Search Results

Search found 43274 results on 1731 pages for 'single line'.

Page 513/1731 | < Previous Page | 509 510 511 512 513 514 515 516 517 518 519 520  | Next Page >

  • getting java.lang.OutOfMemoryError exception while running a Midlet (using netbeans)

    - by Jeeka
    I am writing a Midlet(using Netbeans) which reads a file containing exactly 2400 lines (each line being 32 characters long) and (extract a part of each line) puts them in an array. I am doing the same for 11 such files( all files have exactly 2400 lines).The Midlet runs fine for reading 6 files and putting them in 6 arrays. However, the Midlet stops while doing it for the 7th file throwing the following exception: TRACE: , startApp threw an Exception java.lang.OutOfMemoryError (stack trace incomplete) java.lang.OutOfMemoryError (stack trace incomplete) I have tried the modifying the netbeans.conf file to increase the heap memory ( as suggested by many forums and blogs) but nothing works for me. Here are the parameters that i had modified in the netbeans.conf file: -J-Xss2m -J-Xms1024m -J-Xmx1024m -J-XX:PermSize=1024m -J-XX:MaxPermSize=1536m -J-XX:+UseConcMarkSweepGC -J-XX:+CMSClassUnloadingEnabled -J-XX:+CMSPermGenSweepingEnabled Can anyone please help me to get me out of this ! I badly need this to be sorted out ASAP ! Thanks in advance !

    Read the article

  • Python - werid behavior

    - by orokusaki
    I've done what I shouldn't have done and written 4 modules (6 hours or so) without running any tests along the way. I have a method inside of /mydir/__init__.py called get_hash(), and a class inside of /mydir/utils.py called SpamClass. /mydir/utils.py imports get_hash() from /mydir/__init__. /mydir/__init__.py imports SpamClass from /mydir/utils.py. Both the class and the method work fine on their own but for some reason if I try to import /mydir/, I get an import error saying "Cannot import name get_hash" from /mydir/__init__.py. The only stack trace is the line saying that __init__.py imported SpamClass. The next line is where the error occurs in in SpamClass when trying to import get_hash. Why is this?

    Read the article

  • SQL error C# - Parameter already defined

    - by jakesankey
    Hey there. I have a c# application that parses txt files and imports the data from them into a sql db. I was using sqlite and am now working on porting it to sql server. It was working fine with sqlite but now with sql i am getting an error when it is processing the files. It added the first row of data to the db and then says "parameter @PartNumber has already been declared. Variable names must be unique within a batch or stored procedure". Here is my whole code and SQL table layout ... the error comes at the last insertCommand.ExecuteNonQuery() instance at the end of the code... SQL TABLE: CREATE TABLE Import ( RowId int PRIMARY KEY IDENTITY, PartNumber text, CMMNumber text, Date text, FeatType text, FeatName text, Value text, Actual text, Nominal text, Dev text, TolMin text, TolPlus text, OutOfTol text, FileName text ); CODE: using System; using System.Data; using System.Data.SQLite; using System.IO; using System.Text.RegularExpressions; using System.Threading; using System.Collections.Generic; using System.Linq; using System.Data.SqlClient; namespace JohnDeereCMMDataParser { internal class Program { public static List<string> GetImportedFileList() { List<string> ImportedFiles = new List<string>(); using (SqlConnection connect = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { connect.Open(); using (SqlCommand fmd = connect.CreateCommand()) { fmd.CommandText = @"IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT DISTINCT FileName FROM Import; END"; fmd.CommandType = CommandType.Text; SqlDataReader r = fmd.ExecuteReader(); while (r.Read()) { ImportedFiles.Add(Convert.ToString(r["FileName"])); } } } return ImportedFiles; } private static void Main(string[] args) { Console.Title = "John Deere CMM Data Parser"; Console.WriteLine("Preparing CMM Data Parser... done"); Console.WriteLine("Scanning for new CMM data... done"); Console.ForegroundColor = ConsoleColor.Gray; using (SqlConnection con = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { con.Open(); using (SqlCommand insertCommand = con.CreateCommand()) { SqlCommand cmdd = con.CreateCommand(); string[] files = Directory.GetFiles(@"C:\Documents and Settings\js91162\Desktop\", "R303717*.txt*", SearchOption.AllDirectories); List<string> ImportedFiles = GetImportedFileList(); foreach (string file in files.Except(ImportedFiles)) { string FileNameExt1 = Path.GetFileName(file); cmdd.CommandText = @" IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT COUNT(*) FROM Import WHERE FileName = @FileExt; END"; cmdd.Parameters.Add(new SqlParameter("@FileExt", FileNameExt1)); int count = Convert.ToInt32(cmdd.ExecuteScalar()); con.Close(); con.Open(); if (count == 0) { Console.WriteLine("Parsing CMM data for SQL database... Please wait."); insertCommand.CommandText = @" INSERT INTO Import (FeatType, FeatName, Value, Actual, Nominal, Dev, TolMin, TolPlus, OutOfTol, PartNumber, CMMNumber, Date, FileName) VALUES (@FeatType, @FeatName, @Value, @Actual, @Nominal, @Dev, @TolMin, @TolPlus, @OutOfTol, @PartNumber, @CMMNumber, @Date, @FileName);"; insertCommand.Parameters.Add(new SqlParameter("@FeatType", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@FeatName", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Value", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Actual", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Nominal", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Dev", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolMin", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolPlus", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@OutOfTol", DbType.Decimal)); string FileNameExt = Path.GetFullPath(file); string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); string[] lines = File.ReadAllLines(file); bool parse = false; foreach (string tmpLine in lines) { string line = tmpLine.Trim(); if (!parse && line.StartsWith("Feat. Type,")) { parse = true; continue; } if (!parse || string.IsNullOrEmpty(line)) { continue; } Console.WriteLine(tmpLine); foreach (SqlParameter parameter in insertCommand.Parameters) { parameter.Value = null; } string[] values = line.Split(new[] { ',' }); for (int i = 0; i < values.Length - 1; i++) { SqlParameter param = insertCommand.Parameters[i]; if (param.DbType == DbType.Decimal) { decimal value; param.Value = decimal.TryParse(values[i], out value) ? value : 0; } else { param.Value = values[i]; } } insertCommand.Parameters.Add(new SqlParameter("@PartNumber", RNumberE)); insertCommand.Parameters.Add(new SqlParameter("@CMMNumber", RNumberD)); insertCommand.Parameters.Add(new SqlParameter("@Date", cmmDate)); insertCommand.Parameters.Add(new SqlParameter("@FileName", FileNameExt)); // insertCommand.ExecuteNonQuery(); } } } Console.WriteLine("CMM data successfully imported to SQL database..."); } con.Close(); } } } }

    Read the article

  • Bash or python for changing spacing in files

    - by Werner
    Hi, I have a set of 10000 files. In all of them, the second line, looks like: AAA 3.429 3.84 so there is just one space (requirement) between AAA and the two other columns. The rest of lines on each file are completely different and correspond to 10 columns of numbers. Randomly, in around 20% of the files, and due to some errors, one gets BBB 3.429 3.84 so now there are two spaces between the first and second column. This is a big error so I need to fix it, changing from 2 to 1 space in the files where the error takes place. The first approach I thought of was to write a bash script that for each file reads the 3 values of the second line and then prints them with just one space, doing it for all the files. I wonder what do oyu think about this approach and if you could suggest something better, bashm python or someother approach. Thanks

    Read the article

  • System.Diagnostics.Debugger.Debug() stopped working

    - by Andrew Miner
    I'm working on a program which uses the System.Diagnostics.Debugger.Break() method to allow the user to set a breakpoint from the command-line. This has worked fine for many weeks now. However, when I was working on fixing a unit test today, I tried to use the debug switch from the command-line, and it didn't work. Here's what I've tried: I've confirmed that the Debug() method is really being called (by putting a System.Console.WriteLine() after it) I've confirmed that the build is still in Debug I've done a clean build I've restarted Product Studio A quick Google search didn't reveal anything, and the API documentation for .Net doesn't mention anything about this function not performing correctly. So... any ideas?

    Read the article

  • Drupal theme preprocess function - primary links and suckerfish menus

    - by slimcady
    I have a preprocess function that works fine when the menu is single level list. However I would like it to work w/ suckerfish menus. I want to add a class to the top level menu item so that I can style it. This is the code I used for the single level menu: function cti_flex_preprocess_page(&$vars, $hook) { // Make a shortcut for the primary links variables $primary_links = $vars['primary_links']; // Loop thru the menu, adding a new class for CSS selectors $i = 1; foreach ($primary_links as $link => $attributes){ // Append the new class to existing classes for each menu item $class = $attributes['attributes']['class'] . " item-$i"; // Add revised classes back to the primary links temp variable $primary_links[$link]['attributes']['class'] = $class; $link['title'] = '<span class="hide">' . check_plain($link['title']) . '</span>'; $i++; } // end the foreach loop // reset the variable to contain the new markup $vars['primary_links'] = $primary_links; } I've been trying to use the menu_tree() function to no avail, for example: function cti_flex_preprocess_page(&$vars, $hook) { // Make a shortcut for the primary links variables $primary_links = $vars['primary_links']; // Loop thru the menu, adding a new class for CSS selectors $i = 1; foreach ($primary_links as $link => $attributes){ // Append the new class to existing classes for each menu item $class = $attributes['attributes']['class'] . " item-$i"; // Add revised classes back to the primary links temp variable $primary_links[$link]['attributes']['class'] = $class; $link['title'] = '<span class="hide">' . check_plain($link['title']) . '</span>'; $i++; } // end the foreach loop // reset the variable to contain the new markup $vars['primary_links_tree'] = menu_tree(variable_get('menu_primary_links_source', '$primary_links')); } Any ideas would be greatly appreciated.

    Read the article

  • Access violation using LocalAlloc()

    - by PaulH
    I have a Visual Studio 2008 Windows Mobile 6 C++ application that is using an API that requires the use of LocalAlloc(). To make my life easier, I created an implementation of a standard allocator that uses LocalAlloc() internally: /// Standard library allocator implementation using LocalAlloc and LocalReAlloc /// to create a dynamically-sized array. /// Memory allocated by this allocator is never deallocated. That is up to the /// user. template< class T, int max_allocations > class LocalAllocator { public: typedef T value_type; typedef size_t size_type; typedef ptrdiff_t difference_type; typedef T* pointer; typedef const T* const_pointer; typedef T& reference; typedef const T& const_reference; pointer address( reference r ) const { return &r; }; const_pointer address( const_reference r ) const { return &r; }; LocalAllocator() throw() : c_( NULL ) { }; /// Attempt to allocate a block of storage with enough space for n elements /// of type T. n>=1 && n<=max_allocations. /// If memory cannot be allocated, a std::bad_alloc() exception is thrown. pointer allocate( size_type n, const void* /*hint*/ = 0 ) { if( NULL == c_ ) { c_ = LocalAlloc( LPTR, sizeof( T ) * n ); } else { HLOCAL c = LocalReAlloc( c_, sizeof( T ) * n, LHND ); if( NULL == c ) LocalFree( c_ ); c_ = c; } if( NULL == c_ ) throw std::bad_alloc(); return reinterpret_cast< T* >( c_ ); }; /// Normally, this would release a block of previously allocated storage. /// Since that's not what we want, this function does nothing. void deallocate( pointer /*p*/, size_type /*n*/ ) { // no deallocation is performed. that is up to the user. }; /// maximum number of elements that can be allocated size_type max_size() const throw() { return max_allocations; }; private: /// current allocation point HLOCAL c_; }; // class LocalAllocator My application is using that allocator implementation in a std::vector< #define MAX_DIRECTORY_LISTING 512 std::vector< WIN32_FIND_DATA, LocalAllocator< WIN32_FIND_DATA, MAX_DIRECTORY_LISTING > > file_list; WIN32_FIND_DATA find_data = { 0 }; HANDLE find_file = ::FindFirstFile( folder.c_str(), &find_data ); if( NULL != find_file ) { do { // access violation here on the 257th item. file_list.push_back( find_data ); } while ( ::FindNextFile( find_file, &find_data ) ); ::FindClose( find_file ); } // data submitted to the API that requires LocalAlloc()'d array of WIN32_FIND_DATA structures SubmitData( &file_list.front() ); On the 257th item added to the vector<, the application crashes with an access violation: Data Abort: Thread=8e1b0400 Proc=8031c1b0 'rapiclnt' AKY=00008001 PC=03f9e3c8(coredll.dll+0x000543c8) RA=03f9ff04(coredll.dll+0x00055f04) BVA=21ae0020 FSR=00000007 First-chance exception at 0x03f9e3c8 in rapiclnt.exe: 0xC0000005: Access violation reading location 0x01ae0020. LocalAllocator::allocate is called with an n=512 and LocalReAlloc() succeeds. The actual Access Violation exception occurs within the std::vector< code after the LocalAllocator::allocate call: 0x03f9e3c8 0x03f9ff04 > MyLib.dll!stlp_std::priv::__copy_trivial(const void* __first = 0x01ae0020, const void* __last = 0x01b03020, void* __result = 0x01b10020) Line: 224, Byte Offsets: 0x3c C++ MyLib.dll!stlp_std::vector<_WIN32_FIND_DATAW,LocalAllocator<_WIN32_FIND_DATAW,512> >::_M_insert_overflow(_WIN32_FIND_DATAW* __pos = 0x01b03020, _WIN32_FIND_DATAW& __x = {...}, stlp_std::__true_type& __formal = {...}, unsigned int __fill_len = 1, bool __atend = true) Line: 112, Byte Offsets: 0x5c C++ MyLib.dll!stlp_std::vector<_WIN32_FIND_DATAW,LocalAllocator<_WIN32_FIND_DATAW,512> >::push_back(_WIN32_FIND_DATAW& __x = {...}) Line: 388, Byte Offsets: 0xa0 C++ MyLib.dll!Foo(unsigned long int cbInput = 16, unsigned char* pInput = 0x01a45620, unsigned long int* pcbOutput = 0x1dabfbbc, unsigned char** ppOutput = 0x1dabfbc0, IRAPIStream* __formal = 0x00000000) Line: 66, Byte Offsets: 0x1e4 C++ If anybody can point out what I may be doing wrong, I would appreciate it. Thanks, PaulH

    Read the article

  • How do I set up Scala plugin for NetBeans to copy the Scala runtime library?

    - by Alexey Romanov
    Versions: NetBeans 6.8, Scala Kit 0.16.1 When I compile my project, I get the following output: init: deps-jar: Compiling 2 source files to F:\MyProgramming\NorvigSpellChecker\build\classes compile: Created dir: F:\MyProgramming\NorvigSpellChecker\dist Building jar: F:\MyProgramming\NorvigSpellChecker\dist\NorvigSpellChecker.jar Not copying the libraries. To run this application from the command line without Ant, try: java -jar "F:\MyProgramming\NorvigSpellChecker\dist\NorvigSpellChecker.jar" jar: BUILD SUCCESSFUL (total time: 3 seconds) Of course, the libraries should be copied, so I can't actually run it by using this command line. I don't see any options to copy the library in the project configuration. The plugin uses Ant for building, but I don't have any experience with it; presumably it should be easy enough to tell Ant to copy the libraries. Here is build-impl.xml, what should I do in build.xml?

    Read the article

  • Which network protocol to use for lightweight notification of remote apps?

    - by Chris Thornton
    I have this situation.... Client-initiated SOAP 1.1 communication between one server and let's say, tens of thousands of clients. Clients are external, coming in through our firewall, authenticated by certificate, https, etc.. They can be anywhere, and usually have their own firewalls, NAT routers, etc... They're truely external, not just remote corporate offices. They could be in a corporate/campus network, DSL/Cable, even Dialup. Client uses Delphi (2005 + SOAP fixes from 2007), and the server is C#, but from an architecture/design standpoint, that shouldn't matter. Currently, clients push new data to the server and pull new data from the server on 15-minute polling loop. The server currently does not push data - the client hits the "messagecount" method, to see if there is new data to pull. If 0, it sleeps for another 15 min and checks again. We're trying to get that down to 7 seconds. If this were an internal app, with one or just a few dozen clients, we'd write a cilent "listener" soap service, and would push data to it. But since they're external, sit behind their own firewalls, and sometimes private networks behind NAT routers, this is not practical. So we're left with polling on a much quicker loop. 10K clients, each checking their messagecount every 10 seconds, is going to be 1000/sec messages that will mostly just waste bandwidth, server, firewall, and authenticator resources. So I'm trying to design something better than what would amount to a self-inflicted DoS attack. I don't think it's practical to have the server send soap messages to the client (push) as this would require too much configuration at the client end. But I think there are alternatives that I don't know about. Such as: 1) Is there a way for the client to make a request for GetMessageCount() via Soap 1.1, and get the response, and then perhaps, "stay on the line" for perhaps 5-10 minutes to get additional responses in case new data arrives? i.e the server says "0", then a minute later in response to some SQL trigger (the server is C# on Sql Server, btw), knows that this client is still "on the line" and sends the updated message count of "5"? 2) Is there some other protocol that we could use to "ping" the client, using information gathered from their last GetMessageCount() request? 3) I don't even know. I guess I'm looking for some magic protocol where the client can send a GetMessageCount() request, which would include info for "oh by the way, in case the answer changes in the next hour, ping me at this address...". Also, I'm assuming that any of these "keep the line open" schemes would seriously impact the server sizing, as it would need to keep many thousands of connections open, simultaneously. That would likely impact the firewalls too, I think. Is there anything out there like that? Or am I pretty much stuck with polling? TIA, Chris

    Read the article

  • Why first arg to execve() must be path to executable

    - by EBM
    I understand that execve() and family require the first argument of its argument array to be the same as the executable that is also pointed to by its first argument. That is, in this: execve(prog, args, env); args[0] will usually be the same as prog. But I can't seem to find information as to why this is. I also understand that executables (er, at least shell scripts) always have their calling path as the first argument when running, but I would think that the shell would do the work to put it there, and execve() would just call the executable using the path given in its first argument ("prog" from above), then passing the argument array ("args" from above) as one would on the command line.... i.e., I don't call scripts on the command line with a duplicate executable path in the args list.... /bin/ls /bin/ls /home/john Can someone explain?

    Read the article

  • NSUserDefaults and default language used for I18N

    - by fedmest
    I have searched around a lot for this and found some answers that sounded quite like what I wanted but never worked. I simply need to have my iPhone app load NIBs and Localizable.strings that I decide (through user selection) rather than the ones that are established through the global iPhone/iPad settings. General consensus seems to be that this line [[NSUserDefaults standardUserDefaults] setObject:[NSArray arrayWithObject:@"ro"] forKey:@"AppleLanguages"]; would do the trick (in this specific case, load the NIBs and Localizable.strings in ro.lproj) but I have not had such luck. It keeps on looking for the files in en.lproj or whatever language I chose in the Settings app. I have then tried adding this line [[NSUserDefaults standardUserDefaults] setObject:[NSArray arrayWithObject:@"ro_RO"] forKey:@"AppleLocale"]; and to my great surprise, it worked! ...only once :-( then back to the same issue. Has anyone got any idea how to solve this issue? The aforementioned code was added at the very start of applicationDidFinishLaunching, which is before any NIBs or strings files should be loaded.

    Read the article

  • Where/When does C# and the .NET Framework fail to be the right tool?

    - by Nate Bross
    In my non-programming life, I always attempt to use the approprite tool for the job, and I feel that I do the same in my programming life, but I find that I am choosing C# and .NET for almost everything. I'm finding it hard to come up with (realistic business) needs that cannot be met by .NET and C#. Obviously embedded systems might require something less bloated than the .NET Micro Framework, but I'm really looking for line of business type situations where .NET is not the best tool. I'm primarly a C# and .NET guy since its what I'm the most comfertable in, but I know a fair amount of C++, php, VB, powershell, batch files, and Java, as well as being versed in the web technologes (javascript, html/css). But I'm open minded about it my skill set and I'm looking for cases where C# and .NET are not the right tool for the job. The bottom line here, is that I feel that I'm choosing C# and .NET simply because I am very comfertable with it, so I'm looking for cases where you have chosen something other than .NET, even though you are primarly a .NET developer.

    Read the article

  • Use matching value of a RegExp to name the output file.

    - by fx42
    I have this file "file.txt" which I want to split into many smaller ones. Each line of the file has an id field which looks like "id:1" for a line belonging to id 1. For each id in the file, I like to create a file named idid.txt and put all lines that belong to this id in that file. My brute force bash script solution reads as follows. count=1 while [ $count -lt 19945 ] do cat file.txt | grep "id:$count " >> ./sets/id$count.txt count='expr $count + 1' done Now this is very inefficient as I have do read through the file about 20.000 times. Is there a way to do the same operation with only one pass through the file? - What I'm probably asking for is a way to use the value that matches for a regular expression to name the associated output file.

    Read the article

  • How do you organise multiple git repositories?

    - by dbr
    With SVN, I had a single big repository I kept on a server, and checked-out on a few machines. This was a pretty good backup system, and allowed me easily work on any of the machines. I could checkout a specific project, commit and it updated the 'master' project, or I could checkout the entire thing. Now, I have a bunch of git repositories, for various projects, several of which are on github. I also have the SVN repository I mentioned, imported via the git-svn command.. Basically, I like having all my code (not just projects, but random snippets and scripts, some things like my CV, articles I've written, websites I've made and so on) in one big repository I can easily clone onto remote machines, or memory-sticks/harddrives as backup. The problem is, since it's a private repository, and git doesn't allow checking out of a specific folder (that I could push to github as a separate project, but have the changes appear in both the master-repo, and the sub-repos) I could use the git submodule system, but it doesn't act how I want it too (submodules are pointers to other repositories, and don't really contain the actual code, so it's useless for backup) Currently I have a folder of git-repos (for example, ~/code_projects/proj1/.git/ ~/code_projects/proj2/.git/), and after doing changes to proj1 I do git push github, then I copy the files into ~/Documents/code/python/projects/proj1/ and do a single commit (instead of the numerous ones in the individual repos). Then do git push backupdrive1, git push mymemorystick etc So, the question: How do your personal code and projects with git repositories, and keep them synced and backed-up?

    Read the article

  • How should rules for Aggregate Roots be enforced?

    - by MylesRip
    While searching the web, I came across a list of rules from Eric Evans' book that should be enforced for aggregates: The root Entity has global identity and is ultimately responsible for checking invariants Root Entities have global identity. Entities inside the boundary have local identity, unique only within the Aggregate. Nothing outside the Aggregate boundary can hold a reference to anything inside, except to the root Entity. The root Entity can hand references to the internal Entities to other objects, but they can only use them transiently (within a single method or block). Only Aggregate Roots can be obtained directly with database queries. Everything else must be done through traversal. Objects within the Aggregate can hold references to other Aggregate roots. A delete operation must remove everything within the Aggregate boundary all at once When a change to any object within the Aggregate boundary is committed, all invariants of the whole Aggregate must be satisfied. This all seems fine in theory, but I don't see how these rules would be enforced in the real world. Take rule 3 for example. Once the root entity has given an exteral object a reference to an internal entity, what's to keep that external object from holding on to the reference beyond the single method or block? (If the enforcement of this is platform-specific, I would be interested in knowing how this would be enforced within a C#/.NET/NHibernate environment.)

    Read the article

  • API-based solutions for sending payments to people without bank accounts

    - by Tauren
    I'm looking for inexpensive ways to send payments to hundreds or thousands of individual contractors, even if they do not have a bank account. Currently I only need to support payment in the USA, but may eventually be international. Here's the scenario: I offer a service that allows an organization or manager-type person to coordinate contractors for very short term jobs. These jobs are typically only an hour or two in length. A contractor may get only one job over an entire month, several jobs spread out over a month, multiple jobs on a single day, or any other combination. Thus, a single contractor could earn as little as one job's payment up to potentially payment for dozens. Payment for a month could be as little as $10 up to $1000's. Right now, the system provides payroll reports to the manager and it is the manager's responsibility to produce checks, stuff envelopes, and send mail via the US postal service. I'd like to remove this burden from the manager and have all the payments taken care of for them automatically by the system. I'm not sure where to start or what the best options would be. I'm starting to look into the following solutions, but don't know specifics yet and would like some advice before pursuing them. I'd also like to hear about other ideas or suggestions. PayPal (Send Money, Adaptive Payments, x.com, other???) Amazon (Flexible Payments System?) Fund some sort of pre-paid debit card? Web service with API that mails checks for you? Direct deposit via a bank API (for users with bank accounts)? The problem is that many of these contractors may not be able to obtain bank accounts or credit cards within the USA. I don't mind doing a hybrid of solutions, but are there any that would work well with this issue? I want the solution to be easy to use for the contractors, meaning that they can get the money easily (via check in the mail, debit card ATM withdrawal, etc.)

    Read the article

  • Unable to get data from a WCF client

    - by Scott
    I am developing a DLL that will provide sychronized time stamps to multiple applications running on the same machine. The timestamps are altered in a thread that uses a high performance timer and a scalar to provide the appearance of moving faster than real-time. For obvious reasons I want only 1 instance of this time library, and I thought I could use WCF for the other processes to connect to this and poll for timestamps whenever they want. When I connect however I never get a valid time stamp, just an empty DateTime. I should point out that the library does work. The original implementation was a single DLL that each application incorporated and each one was synced using windows messages. I'm fairly sure it has something to do with how I'm setting up the WCF stuff, to which I am still pretty new. Here are the contract definitions: public interface ITimerCallbacks { [OperationContract(IsOneWay = true)] void TimerElapsed(String id); } [ServiceContract(SessionMode = SessionMode.Required, CallbackContract = typeof(ITimerCallbacks))] public interface ISimTime { [OperationContract] DateTime GetTime(); } Here is my class definition: [ServiceBehavior(InstanceContextMode = InstanceContextMode.Single)] public class SimTimeServer: ISimTime The host setup: // set up WCF interprocess comms host = new ServiceHost(typeof(SimTimeServer), new Uri[] { new Uri("net.pipe://localhost") }); host.AddServiceEndpoint(typeof(ISimTime), new NetNamedPipeBinding(), "SimTime"); host.Open(); and the implementation of the interface function server-side: public DateTime GetTime() { if (ThreadMutex.WaitOne(20)) { RetTime = CurrentTime; ThreadMutex.ReleaseMutex(); } return RetTime; } Lastly the client-side implementation: Callbacks myCallbacks = new Callbacks(); DuplexChannelFactory pipeFactory = new DuplexChannelFactory(myCallbacks, new NetNamedPipeBinding(), new EndpointAddress("net.pipe://localhost/SimTime")); ISimTime pipeProxy = pipeFactory.CreateChannel(); while (true) { string str = Console.ReadLine(); if (str.ToLower().Contains("get")) Console.WriteLine(pipeProxy.GetTime().ToString()); else if (str.ToLower().Contains("exit")) break; }

    Read the article

  • Cannot import SQLite with Python 2.6

    - by David McLaughlin
    I'm running Python 2.6 on Unix and when I run the interactive prompt (SQLite is supposed to be preinstalled) I get: [root@idev htdocs]# python Python 2.6 (r26:66714, Oct 23 2008, 16:25:34) [GCC 3.2.2 20030222 (Red Hat Linux 3.2.2-5)] on linux2 Type "help", "copyright", "credits" or "license" for more information. >>> import sqlite Traceback (most recent call last): File "<stdin>", line 1, in <module> ImportError: No module named sqlite >>> import sqlite Traceback (most recent call last): File "<stdin>", line 1, in <module> ImportError: No module named sqlite >>> How do I resolve this?

    Read the article

  • zeromq installtion on mac os snow leopard

    - by Ashish
    I have installed zeromq 2.1.11 on mac os x using the steps given on http://www.zeromq.org/area:download Then i installed pyzmq (python bindings ) But i get the following error : import zmq Traceback (most recent call last): File "<pyshell#1>", line 1, in <module> import zmq File "/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/__init__.py", line 35, in <module> from zmq.utils import initthreads # initialize threads ImportError: dlopen(/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/utils/initthreads.so, 2): no suitable image found. Did find: /Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/utils/initthreads.so: no matching architecture in universal wrapper

    Read the article

  • Python: User-Defined Exception That Proves The Rule

    - by bandana
    Python documentations states: Exceptions should typically be derived from the Exception class, either directly or indirectly. the word 'typically' leaves me in an ambiguous state. consider the code: class good(Exception): pass class bad(object): pass Heaven = good() Hell = bad() >>> raise Heaven Traceback (most recent call last): File "<pyshell#163>", line 1, in <module> raise Heaven good >>> raise Hell Traceback (most recent call last): File "<pyshell#171>", line 1, in <module> raise Hell TypeError: exceptions must be classes or instances, not bad so when reading the python docs, should i change 'typically' with ''? what if i have a class hierarchy that has nothing to do with the Exception class, and i want to 'raise' objects belonging to the hierarchy? i can always raise an exception with an argument: raise Exception, Hell This seems slightly awkward to me What's so special about the Exception class, that only its family members can be raised?

    Read the article

  • Scanner cuts off my String after about 2400 characters

    - by Ventrue
    I've got some very basic code like while (scan.hasNextLine()) { String temp = scan.nextLine(); System.out.println(temp); } where scan is a Scanner over a file. However, on one particular line, which is about 6k chars long, temp cuts out after something like 2470 characters. There's nothing special about when it cuts out; it's in the middle of the word "Australia." If I delete characters from the line, the place where it cuts out changes; e.g. if I delete characters 0-100 in the file then Scanner will get what was previously 100-2570. I've used Scanner for larger strings before. Any idea what could be going wrong?

    Read the article

  • Kerning problems when drawing text character by character

    - by shekel
    I'm trying to draw strings character by character to add lighting effects to shapes composed of text. while (i != line.length()) { c = line.substring(i, i + 1); cWidth = g.getFontMetrics().stringWidth(c); g.drawString(c, xx += cWidth, yy); i++; } The problem is, the width of a character isn't the actual distance it's drawn from another character when those two characters are printed as a string. Is there any way to get the correct distance in graphics2d?

    Read the article

  • How do I do a join in ActiveRecord after records have been returned?

    - by Russ Bradberry
    I am using ActiveRecord in Rails 3 to pull data from two different tables in two different databases. These databases can not join on each other, but I have the need to do a simple join after-the-fact. I would like to preserve the relation so that I can chain it down the line. here is a simplified version of what I am doing browsers = Browser.all # <-- this is fairly small and can reside in memory events = Event.where(:row_date=>Date.today).select(:name, :browser_id) So as you can see, I want to join browsers in on the events relation, where browser_id should equal browsers.name. events is a relation and I can still add clauses to it down the line, so I dont want to run the query on the db just yet. How would I accomplish this?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Sending message from one server to another in Twisted

    - by Casey Patton
    I've implemented my servers in the following way: def makeServer(application, port): factory = protocol.ServerFactory() factory.protocol = MyChat factory.clients = [] internet.TCPServer(port, factory).setServiceParent(application) application = service.Application("chatserver") server1 = makeServer(application, port=1025) server2 = makeServer(application, port=1026) server3 = makeServer(application, port=1027) Note that MyChat is an event handling class that has a "receiveMessage" action: def lineReceived(self, line): print "received", repr(line) for c in self.factory.clients: c.transport.write(message + '\n') I want server1 to be able to pass messages to server2. Rather, I want server1 to be treated as a client of server2. If server1 receives the message "hi" then I want it to send that same exact message to server2. How can I accomplish this?

    Read the article

< Previous Page | 509 510 511 512 513 514 515 516 517 518 519 520  | Next Page >