, it's not really important): repository - repository_id - repository_name (unique) ... version - version_id - version_string (unique for a particular repository) - repository_id ... package - package_id - package_name (unique) - repository_id ... This makes it easy for me to see, for example, what are valid versions of a given package: I can join with the version table using the repository_id. However, suppose I would like to add some information to this database, e.g., to indicate which package versions have been approved for release. I certainly need a new table: package_version - version_id - package_id - package_version_released ... Again, the nature of the keys that I use are not really important to my problem, and you can imagine that the data column is "promotion_level" or something if that helps. My doubts arise when I realize that there's really a very close relationship between the version_id and the package_id in my new table ... they must share the same repository_id. Only a small subset of package/version combinations are valid. So I should have some kind of constraint on those columns, enforcing that ... ... I don't know, it just feels off, somehow. Like I'm including somehow more information than I really need? I don't know how to explain my hesitance here. I can't figure out which (if any) normal form I'm violating, but I also can't find an example of a schema with this sort of structure ... not being a DBA by profession I'm not sure where to look. So I'm asking: am I just being overly sensitive?

    Read the article

  • Is it Bad Practice to use C++ only for the STL containers?

    - by gmatt
    First a little background ... In what follows, I use C,C++ and Java for coding (general) algorithms, not gui's and fancy program's with interfaces, but simple command line algorithms and libraries. I started out learning about programming in Java. I got pretty good with Java and I learned to use the Java containers a lot as they tend to reduce complexity of book keeping while guaranteeing great performance. I intermittently used C++, but I was definitely not as good with it as with Java and it felt cumbersome. I did not know C++ enough to work in it without having to look up every single function and so I quickly reverted back to sticking to Java as much as possible. I then made a sudden transition into cracking and hacking in assembly language, because I felt I was concentrated too much attention on a much too high level language and I needed more experience with how a CPU interacts with memory and whats really going on with the 1's and 0's. I have to admit this was one of the most educational and fun experiences I've had with computers to date. For obviously reasons, I could not use assembly language to code on a daily basis, it was mostly reserved for fun diversions. After learning more about the computer through this experience I then realized that C++ is so much closer to the "level of 1's and 0's" than Java was, but I still felt it to be incredibly obtuse, like a swiss army knife with far too many gizmos to do any one task with elegance. I decided to give plain vanilla C a try, and I quickly fell in love. It was a happy medium between simplicity and enough "micromanagent" to not abstract what is really going on. However, I did miss one thing about Java: the containers. In particular, a simple container (like the stl vector) that expands dynamically in size is incredibly useful, but quite a pain to have to implement in C every time. Hence my code currently looks like almost entirely C with containers from C++ thrown in, the only feature I use from C++. I'd like to know if its consider okay in practice to use just one feature of C++, and ignore the rest in favor of C type code?

    Read the article

  • Primary language - C++/Qt, C#, Java?

    - by Airjoe
    I'm looking for some input, but let me start with a bit of background (for tl;dr skip to end). I'm an IT major with a concentration in networking. While I'm not a CS major nor do I want to program as a vocation, I do consider myself a programmer and do pretty well with the concepts involved. I've been programming since about 6th grade, started out with a proprietary game creation language that made my transition into C++ at college pretty easy. I like to make programs for myself and friends, and have been paid to program for local businesses. A bit about that- I wrote some programs for a couple local businesses in my senior year in high school. I wrote management systems for local shops (inventory, phone/pos orders, timeclock, customer info, and more stuff I can't remember). It definitely turned out to be over my head, as I had never had any formal programming education. It was a great learning experience, but damn was it crappy code. Oh yeah, by the way, it was all vb6. So, I've used vb6 pretty extensively, I've used c++ in my classes (intro to programming up to algorithms), used Java a little bit in another class (had to write a ping client program, pretty easy) and used Java for some simple Project Euler problems to help learn syntax and such when writing the program for the class. I've also used C# a bit for my own simple personal projects (simple programs, one which would just generate an HTTP request on a list of websites and notify if one responded unexpectedly or not at all, and another which just held a list of things to do and periodically reminded me to do them), things I would've written in vb6 a year or two ago. I've just started using Qt C++ for some undergrad research I'm working on. Now I've had some formal education, I [think I] understand organization in programming a lot better (I didn't even use classes in my vb6 programs where I really should have), how it's important to structure code, split into functions where appropriate, document properly, efficiency both in memory and speed, dynamic and modular programming etc. I was looking for some input on which language to pick up as my "primary". As I'm not a "real programmer", it will be mostly hobby projects, but will include some 'real' projects I'm sure. From my perspective: QtC++ and Java are cross platform, which is cool. Java and C# run in a virtual machine, but I'm not sure if that's a big deal (something extra to distribute, possibly a bit slower? I think Qt would require additional distributables too, right?). I don't really know too much more than this, so I appreciate any help, thanks! TL;DR Am an avocational programmer looking for a language, want quick and straight forward development, liked vb6, will be working with database driven GUI apps- should I go with QtC++, Java, C#, or perhaps something else?

    Read the article

  • How to replicate this button in CSS

    - by jasondavis
    I am trying to create a CSS theme switcher button like below. The top image shows what I have so far and the bottom image shows what I am trying to create. I am not the best at this stuff I am more of a back-end coder. I could really use some help. I have a live demo of the code here http://dabblet.com/gist/2230656 Just looking at what I have and the goal image, some differences. I need to add a gradient The border is not right on mine Radius is a little off Possibly some other stuff? Also here is the code...it can be changed anyway to improve this, the naming and stuff could be improved I am sure but I can use any help I can get. HTML <div class="switch-wrapper"> <div class="switcher left selected"> <span id="left">....</span> </div> <div class="switcher right"> <span id="right">....</span> </div> </div> CSS /* begin button styles */ .switch-wrapper{ width:400px; margin:220px; } .switcher { background:#507190; display: inline-block; max-width: 100%; box-shadow: 1px 1px 1px rgba(0,0,0,.3); position:relative; } #left, #right{ width:17px; height:11px; overflow:hidden; position:absolute; top:50%; left:50%; margin-top:-5px; margin-left:-8px; font: 0/0 a; } #left{ background-image: url(http://www.codedevelopr.com/assets/images/switcher.png); background-position: 0px px; } #right{ background-image: url(http://www.codedevelopr.com/assets/images/switcher.png); background-position: -0px -19px; } .left, .right{ width: 30px; height: 25px; border: 1px solid #3C5D7E; } .left{ border-radius: 6px 0px 0px 6px; } .right{ border-radius: 0 6px 6px 0; margin: 0 0 0 -6px } .switcher:hover, .selected { background: #27394b; box-shadow: -1px 1px 0px rgba(255,255,255,.4), inset 0 4px 5px rgba(0,0,0,.6), inset 0 1px 2px rgba(0,0,0,.6); }

    Read the article

  • Why the parent page get refreshed when I click the link to open thickbox-styled form?

    - by user333205
    Hi, all: I'm using Thickbox 3.1 to show signup form. The form content comes from jquery ajax post. The jquery lib is of version 1.4.2. I placed a "signup" link into a div area, which is a part of my other large pages, and the whole content of that div area is ajax+posted from my server. To make thickbox can work in my above arangement, I have modified the thickbox code a little like that: //add thickbox to href & area elements that have a class of .thickbox function tb_init(domChunk){ $(domChunk).live('click', function(){ var t = this.title || this.name || null; var a = this.href || this.alt; var g = this.rel || false; tb_show(t,a,g); this.blur(); return false; });} This modification is the only change against the original version. Beacause the "signup" link is placed in ajaxed content, so I Use live instead of binding the click event directly. When I tested on my pc, the thickbox works well. I can see the signup form quickly, without feeling the content of the parent page(here, is the other large pages) get refreshed. But after transmiting my site files into VHost, when I click the "signup" link, the signup form get presented very slowly. The large pages get refreshed evidently, because the borwser(ie6) are reloading images from server incessantly. These images are set as background images in CSS files. I think that's because the slow connection of network. But why the parent pages get refreshed? and why the browser reloads those images one more time? Havn't those images been placed in local computer's disk? Is there one way to stop that reloadding? Because the signup form can't get displayed sometimes due to slow connection of network. To verified the question, you can access http://www.juliantec.info/track-the-source.html and click the second link in left grey area, that is the "signup" link mentioned above. Thinks!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • PHP echo query result in Class??

    - by Jerry
    Hi all I have a question about PHP Class. I am trying to get the result from Mysql via PHP. I would like to know if the best practice is to display the result inside the Class or store the result and handle it in html. For example, display result inside the Class class Schedule { public $currentWeek; function teamQuery($currentWeek){ $this->currentWeek=$currentWeek; } function getSchedule(){ $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } $scheduleQuery=mysql_query("SELECT guest, home, time, winner, pickEnable FROM $this->currentWeek ORDER BY time", $connection); if (!$scheduleQuery){ die("database has errors: ".mysql_error()); } while($row=mysql_fetch_array($scheduleQuery, MYSQL_NUMS)){ //display the result..ex: echo $row['winner']; } mysql_close($scheduleQuery); //no returns } } Or return the query result as a variable and handle in php class Schedule { public $currentWeek; function teamQuery($currentWeek){ $this->currentWeek=$currentWeek; } function getSchedule(){ $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } $scheduleQuery=mysql_query("SELECT guest, home, time, winner, pickEnable FROM $this->currentWeek ORDER BY time", $connection); if (!$scheduleQuery){ die("database has errors: ".mysql_error()); // create an array } $ret = array(); while($row=mysql_fetch_array($scheduleQuery, MYSQL_NUMS)){ $ret[]=$row; } mysql_close($scheduleQuery); return $ret; // and handle the return value in php } } Two things here: I found that returned variable in php is a little bit complex to play with since it is two dimension array. I am not sure what the best practice is and would like to ask you experts opinions. Every time I create a new method, I have to recreate the $connection variable: see below $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } It seems like redundant to me. Can I only do it once instead of calling it anytime I need a query? I am new to php class. hope you guys can help me. thanks.

    Read the article

  • Recommended ASP.NET Shared Hosting

    - by coffeeaddict
    Ok, I have to admit I'm getting fed up with www.discountasp.net's pricing model and this annoyance has built up over the past 8 years or so. I've been with them for years and absolutely love them on the technical side, however it's getting ridiculously expensive for so little that you get. I mean here's my scenario: 1) I am running 2 SQL Server databases which costs me $10/ea per month so that's $20/month for 2 and I only get 500 mb disk space which is horrible 2) I am paying $10/mo just for the hosting itself which I only get 1 gig of disk space! I mean common! 3) I am simply running 2 small apps (Screwturn Wiki & Subtext Blog)...so I don't really care if it's up 99% or not, it's not worth paying a total of $300 just to keep these 2 apps running over discountasp.net Anyone else feel the same? Yes, I know they have great support, probably have great servers running behind this but in the end I really don't care as long as my site is up 95% or better. Yes, the hosting toolset rocks. But you know I bet you I can find a similar set somewhere else. I like how I can totally control IIS 7 at discountasp and I can control my own app pool etc. That's very powerful and essential. But anyone have any good alternatives to discountasp that gives me close to the same at a much more reasonable cost point? I mean http://www.m6.net/prices.aspx gives you 10 SQL Databases for $7 and 200 gigs disk space! I don't know about their tools or support but just looking at those numbers and some other hosts I've seen, I feel that discountasp.net is way out of line. They don't even offer any purchasing discounts such as it would be nice if my 2nd SQL Server is only $5/month not $10...stuff like this, to make it much more realistic and fair. Opinions (people who do have discountasp.net, people who have left them, or people who have another host they like)??? But geez $300 just to host a couple DBs and lightweight open source apps? Not worth the price they are charging. I'm almost at a price point that enables me to get a decent dedicated server! I really don't care about beta support. Not a big deal to me.

    Read the article

  • A question about making a C# class persistent during a file load

    - by Adam
    Apologies for the indescriptive title, however it's the best I could think of for the moment. Basically, I've written a singleton class that loads files into a database. These files are typically large, and take hours to process. What I am looking for is to make a method where I can have this class running, and be able to call methods from within it, even if it's calling class is shut down. The singleton class is simple. It starts a thread that loads the file into the database, while having methods to report on the current status. In a nutshell it's al little like this: public sealed class BulkFileLoader { static BulkFileLoader instance = null; int currentCount = 0; BulkFileLoader() public static BulkFileLoader Instance { // Instanciate the instance class if necessary, and return it } public void Go() { // kick of 'ProcessFile' thread } public void GetCurrentCount() { return currentCount; } private void ProcessFile() { while (more rows in the import file) { // insert the row into the database currentCount++; } } } The idea is that you can get an instance of BulkFileLoader to execute, which will process a file to load, while at any time you can get realtime updates on the number of rows its done so far using the GetCurrentCount() method. This works fine, except the calling class needs to stay open the whole time for the processing to continue. As soon as I stop the calling class, the BulkFileLoader instance is removed, and it stops processing the file. What I am after is a solution where it will continue to run independently, regardless of what happens to the calling class. I then tried another approach. I created a simple console application that kicks off the BulkFileLoader, and then wrapped it around as a process. This fixes one problem, since now when I kick off the process, the file will continue to load even if I close the class that called the process. However, now the problem I have is that cannot get updates on the current count, since if I try and get the instance of BulkFileLoader (which, as mentioned before is a singleton), it creates a new instance, rather than returning the instance that is currently in the executing process. It would appear that singletons don't extend into the scope of other processes running on the machine. In the end, I want to be able to kick off the BulkFileLoader, and at any time be able to find out how many rows it's processed. However, that is even if I close the application I used to start it. Can anyone see a solution to my problem?

    Read the article

  • Image animation problem in silverlight

    - by Jak
    Hi followed " http://www.switchonthecode.com/tutorials/silverlight-3-tutorial-planeprojection-and-perspective-3d#comment-4688 ".. the animation is working fine. I am new to silver light. when i use dynamic image from xml instead of static image as in tutorial,.. it is not working fine, please help me on this. i used list box.. for this animation effect do i need to change listbox to some other arrangement ? if your answer yes means, pls give me some sample code. Thanks in advance. Xaml code: <ListBox Name="listBox1"> <ListBox.ItemTemplate> <DataTemplate> <StackPanel> <Image Source="{Binding imgurl}" HorizontalAlignment="Left" Name="image1" Stretch="Fill" VerticalAlignment="Top" MouseLeftButtonUp="FlipImage" /> </StackPanel> </DataTemplate> </ListBox.ItemTemplate> </ListBox> My C# code: //getting image URL from xml XElement xmlads = XElement.Parse(e.Result); //i bind the url in to listBox listBox1.ItemsSource = from ads in xmlads.Descendants("ad") select new zestItem { imgurl = ads.Element("picture").Value }; public class zestItem { public string imgurl { get; set; } } private int _zIndex = 10; private void FlipImage(object sender, MouseButtonEventArgs e) { Image image = sender as Image; // Make sure the image is on top of all other images. image.SetValue(Canvas.ZIndexProperty, _zIndex++); // Create the storyboard. Storyboard flip = new Storyboard(); // Create animation and set the duration to 1 second. DoubleAnimation animation = new DoubleAnimation() { Duration = new TimeSpan(0, 0, 1) }; // Add the animation to the storyboard. flip.Children.Add(animation); // Create a projection for the image if it doesn't have one. if (image.Projection == null) { // Set the center of rotation to -0.01, which will put a little space // between the images when they're flipped. image.Projection = new PlaneProjection() { CenterOfRotationX = -0.01 }; } PlaneProjection projection = image.Projection as PlaneProjection; // Set the from and to properties based on the current flip direction of // the image. if (projection.RotationY == 0) { animation.To = 180; } else { animation.From = 180; animation.To = 0; } // Tell the animation to animation the image's PlaneProjection object. Storyboard.SetTarget(animation, projection); // Tell the animation to animation the RotationYProperty. Storyboard.SetTargetProperty(animation, new PropertyPath(PlaneProjection.RotationYProperty)); flip.Begin(); }

    Read the article

  • Jumping into argv?

    - by jth
    Hi, I`am experimenting with shellcode and stumbled upon the nop-slide technique. I wrote a little tool that takes buffer-size as a parameter and constructs a buffer like this: [ NOP | SC | RET ], with NOP taking half of the buffer, followed by the shellcode and the rest filled with the (guessed) return address. Its very similar to the tool aleph1 described in his famous paper. My vulnerable test-app is the same as in his paper: int main(int argc, char **argv) { char little_array[512]; if(argc>1) strcpy(little_array,argv[1]); return 0; } I tested it and well, it works: jth@insecure:~/no_nx_no_aslr$ ./victim $(./exploit 604 0) $ exit But honestly, I have no idea why. Okay, the saved eip was overwritten as intended, but instead of jumping somewhere into the buffer, it jumped into argv, I think. gdb showed up the following addresses before strcpy() was called: (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x80483ed in main (victim.c:7); saved eip 0x154b56 source language c. Arglist at 0xbffff1e8, args: argc=2, argv=0xbffff294 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec Address of little_array: (gdb) print &little_array[0] $1 = 0xbfffefe8 "\020" After strcpy(): (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x804840d in main (victim.c:10); saved eip 0xbffff458 source language c. Arglist at 0xbffff1e8, args: argc=-1073744808, argv=0xbffff458 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec So, what happened here? I used a 604 byte buffer to overflow little_array, so he certainly overwrote saved ebp, saved eip and argc and also argv with the guessed address 0xbffff458. Then, after returning, EIP pointed at 0xbffff458. But little_buffer resides at 0xbfffefe8, that`s a difference of 1136 byte, so he certainly isn't executing little_array. I followed execution with the stepi command and well, at 0xbffff458 and onwards, he executes NOPs and reaches the shellcode. I'am not quite sure why this is happening. First of all, am I correct that he executes my shellcode in argv, not little_array? And where does the loader(?) place argv onto the stack? I thought it follows immediately after argc, but between argc and 0xbffff458, there is a gap of 620 bytes. How is it possible that he successfully "lands" in the NOP-Pad at Address 0xbffff458, which is way above the saved eip at 0xbffff1ec? Can someone clarify this? I have actually no idea why this is working. My test-machine is an Ubuntu 9.10 32-Bit Machine without ASLR. victim has an executable stack, set with execstack -s. Thanks in advance.

    Read the article

  • text in textbox shows up as circles instead of regular characters?

    - by BlueMonster
    When i type in either of the textboxes i get little circles appearing instead of text. Why is this happening and how do i stop it? Code is as follows: HTML: <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="MainPage.aspx.cs" Inherits="Foods.MainPage" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <link id="Link1" rel="stylesheet" type="text/css" href="Styles/mainStyle.css"/> </head> <body> <form id="form1" runat="server"> <div class = "userIDTboxDiv"> <div class = "userIDTboxText"> &nbsp;&nbsp;&nbsp; Enter User ID: </div> <asp:TextBox id="userIDBox" TextMode="password" runat="server" Height="52px" Width="200px" /> </div> <div class = "passwordTboxDiv"> <div class = "passwordTboxText"> &nbsp;&nbsp;&nbsp; Enter User Password: </div> <asp:TextBox id="TextBox1" TextMode="password" runat="server" Height="52px" Width="200px" /> </div> </form> </body> CSS: body { text-decoration:none; background: white; } input { margin-left: 0px; margin-top: 7px; } .userIDTboxDiv { padding-top: 20%; padding-left: 45%; width: 15%; height: 30%; } .userIDTboxText { padding-left: 17%; height: auto; width:203px; } .passwordTboxDiv { padding-top: 2%; padding-left: 45%; width: 15%; height: 111px; } .passwordTboxText { padding-left: 10%; height: auto; width:203px; }

    Read the article

  • .NET Extension Objects with XSLT -- how to iterate over a collection?

    - by Pandincus
    Help me, Stackoverflow! I have a simple .NET 3.5 console app that reads some data and sends emails. I'm representing the email format in an XSLT stylesheet so that we can easily change the wording of the email without needing to recompile the app. We're using Extension Objects to pass data to the XSLT when we apply the transformation: <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:msxsl="urn:schemas-microsoft-com:xslt" exclude-result-prefixes="msxsl" xmlns:EmailNotification="ext:EmailNotification"> -- this way, we can have statements like: <p> Dear <xsl:value-of select="EmailNotification:get_FullName()" />: </p> The above works fine. I pass the object via code like this (some irrelevant code omitted for brevity): // purely an example structure public struct EmailNotification { public string FullName { get; set; } } // Somewhere in some method ... var notification = new Notification("John Smith"); // ... XsltArgumentList xslArgs = new XsltArgumentList(); xslArgs.AddExtensionObject("ext:EmailNotification", notification); // ... // The part where it breaks! (This is where we do the transformation) xslt.Transform(fakeXMLDocument.CreateNavigator(), xslArgs, XmlWriter.Create(transformedXMLString)); So, all of the above code works. However, I wanted to get a little fancy (always my downfall) and pass a collection, so that I could do something like this: <p>The following accounts need to be verified:</p> <xsl:for-each select="EmailNotification:get_SomeCollection()"> <ul> <li> <xsl:value-of select="@SomeAttribute" /> </li> </ul> <xsl:for-each> When I pass the collection in the extension object and attempt to transform, I get the following error: "Extension function parameters or return values which have Clr type 'String[]' are not supported." or List, or IEnumerable, or whatever I try to pass in. So, my questions are: How can I pass in a collection to my XSLT? What do I put for the xsl:value-of select="" inside the xsl:for-each ? Is what I am trying to do impossible?

    Read the article

  • Coping with feelings of technical mediocrity

    - by Karim
    As I've progressed as a programmer, I noticed more nuance and areas I could study in depth. In part, I've come to think of myself from, at one point, a "guru" to now much less, even mediocre or inadequate. Is this normal, or is it a sign of a destructive excessive ambition? Background I started to program when I was still a kid, I had about 10 or 11 years. I really enjoy my work and never get bored from it. It's amazing how somebody could be paid for what he really likes to do and would be doing it anyway even for free. When I first started to program, I was feeling proud of what I was doing, each application I built was for me a success and after 2-3 year I had a feeling that I'm a coding guru. It was a nice feeling. ;-) But the more I was in the field and the more types of software I started to develop, I was starting to have a feeling that I'm completely wrong in thinking I'm a guru. I felt that I'm not even a mediocre developer. Each new field I start to work on is giving me this feeling. Like when I once developed a device driver for a client, I saw how much I need to learn about device drivers. When I developed a video filter for an application, I saw how much do I still need to learn about DirectShow, Color Spaces, and all the theory behind that. The worst thing was when I started to learn algorithms. It was several years ago. I knew then the basic structures and algorithms like the sorting, some types of trees, some hashtables, strings, etc. and when I really wanted to learn a group of structures I learned about 5-6 new types and saw that in fact even this small group has several hundred subtypes of structures. It's depressing how little time people have in their lives to learn all this stuff. I'm now a software developer with about 10 years of experience and I still feel that I'm not a proficient developer when I think about things that others do in the industry.

    Read the article

  • How to properly preload images, js and css files?

    - by Kenny Bones
    Hi, I'm creating a website from scratch and I was really into this in the late 90's but the web has changed alot since then! And I'm more of a designer so when I started putting this site together, I basically did a system of php includes to make the site more "dynamic" When you first visit the site, you'll be presented to a logon screen, if you're not already logged on (cookies). If you're not logged on, a page called access.php is introdused. I thought I'd preload the most heavy images at this point. So that when the user is done logging on, the images are already cached. And this is working as I want. But I still notice that the biggest image still isn't rendered immediatly anyway. So it's seems kinda pointless. All of this has made me rethink how the site is structured and how scripts and css files are loaded. Using FireBug and YSlow with Firefox I see a few pointers like expires headers and reducing the size of each script. But is this really the culprit? For example, would this be really really stupid in the main index.php? The entire site is basically structured like this <?php require("dbconnect.php"); ?> <?php include ("head.php"); ?> And below this is basically just the body and the content of the site. Head.php however consists of the doctype, head portions, linking of two css style sheets, jQuery library, jQuery validation engine, Cufon and Cufon font file, and then the small Cufon.Replace snippet. The rest of the body comes with the index.php file, but at the bottom of this again is an include of a file called "footer.php" which basically consists of loading of a couple of jsLoader scripts and a slidepanel and then a js function. All of this makes the end page source look like a typical complete webpage, but I'm wondering if any of you can see immediatly that "this is really really stupid" and "don't do that, do this instead" etc. :) Are includes a bad way to go? This site is also pretty image intensive and I can probably do a little more optimization. But I don't think that's its the primary culprit. YSlow gives me a report of what takes up the most space: doc(1) - 5.8K js(5) - 198.7K css(2) - 5.6K cssimage(8) - 634.7K image(6) - 110.8K I know it looks like it's cssimage(8) that weighs the most, but I've already preloaded these images from before and it doesn't really affect the rendering.

    Read the article

  • PHP - JSON Steam API query

    - by Hunter
    First time using "JSON" and I've just been working away at my dissertation and I'm integrating a few features from the steam API.. now I'm a little bit confused as to how to create arrays. function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530'); $test = decode_url($api); var_dump($test['response']['players'][0]['personaname']['steamid']); } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $data = file_get_contents($url); $data_output = json_decode($data, true); return $data_output; } So ea I've wrote a simple method to decode Json as I'll be doing a fair bit.. But just wondering the best way to print out arrays.. I can't for the life of me get it to print more than 1 element without it retunring an error e.g. Warning: Illegal string offset 'steamid' in /opt/lampp/htdocs/lan/lan-includes/scripts/class.steam.php on line 48 string(1) "R" So I can print one element, and if I add another it returns errors. EDIT -- Thanks for help, So this was my solution: function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530,76561197960435530'); $data = decode_url($api); foreach($data ['response']['players'] as $player) { echo "Steam id:" . $player['steamid'] . "\n"; echo "Community visibility :" . $player['communityvisibilitystate'] . "\n"; echo "Player profile" . $player['profileurl'] ."\n"; } } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $json = file_get_contents($decodeURL); $data_output = json_decode($json, true); return $data_output; } Worked this out by taking a look at the data.. and a couple json examples, this returns an array based on the Steam API URL (It works for multiple queries.... just FYI) and you can insert loops inside for items etc.. (if anyone searches for this).

    Read the article

  • How can I improve the recursion capabilities of my ECMAScript implementation?

    - by ChaosPandion
    After some resent tests I have found my implementation cannot handle very much recursion. Although after I ran a few tests in Firefox I found that this may be more common than I originally thought. I believe the basic problem is that my implementation requires 3 calls to make a function call. The first call is made to a method named Call that makes sure the call is being made to a callable object and gets the value of any arguments that are references. The second call is made to a method named Call which is defined in the ICallable interface. This method creates the new execution context and builds the lambda expression if it has not been created. The final call is made to the lambda that the function object encapsulates. Clearly making a function call is quite heavy but I am sure that with a little bit of tweaking I can make recursion a viable tool when using this implementation. public static object Call(ExecutionContext context, object value, object[] args) { var func = Reference.GetValue(value) as ICallable; if (func == null) { throw new TypeException(); } if (args != null && args.Length > 0) { for (int i = 0; i < args.Length; i++) { args[i] = Reference.GetValue(args[i]); } } var reference = value as Reference; if (reference != null) { if (reference.IsProperty) { return func.Call(reference.Value, args); } else { return func.Call(((EnviromentRecord)reference.Value).ImplicitThisValue(), args); } } return func.Call(Undefined.Value, args); } public object Call(object thisObject, object[] arguments) { var lexicalEnviroment = Scope.NewDeclarativeEnviroment(); var variableEnviroment = Scope.NewDeclarativeEnviroment(); var thisBinding = thisObject ?? Engine.GlobalEnviroment.GlobalObject; var newContext = new ExecutionContext(Engine, lexicalEnviroment, variableEnviroment, thisBinding); Engine.EnterContext(newContext); var result = Function.Value(newContext, arguments); Engine.LeaveContext(); return result; }

    Read the article

  • How to get a physics engine like Nape working?

    - by Glacius
    Introduction: I think Nape is a relatively new engine so some of you may not know it. It's supposedly faster than box2d and I like that there is decent documentation. Here's the site: http://code.google.com/p/nape/ I'm relatively new to programming. I am decent at AS3's basic functionality, but every time I try to implement some kind of engine or framework I can't even seem to get it to work. With Nape I feel I got a little further than before but I still got stuck. My problem: I'm using Adobe CS5, I managed to import the SWC file like described here. Next I tried to copy the source of one of the demo's like this one and get it to work but I keep getting errors. I made a new class file, copied the demo source to it, and tried to add it to the stage. My stage code basically looks like this: import flash.Boot; // these 2 lines are as described in the tutorial new Boot(); var demo = new Main(); // these 2 are me guessing what I'm supposed to do addChild(demo); Well, it seems the source code is not even being recognized by flash as a valid class file. I tried editing it, but even if I get it recognized (give a package name and add curly brackets) but I still get a bunch of errors. Is it psuedo code or something? What is going on? My goal: I can imagine I'm going about this the wrong way. So let me explain what I'm trying to achieve. I basically want to learn how to use the engine by starting from a simple basic example that I can edit and mess around with. If I can't even get a working example then I'm unable to learn anything. Preferably I don't want to start using something like FlashDevelop (as I'd have to learn how to use the program) but if it can't be helped then I can give it a try. Thank you.

    Read the article

< Previous Page | 503 504 505 506 507 508 509 510 511 512 513 514  | Next Page >