Search Results

Search found 13869 results on 555 pages for 'memory dump'.

Page 527/555 | < Previous Page | 523 524 525 526 527 528 529 530 531 532 533 534  | Next Page >

  • Performing full screen grab in windows

    - by Steven Lu
    I am working an idea that involves getting a full capture of the screen including windows and apps, analyzing it, and then drawing items back onto the screen, as an overlay. I want to learn image processing techniques and I could get lots of data to work with if I can directly access the Windows screen. I could use this to build automation tools the likes of which have never been seen before. More on that later. I have full screen capture working for the most part. HWND hwind = GetDesktopWindow(); HDC hdc = GetDC(hwind); int resx = GetSystemMetrics(SM_CXSCREEN); int resy = GetSystemMetrics(SM_CYSCREEN); int BitsPerPixel = GetDeviceCaps(hdc,BITSPIXEL); HDC hdc2 = CreateCompatibleDC(hdc); BITMAPINFO info; info.bmiHeader.biSize = sizeof(BITMAPINFOHEADER); info.bmiHeader.biWidth = resx; info.bmiHeader.biHeight = resy; info.bmiHeader.biPlanes = 1; info.bmiHeader.biBitCount = BitsPerPixel; info.bmiHeader.biCompression = BI_RGB; void *data; hbitmap = CreateDIBSection(hdc2,&info,DIB_RGB_COLORS,(void**)&data,0,0); SelectObject(hdc2,hbitmap); Once this is done, I can call this repeatedly: BitBlt(hdc2,0,0,resx,resy,hdc,0,0,SRCCOPY); The cleanup code (I have no idea if this is correct): DeleteObject(hbitmap); ReleaseDC(hwind,hdc); if (hdc2) { DeleteDC(hdc2); } Every time BitBlt is called it grabs the screen and saves it in memory I can access thru data. Performance is somewhat satisfactory. BitBlt executes in 50 milliseconds (sometimes as low as 33ms) at 1920x1200x32. What surprises me is that when I switch display mode to 16 bit, 1920x1200x16, either through my graphics settings beforehand, or by using ChangeDisplaySettings, I get a massively improved screen grab time between 1ms and 2ms, which cannot be explained by the factor of two reduction in bit-depth. Using CreateDIBSection (as above) offers a significant speed up when in 16-bit mode, compared to if I set up with CreateCompatibleBitmap (6-7ms/f). Does anybody know why dropping to 16bit causes such a speed increase? Is there any hope for me to grab 32bit at such speeds? if not for the color depth, but for not forcing a change of screen buffer modes and the awful flickering.

    Read the article

  • Issues declaring already existing NSMutableArray in new class

    - by Graeme
    I have a class (DataImporter) which has the code to download an RSS feed. I also have a view and separate class (TableView) which displays the data in a UITableView and starts the parsing process, storing parsed information in an NSMutableArray (items) which is located in the (TableView) subclass. Now I wish to add a UIMapView which displays the items in the (items) NSMutableArray. Herein lies the issue - I need to somehow get the data from the (items) NSMutableArray into the new (mapView) subclass which I'm struggling with - and I preferably don't want to have to create a new class to download the data again for the mapView class when it already is in the applications memory. Is there a way I can transfer the information from the NSMutableArray (items) class to the (mapView) class (i.e. how do I declare the NSMutableArray in the (mapView) class)? Here's a overview of how the system works: App opened Data downloaded (using DataImporter class) when (TableView) viewDidLoad runs Data stored in NSMutableArray accessible by the (TableView) class And from here I need to access and declare the array from a new (mapView) class. Any help greatly appreciated, thanks. Code for viewDidLoad MapKit: Data *data = nil; NSString *ilocation = [data locations]; NSString *ilocation2 = @"New Zealand"; NSString *inewlString; inewlString = [ilocation stringByAppendingString:ilocation2]; NSLog(@"inewlString=%@",inewlString); if(forwardGeocoder == nil) { forwardGeocoder = [[BSForwardGeocoder alloc] initWithDelegate:self]; } // Forward geocode! [forwardGeocoder findLocation: inewlString]; Code for parsing data into original NSMutable Array: - (void)beginParsing { NSLog(@"Parsing has begun"); //self.navigationItem.rightBarButtonItem.enabled = NO; // Allocate the array for song storage, or empty the results of previous parses if (incidents == nil) { NSLog(@"Grabbing array"); self.datas = [NSMutableArray array]; } else { [datas removeAllObjects]; [self.tableView reloadData]; } // Create the parser, set its delegate, and start it. self.parser = [[DataImporter alloc] init]; parser.delegate = self; [parser start]; }

    Read the article

  • DNS resolution problems; dig SERVFAIL error

    - by JustinP
    I'm setting up a couple of dedicated servers, and having problems setting up my nameservers properly. One of these is a LEMP server (LAMP with nginx in place of Apache), and the other will function solely as an email server, running exim/dovecot/ASSP antispam (no Apache). The LEMP server is CentOS 5.5, with no control panel, while the email server is CentOS 5.5 as well, with cPanel/WHM. So, I've had problems getting DNS set up properly. I have two domains, each one pointing to one of these servers. The nameservers are registered correctly with the domain registrar, and the nameserver IPs are entered correctly as well. I've spoken to tech support at the registrar and they confirm that everything is set up on their end. Not knowing much about DNS, I googled nameservers and DNS until I nearly went blind, and spent hours messing with the configuration. Eventually, I got the LEMP server's DNS working properly (no cPanel). Pleased with this triumph, I'm trying to mimic that configuration and repeat the process with the email server, and it's just not happening. The nameserver starts and stops, but the domain doesn't resolve. Things I have tried Going through standard procedures to set up DNS in WHM Clearing all DNS information, uninstalling BIND, then reinstalling all of that and again going through WHM procedures for setting up DNS Clearing all DNS information, and setting up BIND via shell (completely outside of cPanel) by using my config and zone files from the LEMP server as a template named runs just fine, but nothing is resolving. When I "dig any example.com" I get a SERVFAIL message. Nslookups return no information. Here are my config and zone files. named.conf controls { inet 127.0.0.1 allow { localhost; } keys { coretext-key; }; }; options { listen-on port 53 { any; }; listen-on-v6 port 53 { ::1; }; directory "/var/named"; dump-file "/var/named/data/cache_dump.db"; statistics-file "/var/named/data/named_stats.txt"; memstatistics-file "/var/named/data/named_mem_stats.txt"; // Those options should be used carefully because they disable port // randomization // query-source port 53; // query-source-v6 port 53; allow-query { any; }; allow-query-cache { any; }; }; logging { channel default_debug { file "data/named.run"; severity dynamic; }; }; view "localhost_resolver" { match-clients { 127.0.0.0/24; }; match-destinations { localhost; }; recursion yes; //zone "." IN { // type hint; // file "/var/named/named.ca"; //}; include "/etc/named.rfc1912.zones"; }; view "internal" { /* This view will contain zones you want to serve only to "internal" clients that connect via your directly attached LAN interfaces - "localnets" . */ match-clients { localnets; }; match-destinations { localnets; }; recursion yes; zone "." IN { type hint; file "/var/named/named.ca"; }; // include "/var/named/named.rfc1912.zones"; // you should not serve your rfc1912 names to non-localhost clients. // These are your "authoritative" internal zones, and would probably // also be included in the "localhost_resolver" view above : zone "example.com" { type master; file "data/db.example.com"; }; zone "3.2.1.in-addr.arpa" { type master; file "data/db.1.2.3"; }; }; view "external" { /* This view will contain zones you want to serve only to "external" clients * that have addresses that are not on your directly attached LAN interface subnets: */ match-clients { any; }; match-destinations { any; }; recursion no; // you'd probably want to deny recursion to external clients, so you don't // end up providing free DNS service to all takers allow-query-cache { none; }; // Disable lookups for any cached data and root hints // all views must contain the root hints zone: //include "/etc/named.rfc1912.zones"; zone "." IN { type hint; file "/var/named/named.ca"; }; zone "example.com" { type master; file "data/db.example.com"; }; zone "3.2.1.in-addr.arpa" { type master; file "data/db.1.2.3"; }; }; include "/etc/rndc.key"; db.example.com $TTL 1D ; ; Zone file for example.com ; ; Mandatory minimum for a working domain ; @ IN SOA ns1.example.com. contact.example.com. ( 2011042905 ; serial 8H ; refresh 2H ; retry 4W ; expire 1D ; default_ttl ) NS ns1.example.com. NS ns2.example.com. ns1 A 1.2.3.4 ns2 A 1.2.3.5 example.com. A 1.2.3.4 localhost A 127.0.0.1 www CNAME example.com. mail CNAME example.com. ; db.1.2.3 $TTL 1D $ORIGIN 3.2.1.in-addr.arpa. @ IN SOA ns1.example.com contact.example.com. ( 2011042908 ; 8H ; 2H ; 4W ; 1D ; ) NS ns1.example.com. NS ns2.example.com. 4 PTR hostname.example.com. 5 PTR hostname.example.com. ; Also of note: both of these servers are managed. Tech support is very responsive, and largely useless. Hours go by with them asking me questions to narrow down what could be wrong, then they pass the ticket to the tech on the next shift, who ignores everything that's happened already and spend his whole shift asking all the same questions the last guy asked. So, in summary: *Nameservers, with IPs, are correctly registered with domain registrar *named is configured and running *...and must not be configured correctly, because nothing resolves. Any help would be great. I changed domains and IPs in the files to generics, but let me know if you need to know the domain in question. Thanks! UPDATE I found that I didn't have 127.0.0.1 in /etc/resolv.conf, so I added it, along with my two public IPs that I have named listening on. resolv.conf search www.example.com example.com nameserver 127.0.0.1 nameserver 7.8.9.10 ;Was in here by default, authoritative nameserver of hosting company nameserver 1.2.3.4 ;Public IP #1 nameserver 1.2.3.5 ;Public IP #2 Now when I DIG example.com from the host, it resolves. If I try to DIG from my other server (in the same datacenter), or from the internet, it times out or I get SERVFAIL.

    Read the article

  • Approach for authentication and storing user details.

    - by cappuccino
    Hey folks, I am using the Zend Framework but my question is broadly about sessions / databases / auth (PHP MySQL). Currently this is my approach to authentication: 1) User signs in, the details are checked in database. - Standard stuff really. 2) If the details are correct only the user's unique ID is stored in the session and a security token (user unique ID + IP + Browser info + salt). The session in written to the filesystem. I've been reading around and many are saying that storing stuff in sessions is not a good idea, and that you should really only write a unique ID which refers back to the user's details and a security token to prevent session hijacking. So this is the approach i've taken, i use to write the user's details in session, but i've moved that out. Wanted to know your opinions on this. I'm keeping sessions in the filesystem since i don't run on multiple servers, and since i'm only writting a tiny tiny bit of data to sessions, i thought that performance would be greater keeping sessions in the filesystem to reduce load on the database. Once the session is written on authentication, it really is only read-only from then on. 3) The rest of the user's details (like subscription details, permissions, account info etc) are cached in the filesystem (this can always be easily moved to memory if i wanted even more performance). So rather than keeping the user's details in session, the user's details are cached in the file system. I'm using Zend_Cache and the unique cache id is something like md5(/cache/auth/2892), the number is the unique id of the user. I guess the benefit of this method is that once the user is logged in, there is essentially not database queries being run to get the user's details. Just wonder if this approach is better than keeping the whole lot in session... 4) As the user moves throughout the site the only thing that is checked is the ID in the session and the security token. So, overall the first question is 1) is the filesystem more efficient than a database for this purpose 2) have i taken enough security precautions 3) is separating user detail's from the session into a cached file a pointless task? Thanks.

    Read the article

  • SQL Server CTE referred in self joins slow

    - by Kharlos Dominguez
    Hello, I have written a table-valued UDF that starts by a CTE to return a subset of the rows from a large table. There are several joins in the CTE. A couple of inner and one left join to other tables, which don't contain a lot of rows. The CTE has a where clause that returns the rows within a date range, in order to return only the rows needed. I'm then referencing this CTE in 4 self left joins, in order to build subtotals using different criterias. The query is quite complex but here is a simplified pseudo-version of it WITH DataCTE as ( SELECT [columns] FROM table INNER JOIN table2 ON [...] INNER JOIN table3 ON [...] LEFT JOIN table3 ON [...] ) SELECT [aggregates_columns of each subset] FROM DataCTE Main LEFT JOIN DataCTE BananasSubset ON [...] AND Product = 'Bananas' AND Quality = 100 LEFT JOIN DataCTE DamagedBananasSubset ON [...] AND Product = 'Bananas' AND Quality < 20 LEFT JOIN DataCTE MangosSubset ON [...] GROUP BY [ I have the feeling that SQL Server gets confused and calls the CTE for each self join, which seems confirmed by looking at the execution plan, although I confess not being an expert at reading those. I would have assumed SQL Server to be smart enough to only perform the data retrieval from the CTE only once, rather than do it several times. I have tried the same approach but rather than using a CTE to get the subset of the data, I used the same select query as in the CTE, but made it output to a temp table instead. The version referring the CTE version takes 40 seconds. The version referring the temp table takes between 1 and 2 seconds. Why isn't SQL Server smart enough to keep the CTE results in memory? I like CTEs, especially in this case as my UDF is a table-valued one, so it allowed me to keep everything in a single statement. To use a temp table, I would need to write a multi-statement table valued UDF, which I find a slightly less elegant solution. Did some of you had this kind of performance issues with CTE, and if so, how did you get them sorted? Thanks, Kharlos

    Read the article

  • Understanding C++ dynamic allocation

    - by kiokko89
    Consider the following code: class CString { private: char* buff; size_t len; public: CString(const char* p):len(0), buff(nullptr) { cout << "Constructor called!"<<endl; if (p!=nullptr) { len= strlen(p); if (len>0) { buff= new char[len+1]; strcpy_s(buff, len+1, p); } } } CString (const CString& s) { cout << "Copy constructor called!"<<endl; len= s.len; buff= new char[len+1]; strcpy_s(buff, len+1, s.buff); } CString& operator = (const CString& rhs) { cout << "Assignment operator called!"<<endl; if (this != &rhs) { len= rhs.len; delete[] buff; buff= new char[len+1]; strcpy_s(buff, len+1, rhs.buff); } return *this; } CString operator + (const CString& rhs) const { cout << "Addition operator called!"<<endl; size_t lenght= len+rhs.len+1; char* tmp = new char[lenght]; strcpy_s(tmp, lenght, buff); strcat_s(tmp, lenght, rhs.buff); return CString(tmp); } ~CString() { cout << "Destructor called!"<<endl; delete[] buff; } }; int main() { CString s1("Hello"); CString s2("World"); CString s3 = s1+s2; } My problem is that I don't know how to delete the memory allocated in the addition operator function(char* tmp = new char[length]). I couldn't do this in the constructor(I tried delete[] p) because it is also called from the main function with arrays of chars as parameters which are not allocated on the heap...How can I get around this? (Sorry for my bad English...)

    Read the article

  • Class template specializations with shared functionality

    - by Thomas
    I'm writing a simple maths library with a template vector type: template<typename T, size_t N> class Vector { public: Vector<T, N> &operator+=(Vector<T, N> const &other); // ... more operators, functions ... }; Now I want some additional functionality specifically for some of these. Let's say I want functions x() and y() on Vector<T, 2> to access particular coordinates. I could create a partial specialization for this: template<typename T> class Vector<T, 3> { public: Vector<T, 3> &operator+=(Vector<T, 3> const &other); // ... and again all the operators and functions ... T x() const; T y() const; }; But now I'm repeating everything that already existed in the generic template. I could also use inheritance. Renaming the generic template to VectorBase, I could do this: template<typename T, size_t N> class Vector : public VectorBase<T, N> { }; template<typename T> class Vector<T, 3> : public VectorBase<T, 3> { public: T x() const; T y() const; }; However, now the problem is that all operators are defined on VectorBase, so they return VectorBase instances. These cannot be assigned to Vector variables: Vector<float, 3> v; Vector<float, 3> w; w = 5 * v; // error: no conversion from VectorBase<float, 3> to Vector<float, 3> I could give Vector an implicit conversion constructor to make this possible: template<typename T, size_t N> class Vector : public VectorBase<T, N> { public: Vector(VectorBase<T, N> const &other); }; However, now I'm converting from Vector to VectorBase and back again. Even though the types are the same in memory, and the compiler might optimize all this away, it feels clunky and I don't really like to have potential run-time overhead for what is essentially a compile-time problem. Is there any other way to solve this?

    Read the article

  • Why an object declared in method is subject to garbage collection before the method returns?

    - by SiLent SoNG
    Consider an object declared in a method: public void foo() { final Object obj = new Object(); // A long run job that consumes tons of memory and // triggers garbage collection } Will obj be subject to garbage collection before foo() returns? UPDATE: Previously I thought obj is not subject to garbage collection until foo() returns. However, today I find myself wrong. I have spend several hours in fixing a bug and finally found the problem is caused by obj garbage collected! Can anyone explain why this happens? And if I want obj to be pinned how to achieve it? Here is the code that has problem. public class Program { public static void main(String[] args) throws Exception { String connectionString = "jdbc:mysql://<whatever>"; // I find wrap is gc-ed somewhere SqlConnection wrap = new SqlConnection(connectionString); Connection con = wrap.currentConnection(); Statement stmt = con.createStatement(ResultSet.TYPE_FORWARD_ONLY, ResultSet.CONCUR_READ_ONLY); stmt.setFetchSize(Integer.MIN_VALUE); ResultSet rs = stmt.executeQuery("select instance_id, doc_id from crawler_archive.documents"); while (rs.next()) { int instanceID = rs.getInt(1); int docID = rs.getInt(2); if (docID % 1000 == 0) { System.out.println(docID); } } rs.close(); //wrap.close(); } } After running the Java program, it will print the following message before it crashes: 161000 161000 ******************************** Finalizer CALLED!! ******************************** ******************************** Close CALLED!! ******************************** 162000 Exception in thread "main" com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: And here is the code of class SqlConnection: class SqlConnection { private final String connectionString; private Connection connection; public SqlConnection(String connectionString) { this.connectionString = connectionString; } public synchronized Connection currentConnection() throws SQLException { if (this.connection == null || this.connection.isClosed()) { this.closeConnection(); this.connection = DriverManager.getConnection(connectionString); } return this.connection; } protected void finalize() throws Throwable { try { System.out.println("********************************"); System.out.println("Finalizer CALLED!!"); System.out.println("********************************"); this.close(); } finally { super.finalize(); } } public void close() { System.out.println("********************************"); System.out.println("Close CALLED!!"); System.out.println("********************************"); this.closeConnection(); } protected void closeConnection() { if (this.connection != null) { try { connection.close(); } catch (Throwable e) { } finally { this.connection = null; } } } }

    Read the article

  • Optimizing Vector elements swaps using CUDA

    - by Orion Nebula
    Hi all, Since I am new to cuda .. I need your kind help I have this long vector, for each group of 24 elements, I need to do the following: for the first 12 elements, the even numbered elements are multiplied by -1, for the second 12 elements, the odd numbered elements are multiplied by -1 then the following swap takes place: Graph: because I don't yet have enough points, I couldn't post the image so here it is: http://www.freeimagehosting.net/image.php?e4b88fb666.png I have written this piece of code, and wonder if you could help me further optimize it to solve for divergence or bank conflicts .. //subvector is a multiple of 24, Mds and Nds are shared memory _shared_ double Mds[subVector]; _shared_ double Nds[subVector]; int tx = threadIdx.x; int tx_mod = tx ^ 0x0001; int basex = __umul24(blockDim.x, blockIdx.x); Mds[tx] = M.elements[basex + tx]; __syncthreads(); // flip the signs if (tx < (tx/24)*24 + 12) { //if < 12 and even if ((tx & 0x0001)==0) Mds[tx] = -Mds[tx]; } else if (tx < (tx/24)*24 + 24) { //if >12 and < 24 and odd if ((tx & 0x0001)==1) Mds[tx] = -Mds[tx]; } __syncthreads(); if (tx < (tx/24)*24 + 6) { //for the first 6 elements .. swap with last six in the 24elements group (see graph) Nds[tx] = Mds[tx_mod + 18]; Mds [tx_mod + 18] = Mds [tx]; Mds[tx] = Nds[tx]; } else if (tx < (tx/24)*24 + 12) { // for the second 6 elements .. swp with next adjacent group (see graph) Nds[tx] = Mds[tx_mod + 6]; Mds [tx_mod + 6] = Mds [tx]; Mds[tx] = Nds[tx]; } __syncthreads(); Thanks in advance ..

    Read the article

  • Remote Postgresql - extremely slow

    - by Muffinbubble
    Hi, I have setup PostgreSQL on a VPS I own - the software that accesses the database is a program called PokerTracker. PokerTracker logs all your hands and statistics whilst playing online poker. I wanted this accessible from several different computers so decided to installed it on my VPS and after a few hiccups I managed to get it connecting without errors. However, the performance is dreadful. I have done tons of research on 'remote postgresql slow' etc and am yet to find an answer so am hoping someone is able to help. Things to note: The query I am trying to execute is very small. Whilst connecting locally on the VPS, the query runs instantly. While running it remotely, it takes about 1 minute and 30 seconds to run the query. The VPS is running 100MBPS and then computer I'm connecting to it from is on an 8MB line. The network communication between the two is almost instant, I am able to remotely connect fine with no lag whatsoever and am hosting several websites running MSSQL and all the queries run instantly, whether connected remotely or locally so it seems specific to PostgreSQL. I'm running their newest version of the software and the newest compatible version of PostgreSQL with their software. The database is a new database, containing hardly any data and I've ran vacuum/analyze etc all to no avail, I see no improvements. I don't understand how MSSQL can query almost instantly yet PostgreSQL struggles so much. I am able to telnet to the post 5432 on the VPS IP with no problems, and as I say the query does execute it just takes an extremely long time. What I do notice is on the router when the query is running that hardly any bandwidth is being used - but then again I wouldn't expect it to for a simple query but am not sure if this is the issue. I've tried connecting remotely on 3 different networks now (including different routers) but the problem remains. Connecting remotely via another machine via the LAN is instant. I have also edited the postgre conf file to allow for more memory/buffers etc but I don't think this is the problem - what I am asking it to do is very simple - it shouldn't be intensive at all. Thanks, Ricky

    Read the article

  • Differences between matrix implementation in C

    - by tempy
    I created two 2D arrays (matrix) in C in two different ways. I don't understand the difference between the way they're represented in the memory, and the reason why I can't refer to them in the same way: scanf("%d", &intMatrix1[i][j]); //can't refer as &intMatrix1[(i * lines)+j]) scanf("%d", &intMatrix2[(i * lines)+j]); //can't refer as &intMatrix2[i][j]) What is the difference between the ways these two arrays are implemented and why do I have to refer to them differently? How do I refer to an element in each of the arrays in the same way (?????? in my printMatrix function)? int main() { int **intMatrix1; int *intMatrix2; int i, j, lines, columns; lines = 3; columns = 2; /************************* intMatrix1 ****************************/ intMatrix1 = (int **)malloc(lines * sizeof(int *)); for (i = 0; i < lines; ++i) intMatrix1[i] = (int *)malloc(columns * sizeof(int)); for (i = 0; i < lines; ++i) { for (j = 0; j < columns; ++j) { printf("Type a number for intMatrix1[%d][%d]\t", i, j); scanf("%d", &intMatrix1[i][j]); } } /************************* intMatrix2 ****************************/ intMatrix2 = (int *)malloc(lines * columns * sizeof(int)); for (i = 0; i < lines; ++i) { for (j = 0; j < columns; ++j) { printf("Type a number for intMatrix2[%d][%d]\t", i, j); scanf("%d", &intMatrix2[(i * lines)+j]); } } /************** printing intMatrix1 & intMatrix2 ****************/ printf("intMatrix1:\n\n"); printMatrix(*intMatrix1, lines, columns); printf("intMatrix2:\n\n"); printMatrix(intMatrix2, lines, columns); } /************************* printMatrix ****************************/ void printMatrix(int *ptArray, int h, int w) { int i, j; printf("Printing matrix...\n\n\n"); for (i = 0; i < h; ++i) for (j = 0; j < w; ++j) printf("array[%d][%d] ==============> %d\n, i, j, ??????); }

    Read the article

  • Saving data in custom class via AppDelegate

    - by redspike
    I can't seem to save data to a custom instance object in my AppDelegate. My custom class is very simple and is as follows: Person.h ... @interface Person : NSObject { int _age; } - (void) setAge: (int) age; - (int) age; @end Person.m #import "Person.h" @implementation Person - (void) setAge:(int) age { _age = age; } - (int) age { return _age; } @end I then create an instance of Person in the AppDelegate class: AppDelegate.h @class Person; @interface AccuTaxAppDelegate : NSObject <UIApplicationDelegate> { ... Person *person; } ... @property (nonatomic, retain) Person *person; @end AppDelegate.m ... #import "Person.h" @implementation AccuTaxAppDelegate ... @synthesize person; - (void)applicationDidFinishLaunching:(UIApplication *)application { // Override point for customization after app launch [window addSubview:[navigationController view]]; [window makeKeyAndVisible]; } - (void)applicationWillTerminate:(UIApplication *)application { // Save data if appropriate } #pragma mark - #pragma mark Memory management - (void)dealloc { [navigationController release]; [window release]; [person release]; [super dealloc]; } @end Finally, in my ViewController code I grab a handle on AppDelegate and then grab the person instance, but when I try to save the age it doesn't seem to work: MyViewController ... - (void)textFieldDidEndEditing:(UITextField *)textField { NSString *textAge = [textField text]; int age = [textAge intValue]; NSLog(@"Age from text field::%i", age); AppDelegate *appDelegate = (AppDelegate *)[UIApplication sharedApplication].delegate; Person *myPerson = (Person *)[appDelegate person]; NSLog(@"Age before setting: %i", [myPerson age]); [myPerson setAge:age]; NSLog(@"Age after setting: %i", [myPerson age]); [textAge release]; } ... The output of the above NSLogs are: [Session started at 2010-05-04 18:29:22 +0100.] 2010-05-04 18:29:28.260 AccuTax[16235:207] Age in text field:25 2010-05-04 18:29:28.262 AccuTax[16235:207] Age before setting: 0 2010-05-04 18:29:28.263 AccuTax[16235:207] Age after setting: 0 Any ideas why 'age' isn't being stored? I'm relatively new to Obj-C so please forgive me if I'm missing something very simple!

    Read the article

  • Do You Really Know Your Programming Languages?

    - by Kristopher Johnson
    I am often amazed at how little some of my colleagues know or care about their craft. Something that constantly frustrates me is that people don't want to learn any more than they need to about the programming languages they use every day. Many programmers seem content to learn some pidgin sub-dialect, and stick with that. If they see a keyword or construct that they aren't familiar with, they'll complain that the code is "tricky." What would you think of a civil engineer who shied away from calculus because it had "all those tricky math symbols?" I'm not suggesting that we all need to become "language lawyers." But if you make your living as a programmer, and claim to be a competent user of language X, then I think at a minimum you should know the following: Do you know the keywords of the language and what they do? What are the valid syntactic forms? How are memory, files, and other operating system resources managed? Where is the official language specification and library reference for the language? The last one is the one that really gets me. Many programmers seem to have no idea that there is a "specification" or "standard" for any particular language. I still talk to people who think that Microsoft invented C++, and that if a program doesn't compile under VC6, it's not a valid C++ program. Programmers these days have it easy when it comes to obtaining specs. Newer languages like C#, Java, Python, Ruby, etc. all have their documentation available for free from the vendors' web sites. Older languages and platforms often have standards controlled by standards bodies that demand payment for specs, but even that shouldn't be a deterrent: the C++ standard is available from ISO for $30 (and why am I the only person I know who has a copy?). Programming is hard enough even when you do know the language. If you don't, I don't see how you have a chance. What do the rest of you think? Am I right, or should we all be content with the typical level of programming language expertise? Update: Several great comments here. Thanks. A couple of people hit on something that I didn't think about: What really irks me is not the lack of knowledge, but the lack of curiosity and willingness to learn. It seems some people don't have any time to hone their craft, but they have plenty of time to write lots of bad code. And I don't expect people to be able to recite a list of keywords or EBNF expressions, but I do expect that when they see some code, they should have some inkling of what it does. Few people have complete knowledge of every dark corner of their language or platform, but everyone should at least know enough that when they see something unfamiliar, they will know how to get whatever additional information they need to understand it.

    Read the article

  • IEnumerable<T> ToArray usage, is it a copy or a pointer?

    - by Daniel
    I am parsing an arbitrary length byte array that is going to be passed around to a few different layers of parsing. Each parser creates a Header and a Packet payload just like any ordinary encapsulation. And my problem lies in how the encapsulation holds its packet byte array payload. Say i have a 100 byte array, and it has 3 levels of encapsulation. 3 packet objects will be created and i want to set the payload of these packets to the corresponding position in the byte array of the packet. For example lets say the payload size is 20 for all levels, then imagine it has a public byte[] Payload on each object. However the problem is that this byte[] Payload is a copy of the original 100 bytes. So i'm going to end up with 160 bytes in memory instead of 100. If it were in c++ i could just easily use a pointer however i'm writing this in c#. So i created the following class: public class PayloadSegment<T> : IEnumerable<T> { public readonly T[] Array; public readonly int Offset; public readonly int Count; public PayloadSegment(T[] array, int offset, int count) { this.Array = array; this.Offset = offset; this.Count = count; } public T this[int index] { get { if (index < 0 || index >= this.Count) throw new IndexOutOfRangeException(); else return Array[Offset + index]; } set { if (index < 0 || index >= this.Count) throw new IndexOutOfRangeException(); else Array[Offset + index] = value; } } public IEnumerator<T> GetEnumerator() { for (int i = Offset; i < Offset + Count; i++) yield return Array[i]; } System.Collections.IEnumerator System.Collections.IEnumerable.GetEnumerator() { IEnumerator<T> enumerator = this.GetEnumerator(); while (enumerator.MoveNext()) { yield return enumerator.Current; } } } This way i can simply reference a position inside the original byte array but use positional indexing. However if i do something like: PayloadSegment<byte> something = new PayloadSegment<byte>(someArray, 5, 10); byte[] somethingArray = something.ToArray(); Will the somethingArray be a copy of the bytes, or a reference to the original PayloadSegment which in turn is a reference to the original byte array? Sorry it was hard to word this lol _<

    Read the article

  • Few iPhone noob questions

    - by mshsayem
    Why should I declare local variables as 'static' inside a method? Like: static NSString *cellIdentifier = @"Cell"; Is it a performance advantage? (I know what 'static' does; in C context) What does this syntax mean?[someObj release], someObj = nil; Two statements? Why should I assign nil again? Is not 'release' enough? Should I do it for all objects I allocate/own? Or for just view objects? Why does everyone copy NSString, but retains other objects (in property declaration)? Yes, NSStrings can be changed, but other objects can be changed also, right? Then why 'copy' for just NSString, not for all? Is it just a defensive convention? Shouldn't I release constant NSString? Like here:NSString *CellIdentifier = @"Cell"; Why not? Does the compiler allocate/deallocate it for me? In some tutorial application I observed these (Built with IB): Properties(IBOutlet, with same ivar name): window, someLabel, someTextField, etc etc... In the dealloc method, although the window ivar was released, others were not. My question is: WHY? Shouldn't I release other ivars(labels, textField) as well? Why not? Say, I have 3 cascaded drop-down lists. I mean, based on what is selected on the first list, 2nd list is populated and based on what is selected on the second list, 3rd list is populated. What UI components can reflect this best? How is drop-down list presented in iPhone UI? Tableview with UIPicker? When should I update the 2nd, 3rd list? Or just three labels which have touch events? Can you give me some good example tutorials about Core-Data? (Not just simple data fetching and storing on 2/3 tables with 1/2 relationship) How can I know whether my app is leaking memory? Any tools?

    Read the article

  • Windows Phone period task, function not executing

    - by Special K.
    I'm trying to execute a code (to parse an XML to be more precisely, and after that I'll toast message the user with some new info's), but the class function AccDetailsDownloaded is not executed (is simply skipped), also the memory usage is ~2mb out of 6, here is my code: if (task is PeriodicTask) { getData(); } else { getData(); } // If debugging is enabled, launch the agent again in one minute. #if DEBUG_AGENT ScheduledActionService.LaunchForTest(task.Name, TimeSpan.FromSeconds(60)); #endif // Call NotifyComplete to let the system know the agent is done working. NotifyComplete(); } public void getData() { var settings = IsolatedStorageSettings.ApplicationSettings; string url = "http://example.com/example.xml"; if (!System.Net.NetworkInformation.NetworkInterface.GetIsNetworkAvailable()) { MessageBox.Show("No network connection available!"); return; } // start loading XML-data WebClient downloader = new WebClient(); Uri uri = new Uri(url, UriKind.Absolute); downloader.DownloadStringCompleted += new DownloadStringCompletedEventHandler(AccDetailsDownloaded); downloader.DownloadStringAsync(uri); string toastTitle = ""; toastTitle = "Periodic "; string toastMessage = "Mem usage: " + DeviceStatus.ApplicationPeakMemoryUsage + "/" + DeviceStatus.ApplicationMemoryUsageLimit; // Launch a toast to show that the agent is running. // The toast will not be shown if the foreground application is running. ShellToast toast = new ShellToast(); toast.Title = toastTitle; toast.Content = toastMessage; toast.Show(); } void AccDetailsDownloaded(object sender, DownloadStringCompletedEventArgs e) { if (e.Result == null || e.Error != null) { MessageBox.Show("There was an error downloading the XML-file!"); } else { string toastTitle = ""; toastTitle = "Periodic "; string toastMessage = "Mem usage: " + DeviceStatus.ApplicationPeakMemoryUsage + "/" + DeviceStatus.ApplicationMemoryUsageLimit; // Launch a toast to show that the agent is running. // The toast will not be shown if the foreground application is running. ShellToast toast = new ShellToast(); toast.Title = toastTitle; toast.Content = toastMessage; toast.Show(); } } Thank you.

    Read the article

  • Multi-tier applications using L2S, WCF and Base Class

    - by Gena Verdel
    Hi all. One day I decided to build this nice multi-tier application using L2S and WCF. The simplified model is : DataBase-L2S-Wrapper(DTO)-Client Application. The communication between Client and Database is achieved by using Data Transfer Objects which contain entity objects as their properties. abstract public class BaseObject { public virtual IccSystem.iccObjectTypes ObjectICC_Type { get { return IccSystem.iccObjectTypes.unknownType; } } [global::System.Data.Linq.Mapping.ColumnAttribute(Storage = "_ID", AutoSync = AutoSync.OnInsert, DbType = "BigInt NOT NULL IDENTITY", IsPrimaryKey = true, IsDbGenerated = true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order = 1)] public virtual long ID { //get; //set; get { return _ID; } set { _ID = value; } } } [DataContract] public class BaseObjectWrapper<T> where T : BaseObject { #region Fields private T _DBObject; #endregion #region Properties [DataMember] public T Entity { get { return _DBObject; } set { _DBObject = value; } } #endregion } Pretty simple, isn't it?. Here's the catch. Each one of the mapped classes contains ID property itself so I decided to override it like this [global::System.Data.Linq.Mapping.TableAttribute(Name="dbo.Divisions")] [global::System.Runtime.Serialization.DataContractAttribute()] public partial class Division : INotifyPropertyChanging, INotifyPropertyChanged { [global::System.Data.Linq.Mapping.ColumnAttribute(Storage="_ID", AutoSync=AutoSync.OnInsert, DbType="BigInt NOT NULL IDENTITY", IsPrimaryKey=true, IsDbGenerated=true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order=1)] public override long ID { get { return this._ID; } set { if ((this._ID != value)) { this.OnIDChanging(value); this.SendPropertyChanging(); this._ID = value; this.SendPropertyChanged("ID"); this.OnIDChanged(); } } } } Wrapper for division is pretty straightforward as well: public class DivisionWrapper : BaseObjectWrapper<Division> { } It worked pretty well as long as I kept ID values at mapped class and its BaseObject class the same(that's not very good approach, I know, but still) but then this happened: private CentralDC _dc; public bool UpdateDivision(ref DivisionWrapper division) { DivisionWrapper tempWrapper = division; if (division.Entity == null) { return false; } try { Table<Division> table = _dc.Divisions; var q = table.Where(o => o.ID == tempWrapper.Entity.ID); if (q.Count() == 0) { division.Entity._errorMessage = "Unable to locate entity with id " + division.Entity.ID.ToString(); return false; } var realEntity = q.First(); realEntity = division.Entity; _dc.SubmitChanges(); return true; } catch (Exception ex) { division.Entity._errorMessage = ex.Message; return false; } } When trying to enumerate over the in-memory query the following exception occurred: Class member BaseObject.ID is unmapped. Although I'm stating the type and overriding the ID property L2S fails to work. Any suggestions?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • how to update an Android ListActivity on changing data of the connected SimpleCursorAdapter

    - by 4485670
    I have the following code. What I want to achieve is to update the shown list when I click an entry so I can traverse through the list. I found the two uncommented ways to do it here on stackoverflow, but neither works. I also got the advice to create a new ListActivity on the data update, but that sounds like wasting resources? EDIT: I found the solution myself. All you need to do is call "SimpleCursorAdapter.changeCursor(new Cursor);". No notifying, no things in UI-Thread or whatever. import android.app.ListActivity; import android.database.Cursor; import android.os.Bundle; import android.util.Log; import android.view.View; import android.widget.ListView; import android.widget.SimpleCursorAdapter; public class MyActivity extends ListActivity { private DepartmentDbAdapter mDbHelper; private Cursor cursor; private String[] from = new String[] { DepartmentDbAdapter.KEY_NAME }; private int[] to = new int[] { R.id.text1 }; private SimpleCursorAdapter notes; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.departments_list); mDbHelper = new DepartmentDbAdapter(this); mDbHelper.open(); // Get all of the departments from the database and create the item list cursor = mDbHelper.fetchSubItemByParentId(1); this.startManagingCursor(cursor); // Now create an array adapter and set it to display using our row notes = new SimpleCursorAdapter(this, R.layout.department_row, cursor, from, to); this.setListAdapter(notes); } @Override protected void onListItemClick(ListView l, View v, int position, long id) { super.onListItemClick(l, v, position, id); // get new data and update the list this.updateData(safeLongToInt(id)); } /** * update data for the list * * @param int departmentId id of the parent department */ private void updateData(int departmentId) { // close the old one, get a new one cursor.close(); cursor = mDbHelper.fetchSubItemByParentId(departmentId); // change the cursor of the adapter to the new one notes.changeCursor(cursor); } /** * safely convert long to in to save memory * * @param long l the long variable * * @return integer */ public static int safeLongToInt(long l) { if (l < Integer.MIN_VALUE || l > Integer.MAX_VALUE) { throw new IllegalArgumentException (l + " cannot be cast to int without changing its value."); } return (int) l; } }

    Read the article

  • Getting instance crashes on IntelliJ IDEA with scala plugin.

    - by egervari
    I am building a scala web project using scala test, lift, jpa, hibernate, mercurial plugin, etc. I am getting instant crashes, where the ide just bombs, the window shuts down, and it gives no error messages whatsoever when I am doing any amount of copy/pasting of code. This started happening once my project got to about 100 unit tests. This problem is incredibly annoying, because when the crash happens, 30-60 seconds of activity is not saved. Even IDEA will forget which files were last opened and will forget where the cursor was, which makes it really hard to continue where you left off after the crash. A lot can happen in 60 seconds! Now, I've given up, because it seems like all sorts of things cause the IntelliJ IDEA to crash over and over. For example, if I were to copy and paste this code, to write a similar test for another collection type, it would crash shortly after: it should "cascade save and delete status messages" in { val statusMessage = new StatusMessage("message") var user = userDao.find(1).get user.addToStatusMessages(statusMessage) userDao.save(user) statusMessage.isPersistent should be (true) userDao.delete(user) statusMessageDao.find(statusMessage.id) should equal (None) } There is nothing special about this piece of code. It's code that is working just fine. However, IDEA bombs shortly after I paste something like this. For example, I might change StatusMessage to the new class I want to test cascading on... and then have to import that class into the test... and BOOM... it crashed. On windows 7, the IDEA window literally just minimizes and crashes with no warning. The next time I startup IDEA, it has no memory of what happened. Now, I've had this problem before. I posted it way back on IDEA's YouTrack. I was told to invalidate my caches. That never fixed it then, and it's not fixing it now. Please help. This error is fairly random, but it's happening constantly now. I could program for hours and not see it before... and the fact that my work just gets destroyed and I can't remember what I did during the last minute causes me to swear at my monitor at a db level higher than my stereo can go.

    Read the article

  • writing XML with Xerces 3.0.1 and C++ on windows

    - by Jon
    Hi, i have the following function i wrote to create an XML file using Xerces 3.0.1, if i call this function with a filePath of "foo.xml" or "../foo.xml" it works great, but if i pass in "c:/foo.xml" then i get an exception on this line XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); can someone explain why my code works for relative paths, but not absolute paths please? many thanks. const int ABSOLUTE_PATH_FILENAME_PREFIX_SIZE = 9; void OutputXML(xercesc::DOMDocument* pmyDOMDocument, std::string filePath) { //Return the first registered implementation that has the desired features. In this case, we are after a DOM implementation that has the LS feature... or Load/Save. DOMImplementation *implementation = DOMImplementationRegistry::getDOMImplementation(L"LS"); // Create a DOMLSSerializer which is used to serialize a DOM tree into an XML document. DOMLSSerializer *serializer = ((DOMImplementationLS*)implementation)->createLSSerializer(); // Make the output more human readable by inserting line feeds. if (serializer->getDomConfig()->canSetParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true)) serializer->getDomConfig()->setParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true); // The end-of-line sequence of characters to be used in the XML being written out. serializer->setNewLine(XMLString::transcode("\r\n")); // Convert the path into Xerces compatible XMLCh*. XMLCh *tempFilePath = XMLString::transcode(filePath.c_str()); // Calculate the length of the string. const int pathLen = XMLString::stringLen(tempFilePath); // Allocate memory for a Xerces string sufficent to hold the path. XMLCh *targetPath = (XMLCh*)XMLPlatformUtils::fgMemoryManager->allocate((pathLen + ABSOLUTE_PATH_FILENAME_PREFIX_SIZE) * sizeof(XMLCh)); // Fixes a platform dependent absolute path filename to standard URI form. XMLString::fixURI(tempFilePath, targetPath); // Specify the target for the XML output. XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); //XMLFormatTarget *myFormTarget = new StdOutFormatTarget(); // Create a new empty output destination object. DOMLSOutput *output = ((DOMImplementationLS*)implementation)->createLSOutput(); // Set the stream to our target. output->setByteStream(formatTarget); // Write the serialized output to the destination. serializer->write(pmyDOMDocument, output); // Cleanup. serializer->release(); XMLString::release(&tempFilePath); delete formatTarget; output->release(); }

    Read the article

  • PHP Export Date range

    - by menormedia
    I have a working database export to xls but I need it to export a particular date range based on the 'closed' date. (See code below). For example, I'd like it to export all 'closed' dates for last month and/or this month (Range: Sept 1, 2012 to Sept 30, 2012 or Oct 1, 2012 to Oct 31, 2012) <?PHP //EDIT YOUR MySQL Connection Info: $DB_Server = "localhost"; //your MySQL Server $DB_Username = "root"; //your MySQL User Name $DB_Password = ""; //your MySQL Password $DB_DBName = "ost_helpdesk"; //your MySQL Database Name $DB_TBLName = "ost_ticket"; //your MySQL Table Name //$DB_TBLName, $DB_DBName, may also be commented out & passed to the browser //as parameters in a query string, so that this code may be easily reused for //any MySQL table or any MySQL database on your server //DEFINE SQL QUERY: //edit this to suit your needs $sql = "Select ticketID, name, company, subject, closed from $DB_TBLName ORDER BY closed DESC"; //Optional: print out title to top of Excel or Word file with Timestamp //for when file was generated: //set $Use_Titel = 1 to generate title, 0 not to use title $Use_Title = 1; //define date for title: EDIT this to create the time-format you need $now_date = DATE('m-d-Y'); //define title for .doc or .xls file: EDIT this if you want $title = "MDT Database Dump For Table $DB_TBLName from Database $DB_DBName on $now_date"; /* Leave the connection info below as it is: just edit the above. (Editing of code past this point recommended only for advanced users.) */ //create MySQL connection $Connect = @MYSQL_CONNECT($DB_Server, $DB_Username, $DB_Password) or DIE("Couldn't connect to MySQL:<br>" . MYSQL_ERROR() . "<br>" . MYSQL_ERRNO()); //select database $Db = @MYSQL_SELECT_DB($DB_DBName, $Connect) or DIE("Couldn't select database:<br>" . MYSQL_ERROR(). "<br>" . MYSQL_ERRNO()); //execute query $result = @MYSQL_QUERY($sql,$Connect) or DIE("Couldn't execute query:<br>" . MYSQL_ERROR(). "<br>" . MYSQL_ERRNO()); //if this parameter is included ($w=1), file returned will be in word format ('.doc') //if parameter is not included, file returned will be in excel format ('.xls') IF (ISSET($w) && ($w==1)) { $file_type = "msword"; $file_ending = "doc"; }ELSE { $file_type = "vnd.ms-excel"; $file_ending = "xls"; } //header info for browser: determines file type ('.doc' or '.xls') HEADER("Content-Type: application/$file_type"); HEADER("Content-Disposition: attachment; filename=MDT_DB_$now_date.$file_ending"); HEADER("Pragma: no-cache"); HEADER("Expires: 0"); /* Start of Formatting for Word or Excel */ IF (ISSET($w) && ($w==1)) //check for $w again { /* FORMATTING FOR WORD DOCUMENTS ('.doc') */ //create title with timestamp: IF ($Use_Title == 1) { ECHO("$title\n\n"); } //define separator (defines columns in excel & tabs in word) $sep = "\n"; //new line character WHILE($row = MYSQL_FETCH_ROW($result)) { //set_time_limit(60); // HaRa $schema_insert = ""; FOR($j=0; $j<mysql_num_fields($result);$j++) { //define field names $field_name = MYSQL_FIELD_NAME($result,$j); //will show name of fields $schema_insert .= "$field_name:\t"; IF(!ISSET($row[$j])) { $schema_insert .= "NULL".$sep; } ELSEIF ($row[$j] != "") { $schema_insert .= "$row[$j]".$sep; } ELSE { $schema_insert .= "".$sep; } } $schema_insert = STR_REPLACE($sep."$", "", $schema_insert); $schema_insert .= "\t"; PRINT(TRIM($schema_insert)); //end of each mysql row //creates line to separate data from each MySQL table row PRINT "\n----------------------------------------------------\n"; } }ELSE{ /* FORMATTING FOR EXCEL DOCUMENTS ('.xls') */ //create title with timestamp: IF ($Use_Title == 1) { ECHO("$title\n"); } //define separator (defines columns in excel & tabs in word) $sep = "\t"; //tabbed character //start of printing column names as names of MySQL fields FOR ($i = 0; $i < MYSQL_NUM_FIELDS($result); $i++) { ECHO MYSQL_FIELD_NAME($result,$i) . "\t"; } PRINT("\n"); //end of printing column names //start while loop to get data WHILE($row = MYSQL_FETCH_ROW($result)) { //set_time_limit(60); // HaRa $schema_insert = ""; FOR($j=0; $j<mysql_num_fields($result);$j++) { IF(!ISSET($row[$j])) $schema_insert .= "NULL".$sep; ELSEIF ($row[$j] != "") $schema_insert .= "$row[$j]".$sep; ELSE $schema_insert .= "".$sep; } $schema_insert = STR_REPLACE($sep."$", "", $schema_insert); //this corrects output in excel when table fields contain \n or \r //these two characters are now replaced with a space $schema_insert = PREG_REPLACE("/\r\n|\n\r|\n|\r/", " ", $schema_insert); $schema_insert .= "\t"; PRINT(TRIM($schema_insert)); PRINT "\n"; } } ?>

    Read the article

  • How do I create a thread-safe write-once read-many value in Java?

    - by Software Monkey
    This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

    Read the article

  • WinForm-style Invoke() in unmanaged C++

    - by Matt Green
    I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

    Read the article

  • Using XmlDiffPatch when writing to stream

    - by Mark Smith
    I am trying to use xmldiffpatch when comparing two Xmls(one from a stream, the other from a file) and writing the diff patch to a stream. The first method is to write my xml to a memory stream. The second method loads an xml from a file and creates a stream for the patched file to be written into. The third method actually compares the two files and writes the third. The xmldiff.Compare(originalFile, finalFile, dgw); method takes (XmlReader, XmlReader, XmlWriter). I'm always getting that both files are identical, even though they are not, so I know that I am missing something. Any help is appreciated! public MemoryStream FirstXml() { string[] names = { "John", "Mohammed", "Marc", "Tamara", "joy" }; MemoryStream ms = new MemoryStream(); XmlTextWriter xtw= new XmlTextWriter(ms, Encoding.UTF8); xtw.WriteStartDocument(); xtw.WriteStartElement("root"); foreach (string s in names) { xtw.WriteStartElement(s); xtw.WriteEndElement(); } xtw.WriteEndElement(); xtw.WriteEndDocument(); return ms; } public Stream SecondXml() { XmlReader finalFile =XmlReader.Create(@"c:\......\something.xml"); MemoryStream ms = FirstXml(); XmlReader originalFile = XmlReader.Create(ms); MemoryStream ms2 = new MemoryStream(); XmlTextWriter dgw = new XmlTextWriter(ms2, Encoding.UTF8); GenerateDiffGram(originalFile, finalFile, dgw); return ms2; } public void GenerateDiffGram(XmlReader originalFile, XmlReader finalFile, XmlWriter dgw) { XmlDiff xmldiff = new XmlDiff(); bool bIdentical = xmldiff.Compare(originalFile, finalFile, dgw); dgw.Close(); StreamReader sr = new StreamReader(SecondXml()); string xmlOutput = sr.ReadToEnd(); if(xmlOutput.Contains("</xd:xmldiff>")) {Console.WriteLine("Xml files are not identical"); Console.Read();} else {Console.WriteLine("Xml files are identical");Console.Read();} }

    Read the article

< Previous Page | 523 524 525 526 527 528 529 530 531 532 533 534  | Next Page >