Search Results

Search found 19966 results on 799 pages for 'wild thing'.

Page 508/799 | < Previous Page | 504 505 506 507 508 509 510 511 512 513 514 515  | Next Page >

  • Performance: Subquery or Joining

    - by Auro
    Hello I got a little question about performance of a subquery / joining another table INSERT INTO Original.Person ( PID, Name, Surname, SID ) ( SELECT ma.PID_new , TBL.Name , ma.Surname, TBL.SID FROM Copy.Person TBL , original.MATabelle MA WHERE TBL.PID = p_PID_old AND TBL.PID = MA.PID_old ); This is my SQL, now this thing runs around 1 million times or more. Now my question is what would be faster? if I change TBL.SID to (Select new from helptable where old = tbl.sid) or if I add helptable to the from and do the joining in the where? greets Auro

    Read the article

  • Delete files in C# that windows does not want me to delete?

    - by user315881
    At my company, we are writing a script to take care of simple tasks that we usually would do by hand. I am using c# to delete profiles in c:\documents and settings\, except a few. These will simply be left alone. The problem is that even with code that sets the files to normal and marks the admin user as an owner, they won't delete. They say that the quick launch folder has access denied. I am using a recursive permissions change method and I know that it works. Same thing with file attributes. Why won't it work? How do I fix this?

    Read the article

  • Modifying an inherited Rails association

    - by Chris Kilmer
    I have a Team class that inherits from a Group class. Both Team and Groups have memberships through the same association. However, I need to run a method after a Team memberships is added but not a Group. I currently have something like this: class Group < ActiveRecord::Base has_many :memberships, :class_name => 'Connection', :foreign_key => 'connectable_id', :as => :connectable, :dependent => :destroy end class Team < Group has_many :memberships, :class_name => 'Connection', :foreign_key => 'connectable_id', :as => :connectable, :dependent => :destroy, :after_add => :add_company_membership private def membership_check(membership) end end Is there some way to modify the inherited association in Team so that I don't have to redefine the entire thing but rather just add the :after_add hook it? Any help would be appreciated.

    Read the article

  • how to make PHP lists all Linux Users?

    - by Data-Base
    Hello I want to build a php based site that (automate) some commands on my Ubuntu Server first thing I did was going to the file (sudoers) and add the user www-data so I can execute php commands with root privileges! # running the web apps with root power!!! www-data ALL=(ALL) NOPASSWD: ALL then my PHP code was <?php $command = "cat /etc/passwd | cut -d\":\" -f1"; echo 'running the command: <b>'.$command."</b><br />"; echo exec($command); ?> it returns only one user (the last user) !!! how to make it return all users? thank you

    Read the article

  • Outlook 2007 plugin

    - by JL
    I am about to embark on my first outlook 2007 plugin. I would like to create a new tool bar that will have a button that will initially be disabled. When the user selects a message the button should be enabled... but only if the email is of a certain type of email... This is where I need your expert advice, is there a way to quickly flag an email in outlook, so that in the email select event you can look for a property of that email... for example... on_select if mail.type = "FromISP" then I would prefer not to use the from field.... the other thing is during the send process I need to set the flag, I am doing this again using .net so I have full control over how the mail is created. Any ideas would help... Thanks

    Read the article

  • Uploading an image file with Paperclip (in RoR) causing error.

    - by mtay
    This should be a simple thing to do, but I'm running into a wall and I'm not sure how to debug this response. In my Image model, I have: class Image < ActiveRecord::Base has_attached_file :image, :styles => { :display => "500x500>", :thumbnail => "95x95>"} Then in my Views, my form contains this: -form_for @image, :html => { :multipart => true } do |image| %tr %td.woc_left =label_tag :image, 'photo to upload', :class => 'required' %td.woc_center =image.file_field :image In my Mysql table, I have a column called "image_file_name" (string). However, when I try to upload an image and submit it, I see 2 errors prohibited this from being saved There were problems with the following fields: Image Paperclip::CommandNotFoundError Image Paperclip::CommandNotFoundError What am I doing wrong? Thank you for your help!

    Read the article

  • What is the best instance type to use for hosting a website on ec2?

    - by Josh
    Amazon offers two instance types on EC2: 1) On-Demand and 2) Reserved. After reading the docs on these, I don't really understand the difference from an end-user perspective. More specifically, I'd like to know the answer to this question: is one or the other better for web applications? Based on their names and descriptions, it seems as though on-demand instances may get wiped away from the server altogether if they're not in use which means that they need to be restarted when a request finally does come in. That seems like a pretty bad thing for a website. Am I just misinterpreting the docs? Thanks!

    Read the article

  • Integrate existing Spring based web application with a CMS

    - by anne_developer
    We have stable spring based (spring 2.x) web application. We have a new requirement which is our data entry operators should be able to login to some kind of an admin module and simply change the text in the web pages, change the color etc. I have seen PHP based CMS’s that allows authorized user to change the content in WYSIWYG manner. If anyone of you knows such open source Java CMS or third party application, which can facilitate such thing, please let me know. Please note: we cannot write our application from scratch. We are looking for pluggable component.

    Read the article

  • Creating a file/folder structure and zipping it up?

    - by makeee
    I have a directory of image files and I need a php script or shell script that will rename them, create a structure of nested directories, and then insert each image into a specified place in the directory hierarchy. Ideally I would just specify a parent directory for each file and a parent directory for each directory and it would build it. And then finally, I need the script to zip up the whole thing. There's probably not an existing php class that will do all this for me, but if anyone knows of a php class or other script available online that would handle a lot of this logic that would be great.

    Read the article

  • Singleton pattern with Web application, Not a good idea!!

    - by Tony
    Hi I found something funny, I notice it by luck while I was debugging other thing. I was applying MCP pattern and I made a singleton controller to be shared among all presentations. Suddenly I figured out that some event is called once at first postback, twice if there is two postback, 100 times if there is 100 postbacks. because Singleton is based on a static variable which hold the instance, and the static variable live across postbacks, and I wired the event assuming that it will be wired once, and rewired for each postback. I think we should think twice before applying a singleton in a web application, or I miss something?? thanks

    Read the article

  • Reading in MIPS external file so another file can use it?

    - by SkyWookie
    Hey all, I'm working on this final thing for my MIPS project and it's deceptively easy. I need to get a procedure (called feed) and let its main driver program use it by reading it in. I know that I'm supposed to use the call code 14 and .globl sym (I think) in order to feed it into the file and have it read it. I just need a basic tutorial or something, as I CANNOT find it on the Internet or in my book (just lists the call code, real helpful). Here's what I know: I need to use read, but I also need a file descriptor (don't know where to get it). I need to put the buffer in $a1 and the length in $a2. Well, that's about it. If there's any decent tutorial you could whip up or if there is one online that I don't see let me know please :). I just need a push in the right direction, I'm sure it can't be too difficult, just can't find any info on it!

    Read the article

  • Making a Png Image transparent in older versions of Internet Explorer...

    - by GUNNOO
    Hello People i have a problem with the png formatted images, i used some PNG images in my mock. when i view the mock in I.E the background of the images are not transparent. i got one solution for making it trasparent in "I.E" from the previous POSTS in the Forum. But my Problem is, i want that image to be tiled horizantlly...using that Filter thing. can any one solve this plz....plz.... i need a solution for making a png in I.E and at the same time it shud be tiled horizontally.

    Read the article

  • jQuery/Tablesorter: maintain secondary alphabetical sort

    - by user460847
    I have a table of names and ages that I want the user to be able to sort. When the page initally loads, sortList lists the rows in order from oldest to youngest, and then secondarily from A to Z. I want the same thing (a SECONDARY alphabetical sort) when the user actually clicks on the age <th>, but sortForce is making the alphabetical sort primary. Is there an alternative? $('#super_results table').tablesorter({ sortForce: [[0,0]], sortList: [[1,1],[0,0]] }); Or am I misunderstanding sortForce? Documentation here.

    Read the article

  • select field information with min time value

    - by Scarface
    Hey guys quick question, I thought I was doing the right thing but I keep getting the wrong result. I am trying to simply find the id of the entry with the min time, but I am not getting that entry. $qryuserscount1="SELECT id,min(entry_time) FROM scrusersonline WHERE topic_id='$topic_id'"; $userscount1=mysql_query($qryuserscount1); while ($row2 = mysql_fetch_assoc($userscount1)) { echo $onlineuser= $row2['id']; } That is my query, and it does not work. This however does work which does not make sense to me SELECT id FROM scrusersonline WHERE topic_id='$topic_id' ORDER by entry_time LIMIT 1, can anyone quickly point out what I am doing wrong?

    Read the article

  • Apache mod_rewrite help with Wordpress

    - by protohominid
    I administer my wife's site, namelymarly.com. Up until last week, the root page of the blog was namelymarly.com/blog/. Last week I changed it in the WP settings to be namelymarly.com. WP created the new htaccess file, and I moved the index.php to the root directory (but left the WP folder where it was in the /blog/ directory), as instructed. Everything is working great except for one very important thing: When you type 'namelymarly.com/blog/' into a browser now, you get a 404 error. All other URLs, when they include the '/blog/somethinghere', will redirect properly to '/somethinghere.' It's only when there's nothing after '/blog/' that there's a problem. I tried adding this rule but it breaks the site: RewriteRule ^/blog(/|)$ / Any suggestions/help?

    Read the article

  • I have a custom type which i want to serialize, this custom type accepts input which might consists

    - by starz26
    I have a custom type which i want to serialize, this custom type accepts input which might consists of escape chars. M1_Serilizer(MyCustomType customTypeObj) {XmlSerializer serializer = new XmlSerializer(typeof(MyCustomType)); StringWriter sw = new StringWriter(CultureInfo.InvariantCulture); serializer.Serialize(sw, customTypeObj); string str= sw.ToString(); M2_Deserializer(str); } M2_Deserializer(string str) { XmlSerializer serializer = new XmlSerializer(typeof(MyCustomType)); StringReader sr = new StringReader(str); MyCustomType customTypeObj = (MyCustomType)serializer.Deserialize(sr); } when escape type chars are part of the CustomTypeObj, on deserialization it throws an exception. Q1)How do i overcome this?, Q2)I should use StringReader and StringWriter and not memorystream or other thing ways. StringWriter/reader will only serve my internal functionality Q3)How can these escape chars be handled?

    Read the article

  • Why isn't this button firing the anchor tag?

    - by Noor
    My idea is to press a button that takes me to a web page. I've created a thing that dynamically creates a button and an anchor tag. When the button is clicked, I want it to "click"/fire up the anchor tag.. I've uploaded a demo to my site, when you try it out just leave everything as it is. Click the first button then the add button right away.. then try to click the dynamically created button. Nothing happens, but if you watch the source you can find an anchor tag with the ID FL1000, I've set it up so that the anchor tag gets the ID from the value of the created button + 1000 just incase I need to use that ID.. Thanks guys... edit: this is optimized for google chrome, haven't tried it out with other browser.

    Read the article

  • How can I create a single HTTP Get request for iPhone?

    - by Mph2
    Hi guys! First of all, sorry for my posibly bad english... I got a surely big stupid question... In my enterprise have an automatic door system, that is opened with a HTTP GET request to a file. Example: http://ipaddress/rc.cgi?o=1,50 Where the o=number indicates the amount of seconds that the automatic door will run. The is no need for authentification or nothing (that is made by LAN Radius). So, the question is... How can I make a single button (for example in the springboard) that when you touch it, runs the GET request? You thing that it should be possible with NSURLConection ? Thanks for all

    Read the article

  • Apply a class to a <h1> based on the site url

    - by user1870639
    I'm new to PHP and want to apply a specific class to the title of my page depending on what part of the site the viewer is browsing. For instance, I want to apply the class "blog" to the if the viewer is at domain.com/blog OR domain.com/blog/post-1 so on and so forth BUT apply the class "pics" if they're viewing domain.com/pics or domain.com/pics/gallery-1 etc etc. I found something that could be modified to serve my needs using javascript here but I figured seeing as I'm using PHP already, it'd make more sense to keep this sort of thing server side. As I say, I'm new to PHP. I've experimented with some regular expressions, but to no avail.

    Read the article

  • Hoard allocator not "working"?

    - by Cowboy
    I'm trying to Hoard allocator to work, but it seems it doesn't. I have a benchmark application that does a lot of dynamic memory management. The execution time for Hoard and glibc memory manager is the same. It makes me wonder if I'm doing the right thing. What I do is... export LD_PRELOAD="/path/libhoard.so" g++ main.cpp -O3 -o bm -lpthread -lrt Shouldn't I have to link to Hoard allocator? Does it matter what path (in LD_PRELOAD) is, or can I have whatever path? I'm running Ubuntu 8.04, and g++ 4.2.4 Cheers

    Read the article

  • An explanation of memory usage on Windows server 2003

    - by Rich
    Hi, We've been working on a bit of puzzle at work. We have an application service installed on two machines, both running Windows server 2003. These services do exactly the same thing. However once loaded, one of the services uses 200mb less than the other service. We're at a bit of a loss to what might be causing this discrepancy. I was wondering if there was some kind of server setting that would cause an application to use more memory (heap block size) or anything to explain this. If anyone has any ideas on what may be causing this, or how to find out what is causing this I'd be very grateful. Cheers Rich

    Read the article

  • VB.net Dataset display different column

    - by Josh
    Hello, I am sure this has to a comon thing I just can't find it. I am making a combobox from my data source. Basically, This is a projects form and the user needs to select the the primary contact which is contrained by the customer id (GETbyCustomerID) set in another field. I have it working... mostly except the combobox only displays the contact ID which is completely useless to the user. I need to know how to display the First and Last name (both are seperate columns in the table). Any help? I am just using the designer.

    Read the article

  • Windows service installed successfully but not responding after started.

    - by Ridhi
    I have a windows service written in C#, .Net framework 2.0. I installed it on three machines and it worked fine but on one machine (with .Net framework 2.0) the setup has installed the service successfully but the service is not responding after I start it. I check for this by checking whether a log file is created at a specific path insribed in the config file or not. This log file is created everytime the timer elapses the interval time. I'm unable to figure out the reason. Have checked all the parameters but unable to get any solution to this. The funny thing is that the same setup is running well on other machines. P.S.: I have admin access on all the servers I'm installing this service on.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Java Wicket - Calling javascript ( JQuery ) before AJAX

    - by user1428051
    I got this thing i'm trying to solve: I got a ListView created using Wicket ( 1.5 ) with a lot of elements and a scroll. When new items are available, the user is asked if he would like to refresh the list via a message backed by an AjaxLink: public void onClick(AjaxRequestTarget ajaxTarget) { /* do something ... */ ajaxTarget.addComponent(_list); } So on click the list gets reloaded and the scroll position is reset to zero. Is there any way i can call JavaScript before the list reloads the save the scroll position? (I know how to get/save the scroll position ( .scrollTop() ) , i just don't know how to call a function right before AJAX ).

    Read the article

< Previous Page | 504 505 506 507 508 509 510 511 512 513 514 515  | Next Page >