Search Results

Search found 19966 results on 799 pages for 'wild thing'.

Page 509/799 | < Previous Page | 505 506 507 508 509 510 511 512 513 514 515 516  | Next Page >

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• .NET framework is copied to 'compiler/CLR' and 'GAC?

  - by prosseek

  The book of CLR via C# has this line at page 76. When you install the .NET Framework, tow copies of Microsoft's assembly files are actuall installed. One set is installed into the compiler/CLR directory, and another set is installed into GAC subdirectory I could find the GAC at C:\Windows\Microsoft.NET\assembly, but I couldn't find the compiler/CLR thing. What's the physical directory name of compiler/CLR? I mean, where is it? Why there are two GAC in assembly directory? I find GAC_32 and GAC_MSIL.

  Read the article

• Problem in populating a dictionary object using Enumerable.Range() (C#3.0)

  - by Newbie

  If I do for (int i = 0; i < appSettings.Count; i++) { string key = appSettings.Keys[i]; euFileDictionary.Add(key, appSettings[i]); } It is working fine. When I am trying the same thing using Enumerable.Range(0, appSettings.Count).Select(i => { string Key = appSettings.Keys[i]; string Value = appSettings[i]; euFileDictionary.Add(Key, Value); }).ToDictionary<string,string>(); I am getting a compile time error The type arguments for method 'System.Linq.Enumerable.Select(System.Collections.Generic.IEnumerable, System.Func)' cannot be inferred from the usage. Try specifying the type arguments explicitly. Any idea? Using C#3.0 Thanks

  Read the article

• jQuery on() method not working for appended elements

  - by behz4d

  I know I should use on() method for triggering appended elements and not use click(), so: $('#change_profile_img').on('click', function(){ alert(1); }); so the above code is working fine on any elements unless the appended elements, for example, I'm appending: $('.companylogo:first').append('<a id="change_profile_img" class="ic_change">CHANGE IMAGE</a>'); after it's appended, it's not working, but after a page refresh it works just fine. Another thing that I should mention, I'm doing the append from a modal page, it appends the button and everything but I could not trigger it anymore... I would appreciate any kind of help. Thanks

  Read the article

• Modifying an inherited Rails association

  - by Chris Kilmer

  I have a Team class that inherits from a Group class. Both Team and Groups have memberships through the same association. However, I need to run a method after a Team memberships is added but not a Group. I currently have something like this: class Group < ActiveRecord::Base has_many :memberships, :class_name => 'Connection', :foreign_key => 'connectable_id', :as => :connectable, :dependent => :destroy end class Team < Group has_many :memberships, :class_name => 'Connection', :foreign_key => 'connectable_id', :as => :connectable, :dependent => :destroy, :after_add => :add_company_membership private def membership_check(membership) end end Is there some way to modify the inherited association in Team so that I don't have to redefine the entire thing but rather just add the :after_add hook it? Any help would be appreciated.

  Read the article

• [Python] Help me : how i can deal with web page !

  - by Str1k3r

  hello every one... am looking for modules or functions let's me joins in id web !!!! i mean like i told python go to hotmail.com then go to signup ! how i can do that i mean how i can tell python go to hotmail.com then find some thing called signup in source page then i tell him join to him ....etc i hope you understand my idea ! ** am thinking on urllib2 .. maybe it's can do that? am just new in python

  Read the article

• SQL: Interrupting a query

  - by NoozNooz42

  I've worked on a project using a proprietary non-SQL DB where queries could be interrupted and in the codebase there were quite some spots where that functionnality was used and made perfect sense (for example to stop a long running query that gets cancelled by the user, or when a more recent query takes place and renders the previous query obsolete, etc.) and I realized I never really saw that kind of "interrupted queries" previously and thought it could make a good SO question (several questions, but they're all related to exactly the same thing): can SQL queries be interrupted? is this part of the SQL standard? if it's not part of the SQL standard, which SQL DBs allow queries to be interrupted (any example most welcome)? is it common to interrupt a DB query (SQL or not) which you'll know you won't care about the result anymore? (in the codebase I've worked on, it sure helps lighten the server's load)

  Read the article

• MySql php: check if Row exists

  - by Jeff

  This is probably an easy thing to do but I'm an amateur and things just aren't working for me. I just want to check and see if a row exists where the $lectureName shows. If a row does exist with the $lectureName somewhere in it, I want the function to return "assigned" if not then it should return "available". Here's what I have. I'm fairly sure its a mess. Please help. function checkLectureStatus($lectureName) { $con = connectvar(); mysql_select_db("mydatabase", $con); $result = mysql_query("SELECT * FROM preditors_assigned WHERE lecture_name='$lectureName'"); while($row = mysql_fetch_array($result)); { if (!$row[$lectureName] == $lectureName) { mysql_close($con); return "Available"; } else { mysql_close($con); return "Assigned"; } } When I do this everything return available, even when it should return assigned.

  Read the article

• Compilation failing - no #include - boost

  - by jwoolard

  Hi, I'm trying to compile a third-party library, but g++ is complaining about the following line: typedef boost::shared_ptr<MessageConsumer> MessageConsumerPtr; The strange thing is, there is no #include directive in the file - and it is clearly supposed to be this way; there are about 60 files with the same (or very similar) issues. Clearly if there was an #include directive referencing the relevant boost header this would compile cleanly. My question is: how can I get g++ to somehow automagically find the relevant symbol (in all instances of this issue, it is a namespace that can't be found - usually std:: or boost::) by either automatically processing the relevant header (or some other mechanism). Thanks. Edit My current g++ call looks like: g++ -fPIC -O3 -DUSING_PCH -D_REENTRANT -I/usr/include/boost -I./ -c MessageInterpreter.cpp -o MessageInterpreter.o

  Read the article

• Should I be using libraries if I'm trying to learn how to program?

  - by CodeJustin.com

  I have been programming "a lot" in the past few months and at first I was trying to find the "easyest" language. Fortunately I realized that it's not about the language, it's about learning HOW to code. I ran into the Stanford lectures online (programming methodology) and I watched them all (around 23 hours total) awhile ago. Then I got into Java ME and programmed about 28.47% of a mobile RPG game (only around 2k lines of code). I feel like I learned a lot from those two experiences compared to previous ones but now that I'm moving into flash/actionscript 3.0 development and I'm finding myself learning like I did when I first started with PHP. I'm not really getting whats under the hood kind of. I'm finding myself using libraries to speed up development time which doesn't seem like a bad thing BUT I personally do not know how to write the libraries myself off hand. So should I be coding everything myself or is it ok to use libraries when you don't even know how to code them?

  Read the article

• Loading Nested JS Files on the Page

  - by Aidin

  Hi, I have a JS file that is dependent to another Js file. this Js file is something like this (Common.js) //Some codes here window.onload = PageLoad; //some codes here and then I implement PageLoad function in another Js file. ( I do this because every page has its own PageLoad implementation) and I Load these files like this on my Main.aspx : `<asp:Content ID="Content1" ContentPlaceHolderID="ContentPlaceHolder1" Runat="Server">` `<\script language="javascript" type="text/javascript" src="PagesJS/pgeMain.js"></script>` `<\script language="javascript" type="text/javascript" src="JS/Common.js"></script>` ... ... `</asp:Content>` Every thing works fine on local but when I deploy it, sometimes I get PageLoad undefined Error! Can any one tells me what is wrong with this? Thanks. Aidin

  Read the article

• How to set up Node server for production on own machine?

  - by Matt Hintzke

  This must be a pretty basic thing to do, but I cannot find any good guide on how to do it on the internet. I only find how to set up a development environment for Node. I want to be able to forward my R-Pi's port 80 to my Node server, which I want to obviously listen on port 80. How can I close the native port 80 so that I can let me Node server listen on that port. Ultimately, I want to be able to access my pi from any remote location. I know how to set up a static IP and forward the port on my router, but now how do I allow Node into port 80?

  Read the article

• One application instance for two domain name

  - by dervlap

  Hello, I have two web applications in ASP.NET which are quite the same (same business logic, same DAL, same DB scheme but different instance). The only thing that I need to change is the design (logo, color,...) and the text (global and local resource) to adress two separate business sector. We cannot "subdomain" the application because we need the two app "seems to be" independant. Is it a good idea to run only one instance for the 2 web applications. For example : I will have 2 hostnames : mycompagny.com and mycompagny2.com and I will put an HTTP Module which will set a string which will be propagated in my application like 'company' and 'company2'. I will instanciate the dal only once but the connection string will change depending on the string 'company' or 'company2'. Any pros and cons ? Any other alternatives ?

  Read the article

• C++ Char without Limit

  - by Lienau

  I'm pretty well versed in C#, but I decided it would be a good idea to learn C++ as well. The only thing I can't figure out is chars. I know you can use the string lib but I also want to figure out chars. I know you can set a char with a limit like this: #include <iostream> using namespace std; int main() { char c[128] = "limited to 128"; cout << c << endl; system("pause"); return 0; } But how would I make a char without a limit? I've seen chars with * but I though that was for pointers. Any help is greatly appreciated.

  Read the article

• Using "as" and expecting a null return

  - by DrLazer

  For example. Lets say we have a stackpanel on a form. Its full of both Grids and Labels. I want to loop through all the Grids and do some operation on them but leave the Lables intact. At the moment I am doing it this way. foreach(UIElement element in m_stacker.Children) { Grid block = element as Grid; if(block != null) { //apply changes here } } So i'm using the fact that "as" returns null if it cannot cast into the required type. Is this an ok thing to do or is there a better solution to this problem?

  Read the article

• What is the best way to deal with address inputs that can be from multiple countries?

  - by Andrew.S

  Most of my websites in the past have been rather limited to the United States when it came to displaying addresses. On a project I'm working on right now, however, users can add events from all over the world. My problem is how to go about dealing with the different way in which addresses are displayed across the world. For example, City/State/Zip is just a US thing. I was figuring I would alter the inputs displayed based on the country selected but I have no idea how I'm supposed to know the way every single country does addresses. Ideas?

  Read the article

• hook to save action in eclipse plugin

  - by 4485670

  I want to create a Google Closure Compiler plugin for eclipse. I already have a popup menu entry to compile a Javascript file to its minified version. But it would be more than helpful if every time you save a *.js that minified version would be generated automatically. I read/heard about natures and builders, extension points and IResourceChangeListener. But I did not manage to figure out what I should use and especially how to get it to work. Is there a working example of a plugin that does "the same kind of thing" so I can work from that or a tutorial to write such? With the answer below I searched for projects that use the IResourceChangeListener and came up with this code: manifest: http://codepaste.net/3yahwe plugin.xml: http://codepaste.net/qek3rw activator: http://codepaste.net/s7xowm DummyStartup: http://codepaste.net/rkub82 MinifiedJavascriptUpdater: http://codepaste.net/koweuh There in the MinifiedJavascriptUpdater.java which holds the code for the IResourceChangeListener the "resourceChanged" function is never reached.

  Read the article

• Variable pre-fixes, Visual Studio 2010 onwards?

  - by thedixon

  I'm a bit bewildered on this subject, as I relate variable prefixes to being a thing of the past now, but with Visual Studio 2010 onwards (I'm currently using 2012), do people still do this and why? I only ask because, these days, you can hover over any variable and it'll tell you the variable type and scope. There's literally no requirement for pre-fixing being there for readability. By this I mean: string strHello int intHello etc. And I'm being language/tool biased here - as Visual Studio takes a lot of the legwork out for you in terms of seeing exactly what type the variable is, including after conversions in the code. This is not a "general programming" question.

  Read the article

• What is the best instance type to use for hosting a website on ec2?

  - by Josh

  Amazon offers two instance types on EC2: 1) On-Demand and 2) Reserved. After reading the docs on these, I don't really understand the difference from an end-user perspective. More specifically, I'd like to know the answer to this question: is one or the other better for web applications? Based on their names and descriptions, it seems as though on-demand instances may get wiped away from the server altogether if they're not in use which means that they need to be restarted when a request finally does come in. That seems like a pretty bad thing for a website. Am I just misinterpreting the docs? Thanks!

  Read the article

• Javascript keeps undefining my vars, it's harshing my buzz. Help?

  - by Keene Maverick

  This is my first experience with javascript, and... Well... Ugh. Here's what's happening: function step_1(id) { //blah blah step_2(id); } function step_2(id) { //blah blah step_3(id); } function step_3(id) { //blah blah alert(id); } step_1(0); // I can stick any number here, same thing happens... The alert pops up and says "Undefined". But, if I throw an alert(id); in step_2, then both alerts say "0". Why/how is id undefined? What am I doing wrong? I've even tried reassigning id in each function, like: var nid = id; step_2(nid); etc... But that still doesn't work without the alerts.

  Read the article

• how i insert values from list of Data Grid View,current time ,EmployeeID using button click event (C

  - by Six fourty

  hi, it show me this error Incorrect syntax near the keyword 'Select' to make to clear Employee ID in this case is FK in the table (Attendance detail) and the other thing is i am using Data Grid View from another table(Employee information) to Show the list of the staff in my form. then i want to transfer each selected cell value from Data Grid View to attendance detail table. 10q private void time_in_Click(object sender, EventArgs e) { employee_InformationDataGridView.SelectedCells[0].Style.ForeColor = Color.Green; time_in.Enabled = false; time_out.Enabled = true; con = new SqlConnection(GlobalClass.conn); con.Open(); SqlCommand cmd = new SqlCommand("Insert into Attendancedetail Values(" + "Select from EmployeeInformation(EmployeeID)" + ",'" + employee_InformationDataGridView.SelectedCells[0] + "','" + DateTime.Now.ToLongDateString() + "','" + null + "','" + null + "','" + DateTime.Now.ToLongTimeString() + "'," + null + ")", con); int i = cmd.ExecuteNonQuery(); MessageBox.Show(i.ToString() + " record inserted"); }

  Read the article

• how to make PHP lists all Linux Users?

  - by Data-Base

  Hello I want to build a php based site that (automate) some commands on my Ubuntu Server first thing I did was going to the file (sudoers) and add the user www-data so I can execute php commands with root privileges! # running the web apps with root power!!! www-data ALL=(ALL) NOPASSWD: ALL then my PHP code was <?php $command = "cat /etc/passwd | cut -d\":\" -f1"; echo 'running the command: <b>'.$command."</b><br />"; echo exec($command); ?> it returns only one user (the last user) !!! how to make it return all users? thank you

  Read the article

• How to use the sum the value of 2 totals in different table (Reporting Services)?

  - by dewacorp.alliances

  Hi there In report design, I have 2 tables (Current and Proposed) the structure like this: Current Parameter | Value | Rate | Total Value ... Proposed Parameter | Value | Rate | Total Value ... Each bottom of the table (Table Footer), I have something called: "Total: " which is a sum of Total field. I called these textboxes are txtbxCurrent and txtbxProposed and the format is in currency already. This thing is running well. But now I need to get a total of these txtbxCurrent and txtbxProposed. How do I do this? Can I take the value of this or not? BTW .. I am using Ms SQL Server 2005 (ReportViewer - client) Also here my dataset looks like: RecID | Type | Parameter | Value | Rate | Total 1, CURRENT, 'Param1', 100, 0.1, 10 1, CURRENT, 'Param2', 200, 0.2, 10 1, PROPOSED, 'Param1', 100, 0.2, 20 1, PROPOSED, 'Param2', 200, 0.2, 20 Thanks

  Read the article

• Outlook 2007 plugin

  - by JL

  I am about to embark on my first outlook 2007 plugin. I would like to create a new tool bar that will have a button that will initially be disabled. When the user selects a message the button should be enabled... but only if the email is of a certain type of email... This is where I need your expert advice, is there a way to quickly flag an email in outlook, so that in the email select event you can look for a property of that email... for example... on_select if mail.type = "FromISP" then I would prefer not to use the from field.... the other thing is during the send process I need to set the flag, I am doing this again using .net so I have full control over how the mail is created. Any ideas would help... Thanks

  Read the article

• control.focus() after selectedIndexChanged

  - by kyle

  I need to focus on a textbox after an item has been selected from a dropdownlist. I've tried control.focus() and setfocus(). The last thing I've tried was Set_Focus(dtbEffectiveDate.ClientID) inside the SelectedIndexChanged method with the folowing method. Protected Sub Set_Focus(ByVal ControlName As String) Dim strScript As String strScript = "<script language=javascript> window.setTimeout(""" + ControlName + ".focus();"",0); </script>" RegisterStartupScript("focus", strScript) End Sub I'm out of answers so any help would be awesome.

  Read the article

< Previous Page | 505 506 507 508 509 510 511 512 513 514 515 516  | Next Page >