Search Results

Search found 19966 results on 799 pages for 'wild thing'.

Page 509/799 | < Previous Page | 505 506 507 508 509 510 511 512 513 514 515 516  | Next Page >

• User's possibilities on site

  - by Lari13

  I want to build a system on the website, that allows users to do some things depend on their rating. For example I have rule for rating value X: 1 post in 3 days 10 comments in 1 day 20 votes in 2 days for rating value Y, rule may be following: 3 post in 1 day 50 comments in 1 day 30 votes in 1 day Each night I recalculate users' ratings, so I know what each user is able to do. Possibilities don't sum or reset on each rating's recalculation. One more important thing is that admin can fill concrete user's possibilities at any time. What is optimal database (MySQL) structure for desired? I can count what concrete user has done: SELECT COUNT(*) FROM posts WHERE UserID=XXX AND DateOfPost >= 'YYY' SELECT COUNT(*) FROM comments WHERE UserID=XXX AND CommentOfPost >= 'YYY' But how can I do admin filling possibilities in this case?

  Read the article

• Knowledge mining using Hadoop.

  - by Anurag

  Hello there, I want to do a project Hadoop and map reduce and present it as my graduation project. To this, I've given some thought,searched over the internet and came up with the idea of implementing some basic knowledge mining algorithms say on a social websites like Facebook or may stckoverflow, Quora etc and draw some statistical graphs, comparisons frequency distributions and other sort of important values.For searching purpose would it be wise to use Apache Solr ? I want know If such thing is feasible using the above mentioned tools, if so how should I build up on this little idea? Where can I learn about knowledge mining algorithms which are easy to implement using java and map reduce techniques? In case this is a wrong idea please suggest what else can otherwise be done on using Hadoop and other related sub-projects? Thank you

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• django - where to clean extra whitespace from form field inputs?

  - by Westerley

  I've just discovered that Django doesn't automatically strip out extra whitespace from form field inputs, and I think I understand the rationale ('frameworks shouldn't be altering user input'). I think I know how to remove the excess whitespace using python's re: #data = re.sub('\A\s+|\s+\Z', '', data) data = data.strip() data = re.sub('\s+', ' ', data) The question is where should I do this? Presumably this should happen in one of the form's clean stages, but which one? Ideally, I would like to clean all my fields of extra whitespace. If it should be done in the clean_field() method, that would mean I would have to have a lot of clean_field() methods that basically do the same thing, which seems like a lot of repetition. If not the form's cleaning stages, then perhaps in the model that the form is based on? Thanks for your help! W.

  Read the article

• How to set up Node server for production on own machine?

  - by Matt Hintzke

  This must be a pretty basic thing to do, but I cannot find any good guide on how to do it on the internet. I only find how to set up a development environment for Node. I want to be able to forward my R-Pi's port 80 to my Node server, which I want to obviously listen on port 80. How can I close the native port 80 so that I can let me Node server listen on that port. Ultimately, I want to be able to access my pi from any remote location. I know how to set up a static IP and forward the port on my router, but now how do I allow Node into port 80?

  Read the article

• Java Wicket - Calling javascript ( JQuery ) before AJAX

  - by user1428051

  I got this thing i'm trying to solve: I got a ListView created using Wicket ( 1.5 ) with a lot of elements and a scroll. When new items are available, the user is asked if he would like to refresh the list via a message backed by an AjaxLink: public void onClick(AjaxRequestTarget ajaxTarget) { /* do something ... */ ajaxTarget.addComponent(_list); } So on click the list gets reloaded and the scroll position is reset to zero. Is there any way i can call JavaScript before the list reloads the save the scroll position? (I know how to get/save the scroll position ( .scrollTop() ) , i just don't know how to call a function right before AJAX ).

  Read the article

• Need Regex for to match special situations

  - by Daniel

  I'm desperately searching for regular expressions that match these scenarios: 1) Match alternating chars I've a string like "This is my foobababababaf string" - and I want to match "babababa" Only thing I know is the length of the fragment to search - I don't know what chars/digits that might be - but they are alternating. I've really no clue where to start :( 2) Match combined groups In a string like "This is my foobaafoobaaaooo string" - and I want to match "aaaooo". Like in 1) I don't know what chars/digits that might be. I only know that they will appear in two groups. I experimented using (.)\1\1\1(.)\1\1\1 and things like this...

  Read the article

• Prevent Apache from answering invalid requests

  - by nickdnk

  I have an Apache web-server that acts as a web front-end for iPhone and iPad applications that communicate by POST and JSON only. Is there any way to prevent Apache from answering requests that are invalid? I can see my error log is filled with attempts to open files such as /admin.php /index.php etc - files that don't exist on my server. I believe this is possible with IIS, but can you do the same thing with Apache? Basically I want the request to appear timed out unless you post exactly the right content to the right file - or at least if you do not request an existing file. This would make the server appear non-existing to everyone but my iPhone users as all communication is SSL and directories are not really guess-able. I did disable the ServerTokens and all that, but I still get File not found etc. when I access the server requesting a random file, which is what these bots do constantly.

  Read the article

• Beside SVN, how do you manage your development vs test vs production source code?

  - by medopal

  I'm working on a very large project with three phases of source code. Development source code: changes rapidly every second, and checked by our QA Test environment code: released to clients' QA department (released every 2-3 weeks) Production environment: after confirmed ok by client QA its released to prod. (every few months) The system (governmental web app) is very large to track changes,bugs and hot fixes, sometimes the Testers could ask for a change, some other times the Production could ask for a hot fix or small update. The problem is, when the Test or Production request changes, the development code is already changed a lot, and they always warn us they want only that small fix, do not upload anything new with it. The question, how should i manage the code for the 3 phases, and get back to Test or Production code any tie and fix that small one thing (reflecting the change to the current Development as well)? Note: making a branch each time is too much, and i don't want the developers to be lost between updating the mainstream, the branch and the Test code!

  Read the article

• Call OnDraw in another method, then "refresh" that call in ANOTHER method.

  - by Aidan

  Hey guys, Hopefully this will actually make sense and sorry if its a stupid / obvious question. Basically I'm calling the onDraw method like so... requestWindowFeature(Window.FEATURE_NO_TITLE); Preview mPreview = new Preview(this); DrawOnTop mDraw = new DrawOnTop(this); setContentView(mPreview); addContentView(mDraw, new LayoutParams (LayoutParams.WRAP_CONTENT, LayoutParams.WRAP_CONTENT)); You see I'm drawing it on top of a Camera view and the information being drawn is subject to change. I have a listener setup which will update the variables being drawn at the appropriate time but I now want to "refresh" this draw in that listener. How would I do such a thing?

  Read the article

• What are the disadvantages of using a StringBuilder?

  - by stickman

  I know that StringBuilder is more efficient than a normal string when processing code which modifies the string value a lot because although strings act like value types, they are actually reference, which makes them immutable so every time we change it, we need to create a new reference in memory. My question is that, why doesn't .NET just use stringBuilder by default? There must be some disadvantages of it over just using String. Can anyone tell me what they are? The only thing I can think of is perhaps it is a heavier object and it takes more time to instantiate so if you aren't changing the string too much, this would override the benefits of StringBuilder

  Read the article

• Determining child count of path

  - by sqlnewbie

  I have a table whose 'path' column has values and I would like to update the table's 'child_count' column so that I get the following output. path | child_count --------+------------- | 5 /a | 3 /a/a | 0 /a/b | 1 /a/b/c | 0 /b | 0 My present solution - which is way too inefficient - uses a stored procedure as follows: CREATE FUNCTION child_count() RETURNS VOID AS $$ DECLARE parent VARCHAR; BEGIN FOR parent IN SELECT path FROM my_table LOOP DECLARE tokens VARCHAR[] := REGEXP_SPLIT_TO_ARRAY(parent, '/'); str VARCHAR := ''; BEGIN FOR i IN 2..ARRAY_LENGTH(tokens, 1) LOOP UPDATE my_table SET child_count = child_count + 1 WHERE path = str; str := str || '/' || tokens[i]; END LOOP; END; END LOOP; END; $$ LANGUAGE plpgsql; Anyone knows of a single UPDATE statement that does the same thing?

  Read the article

• c# project cannot find c++ .dll?

  - by flavour404

  I have a working c++ dll that works in one c# project that I am calling via the interop service. I have created another c# project and am trying to call the same .dll but keep getting a generic error message stating that the .dll cannot be found, both project are .net 2.0. What folder, and where do I specify in the project, should I put the .dll file in so that the project can find it? Think of it as a reminder for me... In the previous project I did not have a reference to it, I just had it in the /bin folder and doing the same thing for this project does not work. Thanks R.

  Read the article

• How do customize the g:sortableColumn?

  - by kakaotalk

  Well, I have one column in my list that I need to customize, the thing is grails' own g:sortable doesn't work. For instance, my first column shows employee ids, then my second column, shows the employees full name where full name is a combination of first name and last name. I got it to work, sorting and all, but when I try to place it in a table with g:sortable, the g:sortable just wouldn't work. I'm thinking about passing params around but it's a bit tricky. Any suggestions? I've looked around the internet, and seems like nothing. :\

  Read the article

• out-of-the-box way to get an idmap from hibernate for a given entity?

  - by Geert-Jan

  Over and over again I notive myself getting a list from hibernate, and the first thing next is put it in an idmap like: List<House> entities = s.createCriteria(House.class).list(); Map<String,House> entitymap = new HashMap<String,House>(); for(TA_entity e:entities){ entitymap.put(e.getId(), e); } Is there a way to get this directly out of hibenerate? afterall Hibernate is familiar with the id.

  Read the article

• Android:simulating 1-bit display

  - by user1681805

  I'm new to Android,trying to build a simple game which use 1-bit black and white display.the screen dimension is 160 * 80,that is 12800 pixels.I created a byte array for the "VRAM",so each time it draws,it first checks the array. The thing is that I am not drawing a point or rectangle for each pixel,I'm using 2 bitmaps(ARGB_4444,I have to use alpha channel,because of shadow effect),1 for positive and 1 for negative.So I called 12800 times drawBitmap() in the surfaceView's Draw method.I know that's silly...But even for openGL,12800 quards won't be that fast right? Sorry..I cannot post imgs.the link of screenshot:http://i1014.photobucket.com/albums/af267/baininja/Screenshot_2013-10-22-01-05-36_zps91dbcdef.png should i totally give up this and draw points on a 160*80 bitmap then scale it to intented size?But that loses the visual effects.

  Read the article

• Loading Nested JS Files on the Page

  - by Aidin

  Hi, I have a JS file that is dependent to another Js file. this Js file is something like this (Common.js) //Some codes here window.onload = PageLoad; //some codes here and then I implement PageLoad function in another Js file. ( I do this because every page has its own PageLoad implementation) and I Load these files like this on my Main.aspx : `<asp:Content ID="Content1" ContentPlaceHolderID="ContentPlaceHolder1" Runat="Server">` `<\script language="javascript" type="text/javascript" src="PagesJS/pgeMain.js"></script>` `<\script language="javascript" type="text/javascript" src="JS/Common.js"></script>` ... ... `</asp:Content>` Every thing works fine on local but when I deploy it, sometimes I get PageLoad undefined Error! Can any one tells me what is wrong with this? Thanks. Aidin

  Read the article

• Intent resolution in Android

  - by Saksham

  Hello community, If I want to create custom address book (which overrides my phone's default address book), and if I want it to be used by all applications, what should be my intent filter? Does Android allow me to do such a thing considering the fact that such a third-party app could potentially be malicious?! And, if I want to have yet another address book application, I suppose the second app also has same intent-filter, isn't it? How does the framework decide which app to pick if I click on Contacts button when making a call? In other words, how does the framework resolve intents in case there is a conflict between multiple intent-filters? I'm new to android, so please excuse me if this question is stupid. I would like to get some feedback in any case! Thanks in advance, Saksham

  Read the article

• Using php to create a password system with chinese characters

  - by WillDonohoe

  Hi guys, I'm having an issue with validating chinese characters against other chinese characters, for example I'm creating a simple password script which gets data from a database, and gets the user input through get. The issue I'm having is for some reason, even though the characters look exactly the same when you echo them out, my if statement still thinks they are different. I have tried using the htmlentities() function to encode the characters, the password from the database encodes nicely, giving me a working '& #35441;' (I've put a space in it to stop it from converting to a chinese character!). The other user input value gives me a load of funny characters. The only thing which I believe must be breaking it, is it encodes in a different way and therefore the php thinks it's 2 completely different strings. Does anybody have any ideas? Thanks in advance, Will

  Read the article

• What is the best way to deal with address inputs that can be from multiple countries?

  - by Andrew.S

  Most of my websites in the past have been rather limited to the United States when it came to displaying addresses. On a project I'm working on right now, however, users can add events from all over the world. My problem is how to go about dealing with the different way in which addresses are displayed across the world. For example, City/State/Zip is just a US thing. I was figuring I would alter the inputs displayed based on the country selected but I have no idea how I'm supposed to know the way every single country does addresses. Ideas?

  Read the article

• jQuery on() method not working for appended elements

  - by behz4d

  I know I should use on() method for triggering appended elements and not use click(), so: $('#change_profile_img').on('click', function(){ alert(1); }); so the above code is working fine on any elements unless the appended elements, for example, I'm appending: $('.companylogo:first').append('<a id="change_profile_img" class="ic_change">CHANGE IMAGE</a>'); after it's appended, it's not working, but after a page refresh it works just fine. Another thing that I should mention, I'm doing the append from a modal page, it appends the button and everything but I could not trigger it anymore... I would appreciate any kind of help. Thanks

  Read the article

• JDBC Pagination

  - by Zeeshan

  Hi, I want to implement pagination using JDBC. The actual thing I want to know is "How can i get first 50 and then next 50 records from database for page 1 and 2 respectively" My Query is Select * from data [data table contains 20,000 rows] For page #1 I get 50 records and for page #2 I want to get next 50 records. How can I implement it efficiently in JDBC? I have searched and found that rs.absolute(row) is the way to skip first page records but it takes some amount of time on large result sets and I don't want to bear this amount of time. Also, I don't want to use rownum and limit + offset in query because these are not good to use in query, I dont know why, still I don't want to use it in query. Can anyone help me how to get limited ResultSet for pagination or is there any way JDBC is giving us?

  Read the article

• How to use Externel Procedures in Triggers on Oracle 11g..

  - by RBA

  Hi, I want to fire a trigger whenever an insert command is fired.. The trigger will access a pl/sql file which can change anytime.. So the query is, if we design the trigger, how can we make sure this dynamic thing happens.. As during the stored procedure, it is not workingg.. I think - it should work for 1) External Procedures 2) Execute Statement Please correct me, if I am wrong.. I was working on External Procedures but i am not able to find the way to execute the external procedure from here on.. SQL> CREATE OR REPLACE FUNCTION Plstojavafac_func (N NUMBER) RETURN NUMBER AS 2 LANGUAGE JAVA 3 NAME 'Factorial.J_calcFactorial(int) return int'; 4 / @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@ SQL> CREATE OR REPLACE TRIGGER student_after_insert 2 AFTER INSERT 3 ON student 4 FOR EACH ROW How to call the procedure from heree... And does my interpretations are right,, plz suggest.. Thanks.

  Read the article

• Return the difference between the lowest and highest key

  - by stan

  This is a past exam paper i am attempting and have no way to check if the out put is correct as i am not capable of building one of these things the question is in the title class Tree{ Tree left; Tree right; int key; public static int span(Tree tree) { if ( tree == null ){ return null; } if( tree.left != null) int min = span(tree.left); } if( tree.right != null){ int max = span(tree.right); } return max - min; } } Could anyone suggest what i need to change to get 5/5 marks :D - the only thing we have to do is write the span method, the header was given for us Thanks

  Read the article

• Submit multiple forms as one

  - by Stephen Sarcsam Kamenar

  I have two forms on the page. To the user it looks like 1 form, and I actually wish it was one form. But the way I'm trying to reuse code and include things, I can't avoid two forms in the source code... trying to act as one. I don't want to do ajax submit, I want a normal post submit, my form handler has redirects in it. How can I submit both of these, and get values that make sense on the server side. something like $_POST['form1]['whatever'] $_POST['form2]['thing'] Maybe take all the inputs from form 2, rename all of them with a prefix, and append them to form 1? I can't find a non-messy way of doing this. I don't think I need code, just a plan. Least messy idea wins.

  Read the article

< Previous Page | 505 506 507 508 509 510 511 512 513 514 515 516  | Next Page >