Search Results

Search found 43274 results on 1731 pages for 'single line'.

Page 515/1731 | < Previous Page | 511 512 513 514 515 516 517 518 519 520 521 522  | Next Page >

  • Could I do this blind relative to absolute path conversion (for perforce depot paths) better?

    - by wonderfulthunk
    I need to "blindly" (i.e. without access to the filesystem, in this case the source control server) convert some relative paths to absolute paths. So I'm playing with dotdots and indices. For those that are curious I have a log file produced by someone else's tool that sometimes outputs relative paths, and for performance reasons I don't want to access the source control server where the paths are located to check if they're valid and more easily convert them to their absolute path equivalents. I've gone through a number of (probably foolish) iterations trying to get it to work - mostly a few variations of iterating over the array of folders and trying delete_at(index) and delete_at(index-1) but my index kept incrementing while I was deleting elements of the array out from under myself, which didn't work for cases with multiple dotdots. Any tips on improving it in general or specifically the lack of non-consecutive dotdot support would be welcome. Currently this is working with my limited examples, but I think it could be improved. It can't handle non-consecutive '..' directories, and I am probably doing a lot of wasteful (and error-prone) things that I probably don't need to do because I'm a bit of a hack. I've found a lot of examples of converting other types of relative paths using other languages, but none of them seemed to fit my situation. These are my example paths that I need to convert, from: //depot/foo/../bar/single.c //depot/foo/docs/../../other/double.c //depot/foo/usr/bin/../../../else/more/triple.c to: //depot/bar/single.c //depot/other/double.c //depot/else/more/triple.c And my script: begin paths = File.open(ARGV[0]).readlines puts(paths) new_paths = Array.new paths.each { |path| folders = path.split('/') if ( folders.include?('..') ) num_dotdots = 0 first_dotdot = folders.index('..') last_dotdot = folders.rindex('..') folders.each { |item| if ( item == '..' ) num_dotdots += 1 end } if ( first_dotdot and ( num_dotdots > 0 ) ) # this might be redundant? folders.slice!(first_dotdot - num_dotdots..last_dotdot) # dependent on consecutive dotdots only end end folders.map! { |elem| if ( elem !~ /\n/ ) elem = elem + '/' else elem = elem end } new_paths << folders.to_s } puts(new_paths) end

    Read the article

  • C: Incompatible types?

    - by Airjoe
    #include <stdlib.h> #include <stdio.h> struct foo{ int id; char *bar; char *baz[6]; }; int main(int argc, char **argv){ struct foo f; f.id=1; char *qux[6]; f.bar=argv[0]; f.baz=qux; // Marked line return 1; } This is just some test code so ignore that qux doesn't actually have anything useful in it. I'm getting an error on the marked line, incompatible types when assigning to type ‘char *[6]’ from type ‘char **’ but both of the variables are defined as char *[6] in the code. Any insight?

    Read the article

  • Having issue with OpenGL 1.0 for HP slate 7

    - by Roy Coder
    I have issue with HP slate when i am trying to draw Line in OpenGL Draw method. But working in other devices. In Hp Slate Green line not drawn properly as like in another device. My Code is: gl.glPushMatrix(); gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); gl.glVertexPointer(2, GL10.GL_FLOAT, 0, vertexFloatBuffer); gl.glColorMask(true, true, true, true); gl.glDepthMask(true); gl.glLineWidth(8.0f); setColor(gl); gl.glDrawArrays(GL10.GL_LINES, 0, fPoints.length / 2); gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glPopMatrix(); Suggest me at which place i am wrong or missing something? UpdateImage

    Read the article

  • update table in gtk

    - by ali
    I have window that contains a table on screen, now I want to attach a widget to that table I use gtk_table_attach(GTK_TABLE(table), label, ...) the function is correct and it runs without any error but table does not respond to that line I mean there is no change on my table, I think I need something to tell that table update it self but how? note= that line is inside a callback of a signal and I am sure that signal runs note2= I do not want to destroy window for that note3= I use gtk+ and pygtk note4= I am sure I attach that widget to a correct position ( it is free)

    Read the article

  • Polymorphic urls with singular resources

    - by Brendon Muir
    I'm getting strange output when using the following routing setup: resources :warranty_types do resources :decisions end resource :warranty_review, :only => [] do resources :decisions end I have many warranty_types but only one warranty_review (thus the singular route declaration). The decisions are polymorphically associated with both. I have just a single decisions controller and a single _form.html.haml partial to render the form for a decision. This is the view code: = simple_form_for @decision, :url => [@decision_tree_owner, @decision.becomes(Decision)] do |form| The warranty_type url looks like this (for a new decision): /warranty_types/2/decisions whereas the warranty_review url looks like this: /admin/warranty_review/decisions.1 I think because the warranty_review id has no where to go, it's just getting appended to the end as an extension. Can someone explain what's going on here and how I might be able to fix it? I can work around it by trying to detect for a warranty_review class and substituting @decision_tree_owner with :warranty_review and this generates the correct url, but this is messy. I would have thought that the routing would be smart enough to realise that warranty_review is a singular resource and thus discard the id from the URL. This is Rails 3 by the way :)

    Read the article

  • What coding standards do you follow?

    - by Mark Szymanski
    I was just curious what coding standards people followed. I for one use the following: Brackets ALWAYS go on the next line. For instance: int main() { //Blah... } I never use code folding. (Yes my IDE's do support it (Xcode and Eclipse). Put related functions/methods single-spaced, otherwise double space. Here is an example: int foo = 0; printf("%d",foo); those are related while these are not: printf("Hello, World!"); return(0); I don't put else statements on the same line as the closing bracket for the preceding if statement. Most of the time in Java if a program needs multiple try catch statements I will just put the whole thing in one try catch.

    Read the article

  • Python Importing object that originates in one module from a different module into a third module

    - by adewinter
    I was reading the sourcode for a python project and came across the following line: from couchexport.export import Format (source: https://github.com/wbnigeria/couchexport/blob/master/couchexport/views.py#L1 ) I went over to couchexport/export.py to see what Format was (Class? Dict? something else?). Unfortunately Format isn't in that file. export.py does however import a Format from couchexport.models where there is a Format class (source: https://github.com/wbnigeria/couchexport/blob/master/couchexport/models.py#L11). When I open up the original file in my IDE and have it look up the declaration, in line I mentioned at the start of this question, it leads directly to models.py. What's going on? How can an import from one file (export.py) actually be an import from another file (models.py) without being explicitly stated?

    Read the article

  • Good open source analytics/stats software in PHP?

    - by makeee
    The url shortening service I'm building needs to display some basic click stats to users: # of clicks, conversions, referring domains, and country (filterable by a date range). I'll possibly want more advanced stats in the future. Is there existing open source software that will allow me to pass events to it and then easily display a bar or line graph of that event (for example, a line graph of "conversions" between two specified dates). It seems like something like this should exist and would be much easier then building the whole thing from scratch. I know there are graphing scripts, but that still requires me to format the data (usually as an xml file) and then pass it to the graph. I'm looking for something a bit more complete, which I can just feed the events and then it does everything else.

    Read the article

  • Using SMO to call Database.ExecuteNonQuery() concurrently?

    - by JimDaniel
    I have been banging my head against the wall trying to figure out how I can run update scripts concurrently against multiple databases in a single SQL Server instance using SMO. Our environments have an ever-increasing number of databases which need updating, and iterating through one at a time is becoming a problem (too slow). From what I understand SMO does not support concurrent operations, and my tests have bore that out. There seems to be shared memory at the Server object level, for things like DataReader context, keeps throwing exceptions such as "reader is already open." I apologize for not having the exact exceptions I am getting. I will try to get them and update this post. I am no expert on SMO and just feeling my way through to be honest. Not really sure I am approaching it the right way, but it's something that has to be done, or our productivity will slow to a crawl. So how would you guys do something like this? Am I using the wrong technology with SMO? All I am wanting to do is execute sql scripts against databases in a single sql server instance in parallel. Thanks for any help you can give, Daniel

    Read the article

  • Netbeans PHP require_once() problem

    - by mawg
    I'm stumped! In PHP in Netbeans (6.8), a project has two files, file1.php and file2.php file1.php starts require_once('file2.php'); and I get Warning: require_once(query_form.php): failed to open stream: No such file or directory in C:\xampp\htdocs\my_project\file1.php on line 3 Call Stack: 0.0741 322920 1. {main}() C:\xampp\htdocs\my_project\file1.php:0 Fatal error: require_once(): Failed opening required 'file2.php' (include_path='.;\xampp\php\PEAR') in C:\xampp\htdocs\my_project\file1.php on line 3 Call Stack: 0.0741 322920 1. {main}() C:\xampp\htdocs\my_project\file1.php:0 I tried require_once('./file2.php'); and require_once('.\file2.php'); since it is windows. I even added C:\xampp\htdocs\my_project\ to the projects include path and it shows up as such on the prject view and see file1.php and file2.php It doesn't show up on this error report, but possibly because Netbeans (or PHP ]) knows that C:\xampp\htdocs\my_project\ === . Any suggestions? Btw, I am new to Netbeans, so it i sprobably something very obvious.

    Read the article

  • Does .NET have a linker?

    - by Water Cooler v2
    From Jon Skeet's blog: What does the following comment mean? // The line below only works when linked rather than // referenced, as otherwise you need a cast. // The compiler treats it as if it both takes and // returns a dynamic value. string value = com.MakeMeDynamic(10); I understand what referencing an assembly is. You may reference it when compiling the program files either using the /ref: switch at the command line or you may add a statically reference to the assembly in Visual Studio. But how do you link to an assembly in .NET? Does he mean, load the assembly using Reflection (Assembly.LoadFile())? Or, the Win32 API LoadLibrary()? Or, does .NET have a linker that I have never heard of?

    Read the article

  • UIViewController is popped from view stack and NSURLConnection crashes the application

    - by rickharrison
    I am pushing a UIViewController onto a UINavigationController. This view controller immediately starts a download of an xml feed and then parses it. However, if you hit the back button before it is done downloading, and crashes with EXC_BAD_ACCESS. The line that is crashing it is in parserDidEndDocument and is this line: if (self.delegate && [self.delegate conformsToProtocol:@protocol(ModelDelegate)]) [self.delegate modelDidFinishParsing:self]; I assume it is crashing because it is trying to access self.delegate which is not assigned anymore. How do I get around this? Also, I would release the model object in the modelDidFinishParsing method. How would I release this model if it never reaches this method.

    Read the article

  • Is it hard problem?

    - by Lukasz Lew
    I can't solve it: You are given 8 integers: A, B, C representing a line on a plane with equation A*x + B*y = C a, b, c representing another line x, y representing a point on a plane The two lines are not parallel therefore divide plane into 4 pieces. Point (x, y) lies inside of one these pieces. Problem: Write a fast algorithm that will find a point with integer coordinates in the same piece as (x,y) that is closest to the cross point of the two given lines. Note: This is not a homework, this is old Euler-type task that I have absolutely no idea how to approach.

    Read the article

  • Finding rank of the student -Sql Compact

    - by Jankhana
    I have a table like this : Name Mar1 Mar2 Mar3 Total xxx 80 80 80 240 yyy 60 70 50 180 aaa 85 65 75 225 I wanted to find the rank of the student based on total. I using SQL Compact 3.5 . As we have rank() function in sql server do we have something with which we can find the students rank??? When I used "select Total,rank() over (order by total desc) i1 from stmarks " it's giving error as " Major Error 0x80040E14, Minor Error 25501 select Total,rank() over (order by total desc) i1 from stmarks There was an error parsing the query. [ Token line number = 1,Token line offset = 21,Token in error = over ] " Do Sql Compact support rank() over or is there any another way???

    Read the article

  • How to set maxLines and ellipsesize of a TextView at the same time.

    - by michael
    I want to limit my text view to have maximum of 6 lines, so I did: <TextView android:id="@+id/toptext" android:layout_width="fill_parent" android:layout_height="wrap_content" android:maxLines="6"/> But when I try to configure it to add '...' when the text is truncated, I add android:ellipsize="end". I do see the ... but then my TextView only has a max line of 2, instead of 6. Can you please how can I make the text view of maximum line of 6 and add '...' when it get truncated? Thank you.

    Read the article

  • Can I test for the end of the content of a text/plain file with Selenium or javascript?

    - by fool4jesus
    I have a page that results in a text/plain file being displayed in the browser that looks like this: ... Admin Site Administration 2010-04-21 22:26:34 [email protected] Test Site Bob Smith 2010-04-21 22:27:09 [email protected] Admin Site Administration 2010-04-21 22:29:26 [email protected] I am trying to write a Selenium test against this that verifies the last line of the file has "[email protected]" at the end. How would you do this? I can't depend on the date/time as this is a login report that is constantly getting updated - all I want is to ensure that the last line ends with that email address. And I can't figure out how to do it using Selenium expressions, DOM, or XPath.

    Read the article

  • Sending message from one server to another in Twisted

    - by Casey Patton
    I've implemented my servers in the following way: def makeServer(application, port): factory = protocol.ServerFactory() factory.protocol = MyChat factory.clients = [] internet.TCPServer(port, factory).setServiceParent(application) application = service.Application("chatserver") server1 = makeServer(application, port=1025) server2 = makeServer(application, port=1026) server3 = makeServer(application, port=1027) Note that MyChat is an event handling class that has a "receiveMessage" action: def lineReceived(self, line): print "received", repr(line) for c in self.factory.clients: c.transport.write(message + '\n') I want server1 to be able to pass messages to server2. Rather, I want server1 to be treated as a client of server2. If server1 receives the message "hi" then I want it to send that same exact message to server2. How can I accomplish this?

    Read the article

  • How to convert string with double high/wide characters to normal string [VC++6]

    - by Shaitan00
    My application typically recieves a string in the following format: " Item $5.69 " Some contants I always expect: - the LENGHT always 20 characters - the start index of the text always [5] - and most importantly the index of the DECIMAL for the price always [14] In order to identify this string correctly I validate all the expected contants listed above .... Some of my clients have now started sending the string with Doube-High / Double-Wide values (pair of characters which represent a single readable character) similar to the following: " Item $x80x90.x81x91x82x92 " For testing I simply scan the string character-by-character, compare char[i] and char[i+1] and replace these pairs with their corresponding single character when a match is found (works fine) as follows: [Code] for (int i=0; i < sData.length(); i++) { char ch = sData[i] & 0xFF; char ch2 = sData[i+1] & 0xFF; if (ch == '\x80' && ch2 == '\x90') zData.replace("\x80\x90", "0"); else if (ch == '\x81' && ch2 == '\x91') zData.replace("\x81\x91", "1"); else if (ch == '\x82' && ch2 == '\x92') zData.replace("\x82\x92", "2"); ... ... ... } [/Code] But the result is something like this: " Item $5.69 " Notice how this no longer matches my expectation: the lenght is now 17 (instead of 20) due to the 3 conversions and the decimal is now at index 13 (instead of 14) due to the conversion of the "5" before the decimal point. Ideally I would like to convert the string to a normal readable format keeping the constants (length, index of text, index of decimal) at the same place (so the rest of my application is re-usable) ... or any other suggestion (I'm pretty much stuck with this)... Is there a STANDARD way of dealing with these type of characters? Any help would be greatly appreciated, I've been stuck on this for a while now ... Thanks,

    Read the article

  • Strange behaviour of NSScanner on simple whitespace removal

    - by Michael Waterfall
    I'm trying to replace all multiple whitespace in some text with a single space. This should be a very simple task, however for some reason it's returning a different result than expected. I've read the docs on the NSScanner and it seems like it's not working properly! NSScanner *scanner = [[NSScanner alloc] initWithString:@"This is a test of NSScanner !"]; NSMutableString *result = [[NSMutableString alloc] init]; NSString *temp; NSCharacterSet *whitespace = [NSCharacterSet whitespaceCharacterSet]; while (![scanner isAtEnd]) { // Scan upto and stop before any whitespace [scanner scanUpToCharactersFromSet:whitespace intoString:&temp]; // Add all non whotespace characters to string [result appendString:temp]; // Scan past all whitespace and replace with a single space if ([scanner scanCharactersFromSet:whitespace intoString:NULL]) { [result appendString:@" "]; } } But for some reason the result is @"ThisisatestofNSScanner!" instead of @"This is a test of NSScanner !". If you read through the comments and what each line should achieve it seems simple enough!? scanUpToCharactersFromSet should stop the scanner just as it encounters whitespace. scanCharactersFromSet should then progress the scanner past the whitespace up to the non-whitespace characters. And then the loop continues to the end. What am I missing or not understanding?

    Read the article

  • PowerShell function arguments: Can the first one be optional first?

    - by Johannes Rössel
    I have an advanced function in PowerShell, which roughly looks like this: function Foo { [CmdletBinding] param ( [int] $a = 42, [int] $b ) } The idea is that it can be run with either two, one or no arguments. However, the first argument to become optional is the first one. So the following scenarios are possible to run the function: Foo a b # the normal case, both a and b are defined Foo b # a is omitted Foo # both a and b are omitted However, normally PowerShell tries to fit the single argument into a. So I thought about specifying the argument positions explicitly, where a would have position 0 and b position 1. However, to allow for only b specified I tried putting a into a parameter set. But then b would need a different position depending on the currently-used parameter set. Any ideas how to solve this properly? I'd like to retain the parameter names (which aren't a and b actually), so using $args is probably a last resort. I probably could define two parameter sets, one with two mandatory parameters and one with a single optional one, but I guess the parameter names have to be different in that case, then, right?

    Read the article

  • How to compare if string has a enter key in the end using jquery/javascript?

    - by user144842
    I have a string value from a user input box. I have to figure out if last char is a enter key (line feed). Thats the code. Here I am checking if last char has a whitespace. Now I also have to check if last char is enter key (carriage return or line feed). How can i do this? var txt = $get("<%= txtUserText.ClientID %>"); if (txt.value.substring(txt.value.length -1) !== ' ' || <checkifLastCharIsEnterKey>) //my code to take action **I don't think i need a keypress or keyup event because this above piece of code is not invoked at the time of user input.

    Read the article

  • ASP.NET Treeview Control not expanding on click

    - by Scott Vercuski
    I having an issue with the ASP.NET Treeview control. I create the treeview just fine but the nodes will not expand or collapse. I see there is a javascript error but it is for line 1 character 0 of the webpage, there is nothing at line 1 character 0. I am using the ASP:Treeview control in conjunction with the Telerik controls, but I'm not sure if that is an issue. I saw there was a similar question here but the answer is not pertinent to my site. Has anyone run into this issue before? I've tried searching Google and tried a number of proposed solutions but so far none have worked. Thank you,

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • NSURLConnection shown as leaking in instruments

    - by Gyozo Kudor
    Hello another stupid question regarding leaks and also NSURLConnection. How do i release it? Is it enough if i release in the following 2 methods? (void)connection:(NSURLConnection *)connection didFailWithError:(NSError *)error (void)connectionDidFinishLoading:(NSURLConnection *)connection Because in instruments it shows me the line where I alloc my connection as the source of leaking. OK I don't get it. After the following code my urlConnection has a retain count of 2. WTF? NSURLConnection *urlConnection = [[NSURLConnection alloc] initWithRequest: urlRequest delegate: self]; This is the line that instruments points me to. I find this very weird.

    Read the article

< Previous Page | 511 512 513 514 515 516 517 518 519 520 521 522  | Next Page >