Search Results

Search found 13940 results on 558 pages for 'chromium browser'.

Page 529/558 | < Previous Page | 525 526 527 528 529 530 531 532 533 534 535 536  | Next Page >

• Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

  - by gWiz

  I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

  Read the article

• How to detect for screenreaders/MSAA without focusing the flash movie?

  - by utt73

  I am trying to detect for the presence of assistive technology using flash. When a Flash movie holding the actionscript below on frame 1 is loaded (and screenreader chatting to IE or Firefox over MSAA is active -- JAWS or NVDA), Accessibility.isActive() does not return "true" until the movie is focused. Well, actually not until some "event" happens. The movie will just sit there until I right-click it & show flash player's context menu... it seems only then Accessibility.isActive() returns true. Right-clicking is the only way I could get the movie to "wake up". How do I get the movie to react on it's own and detect MSAA? I've tried sending focus to it with Javascript... can a fake a right-click in javascript or actionscript? Or do you know the events a right click is firing in a flash movie -- possibly I can programatically make that event happen? My Actionscript: var x = 0; //check if Microsoft Active Accessibility (MSAA) is active. //Setting takes 1-2 seconds to detect -- hence the setTimeout loop. function check508(){ if ( Accessibility.isActive() ) { //remove this later... just visual for testing logo.glogo.logotext.nextFrame(); //tell the page's javascript this is a 508 user getURL("javascript:setAccessible();") } else if (x<100) { trace ("There is currently no active accessibility aid. Attempt " + x); x++; setTimeout(check508,200); } } /* //FYI: only checks if browser can talk to MSAA, not that it is actually running. Sigh. if (System.capabilities.hasAccessibility) { logo.glogo.logotext.nextFrame(); getURL("javascript:setAccessible();") }; */ check508(); stop(); My HTML: <embed id="detector" width="220" height="100" quality="high" wmode="window" type="application/x-shockwave-flash" src="/images/detect.swf" pluginspage="http://www.adobe.com/go/getflashplayer" flashvars="">

  Read the article

• Ajax doesn't work on remote server .

  - by Nuha

  Hello . when I Implemented chatting Function , I use Ajax to send messages between file to another . so , it is working well on local host . but , when I upload it in to remote server it doesn't work. can U tell me ,why ? is an Ajax need Special configuration ? Ajax code : function Ajax_Send(GP,URL,PARAMETERS,RESPONSEFUNCTION){? var xmlhttp? try{xmlhttp=new ActiveXObject("Msxml2.XMLHTTP")}? catch(e){? try{xmlhttp=new ActiveXObject("Microsoft.XMLHTTP")}? catch(e){? try{xmlhttp=new XMLHttpRequest()}? catch(e){? alert("Your Browser Does Not Support AJAX")}}}? ? err=""? if (GP==undefined) err="GP "? if (URL==undefined) err +="URL "? if (PARAMETERS==undefined) err+="PARAMETERS"? if (err!=""){alert("Missing Identifier(s)\n\n"+err);return false;}? ? xmlhttp.onreadystatechange=function(){? if (xmlhttp.readyState == 4){? if (RESPONSEFUNCTION=="") return false;? eval(RESPONSEFUNCTION(xmlhttp.responseText))? }? }? ? if (GP=="GET"){? URL+="?"+PARAMETERS? xmlhttp.open("GET",URL,true)? xmlhttp.send(null)? }? ? if (GP="POST"){? PARAMETERS=encodeURI(PARAMETERS)? xmlhttp.open("POST",URL,true)? xmlhttp.setRequestHeader("Content-type", "application/x-www-form-urlencoded")? xmlhttp.setRequestHeader("Content-length",PARAMETERS.length)? xmlhttp.setRequestHeader("Connection", "close")? xmlhttp.send(PARAMETERS)? }? }

  Read the article

• How to download file into string with progress callback?

  - by Kaminari

  I would like to use the WebClient (or there is another better option?) but there is a problem. I understand that opening up the stream takes some time and this can not be avoided. However, reading it takes a strangely much more amount of time compared to read it entirely immediately. Is there a best way to do this? I mean two ways, to string and to file. Progress is my own delegate and it's working good. FIFTH UPDATE: Finally, I managed to do it. In the meantime I checked out some solutions what made me realize that the problem lies elsewhere. I've tested custom WebResponse and WebRequest objects, library libCURL.NET and even Sockets. The difference in time was gzip compression. Compressed stream lenght was simply half the normal stream lenght and thus download time was less than 3 seconds with the browser. I put some code if someone will want to know how i solved this: (some headers are not needed) public static string DownloadString(string URL) { WebClient client = new WebClient(); client.Headers["User-Agent"] = "Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US) AppleWebKit/532.5 (KHTML, like Gecko) Chrome/4.1.249.1045 Safari/532.5"; client.Headers["Accept"] = "application/xml,application/xhtml+xml,text/html;q=0.9,text/plain;q=0.8,image/png,*/*;q=0.5"; client.Headers["Accept-Encoding"] = "gzip,deflate,sdch"; client.Headers["Accept-Charset"] = "ISO-8859-2,utf-8;q=0.7,*;q=0.3"; Stream inputStream = client.OpenRead(new Uri(URL)); MemoryStream memoryStream = new MemoryStream(); const int size = 32 * 4096; byte[] buffer = new byte[size]; if (client.ResponseHeaders["Content-Encoding"] == "gzip") { inputStream = new GZipStream(inputStream, CompressionMode.Decompress); } int count = 0; do { count = inputStream.Read(buffer, 0, size); if (count > 0) { memoryStream.Write(buffer, 0, count); } } while (count > 0); string result = Encoding.Default.GetString(memoryStream.ToArray()); memoryStream.Close(); inputStream.Close(); return result; } I think that asyncro functions will be almost the same. But i will simply use another thread to fire this function. I dont need percise progress indication.

  Read the article

• Why the parent page get refreshed when I click the link to open thickbox-styled form?

  - by user333205

  Hi, all: I'm using Thickbox 3.1 to show signup form. The form content comes from jquery ajax post. The jquery lib is of version 1.4.2. I placed a "signup" link into a div area, which is a part of my other large pages, and the whole content of that div area is ajax+posted from my server. To make thickbox can work in my above arangement, I have modified the thickbox code a little like that: //add thickbox to href & area elements that have a class of .thickbox function tb_init(domChunk){ $(domChunk).live('click', function(){ var t = this.title || this.name || null; var a = this.href || this.alt; var g = this.rel || false; tb_show(t,a,g); this.blur(); return false; });} This modification is the only change against the original version. Beacause the "signup" link is placed in ajaxed content, so I Use live instead of binding the click event directly. When I tested on my pc, the thickbox works well. I can see the signup form quickly, without feeling the content of the parent page(here, is the other large pages) get refreshed. But after transmiting my site files into VHost, when I click the "signup" link, the signup form get presented very slowly. The large pages get refreshed evidently, because the borwser(ie6) are reloading images from server incessantly. These images are set as background images in CSS files. I think that's because the slow connection of network. But why the parent pages get refreshed? and why the browser reloads those images one more time? Havn't those images been placed in local computer's disk? Is there one way to stop that reloadding? Because the signup form can't get displayed sometimes due to slow connection of network. To verified the question, you can access http://www.juliantec.info/track-the-source.html and click the second link in left grey area, that is the "signup" link mentioned above. Thinks!

  Read the article

• How can I stop Flash from changing indent when user Clicks on hyperlink in TextField?

  - by Paul Chernoch

  I have a TextField which I initialize by setting htmlText. The text has anchor tags (hyperlinks). When a user clicks on the hyperlink, the indentation of the second and subsequent lines in the paragraph changes. Why? How do I stop it? My html has an image at the beginning of the line, followed by the tag, followed by more text. To style the hyper links to look blue always and underlined when the mouse is over them, I do this: var css:StyleSheet = new StyleSheet(); css.parseCSS("a {color: #0000FF;} a:hover {text-decoration: underline;}"); stepText.styleSheet = css; stepText.htmlText = textToUse; stepText.visible = true; Here is a fragment of the html text (with newlines and exrta whitespace added to improve readability - originally it was one long line): <textformat indent="-37" blockindent="37" > <img src="media/interface/level-1-bullets/solid-circle.png" align="left" hspace="8" vspace="1"/> American Dental Association. (n.d.). <i>Cleaning your teeth and gums (oral hygiene)</i>. Retrieved 11/24/08, from <a href="http://www.ada.org/public/topics/cleaning_faq.asp" target="_blank">http://www.ada.org/public/topics/cleaning_faq.asp </a> </textformat> <br/> As it turns out, the text field is of a width such that it wraps and the second line starts with "Retrieved 11/24/08". Clicking on the hyper link causes this particular line to be indented. Subsequent paragraphs are not affected. ASIDE: The image is a list bullet about 37 pixels wide. (I used images instead of li tags because Flash does not allow nested lists, so I faked it using a series of images with varying amounts of whitespace to simulate three levels of indentation.) IDEA: I was thinking of changing all hyperlinks to use "event:" as the URL protocol, which causes a TextEvent.LINK event to be triggered instead of following the link. Then I would have to open the browser in a second call. I could use this event handler to set the html text to itself, which might clear the problem. (When I switch pages in my application and then come back to the page, everything is OKAY again.) PROBLEM: If I use the "event:" protocol and user tries the right-mouse button click, they will get an error, or so I am told. (See http://www.blog.lessrain.com/as3-texteventlink-and-contextmenu-incompatibilities/ ) I do not like this trade-off.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Using JavaScript to parse an XML file

  - by Chris Clouten

  I am new to Stack OverFlow and coding in general. I am trying to take an XML file and render it in the browser using JavaScript. I have looked around at some sample code of how to do this and came up with the following code: <!DOCTYPE html> <html> <body> <script> if (window.XMLHttpRequest) {// code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp=new XMLHttpRequest(); } else {// code for IE6, IE5 xmlhttp=new ActiveXObject("Microsoft.XMLHTTP"); } xmlhttp.open("GET","social.xml",false); xmlhttp.send(); xmlDoc=xmlhttp.responseXML; document.write("<table border='1'>"); var x=xmlDoc.getElementsByTagName("CD"); for (i=0;i<x.length;i++) { document.write("<tr><td>"); document.write(x[i].getElementsByTagName("c_id")[0].childNodes[0].nodeValue); document.write("</td><td>"); document.write(x[i].getElementsByTagName("facebook_id")[0].childNodes[0].nodeValue); document.write("</td></tr>"); } document.write("</table>"); </script> </body> </html> Anyway, when I run this on my local server none of the data that I am trying to display in the table appears. My .html file and .xml file are in the same folder, so I believe I have the correct file pathway. I could just be making a rookie mistake here, but I can't for the life of me figure out why a table listing the c_id and facebook_id values is not being created. I looked around for answers and haven't been able to find any. Any help would be greatly appreciated. Thanks!

  Read the article

• CSS selectors : should I minimise my use of the class attribute in the HTML or optimise the speed

  - by Laurent Bourgault-Roy

  As I was working on a small website, I decided to use the PageSpeed extension to check if their was some improvement I could do to make the site load faster. However I was quite surprise when it told me that my use of CSS selector was "inefficient". I was always told that you should keep the usage of the class attribute in the HTML to a minimum, but if I understand correctly what PageSpeed tell me, it's much more efficient for the browser to match directly against a class name. It make sense to me, but it also mean that I need to put more CSS classes in my HTML. It also make my .css file a little harder to read. I usually tend to mark my CSS like this : #mainContent p.productDescription em.priceTag { ... } Which make it easy to read : I know this will affect the main content and that it affect something in a paragraph tag (so I wont start to put all sort of layout code in it) that describe a product and its something that need emphasis. However it seem I should rewrite it as .priceTag { ... } Which remove all context information about the style. And if I want to use differently formatted price tag (for example, one in a list on the sidebar and one in a paragraph), I need to use something like that .paragraphPriceTag { ... } .listPriceTag { ... } Which really annoy me since I seem to duplicate the semantic of the HTML in my classes. And that mean I can't put common style in an unqualified .priceTag { ... } and thus I need to replicate the style in both CSS rule, making it harder to make change. (Altough for that I could use multiple class selector, but IE6 dont support them) I believe making code harder to read for the sake of speed has never been really considered a very good practice . Except where it is critical, of course. This is why people use PHP/Ruby/C# etc. instead of C/assembly to code their site. It's easier to write and debug. So I was wondering if I should stick with few CSS classes and complex selector or if I should go the optimisation route and remove my fancy CSS selectors for the sake of speed? Does PageSpeed make over the top recommandation? On most modern computer, will it even make a difference?

  Read the article

• Issues in Ajax based applications

  - by Sinuhe

  I'm very interested in developing Ajax based applications. This is, loading almost all of the content of the application via XMLHttpRequest, instead of only some combos and widgets. But if I try to do this form scratch, soon I find some problems without an easy solution. I wonder if there is some framework (both client and server side) to deal with this issues. As far as I know, there isn't (but I've searched mainly in Java world). So I am seriously thinking of doing my own framework, at least for my projects. Therefore, in this question I ask for several things. First, the possible problems of an ajax based development. Then, I'm looking for some framework or utility in order to deal with them. Finally, if there is no framework available, what features must it have. Here are the issues I thought: 1 - JavaScript must be enabled. Security paranoia isn't the only problem: a lot of mobile devices couldn't use the application, too. 2 - Sometimes you need to update more than one DIV (e.g. main content, menu and breadcrumbs). 3 - Unknown response type: when you make an Ajax call, you set the callback function too, usually specifying if expected response is a javascript object or in which DIV put the result. But this fails when you get another type of response: for example when the session has expired and the user must log in again. 4 - Browser's refresh, back and forward buttons can be a real pain. User will expect different behaviors depending on the situation. 5 - When search engines indexes a site, only follow links. Thus, content load by Ajax won't "exist" for who doesn't know about it yet. 6 - Users can ask for open a link in a different window/tab. 7 - Address bar doesn't show the "real" page you are in. So, you can't copy the location and send it to a friend or bookmark the page. 8 - If you want to monetize the site, you can put some advertisings. As you don't refresh entire page and you want to change the ad after some time, you have to refresh only the DIV where the ad is. But this can violate the Terms and Conditions of your ad service. In fact, it can go against AdSense TOS. 9 - When you refresh an entire page, all JavaScript gets "cleaned". But in Ajax calls, all JavaScript objects will remain. 10 - You can't easily change your CSS properties.

  Read the article

• How to Fix my jQuery code in IE?? Works in Firefox..

  - by scott jarvis

  I am using jQuery to show/hide a div container (#pluginOptionsContainer), and load a page (./plugin_options.php) inside it with the required POST vars sent. What POST data is sent is based on the value of a select list (#pluginDD) and the click of a button (#pluginOptionsBtn)... It works fine in Firefox, but doesn't work in IE.. The '$("#pluginOptionsContainer").load()' request never seems to finish in IE - I only see the loading message forever... bind(), empty() and append() all seem to work fine in IE.. But not load().. Here is my code: // wait for the DOM to be loaded $(document).ready(function() { // hide the plugin options $('#pluginOptionsContainer').hide(); // This is the hack for IE if ($.browser.msie) { $("#pluginDD").click(function() { this.blur(); this.focus(); }); } // set the main function $(function() { // the button shows hides the plugin options page (and its container) $("#pluginOptionsBtn") .click(function() { // show the container of the plugin options page $('#pluginOptionsContainer').empty().append('<div style="text-align:center;width:99%;">Loading...</div>'); $('#pluginOptionsContainer').toggle(); }); // set the loading message if user changes selection with either the dropdown or button $("#pluginDD,#pluginOptionsBtn").bind('change', function() { $('#pluginOptionsContainer').empty().append('<div style="text-align:center;width:99%;">Loading...</div>'); }); // then update the page when the plugin is changed when EITHER the plugin button or dropdown or clicked or changed $("#pluginDD,#pluginOptionsBtn").bind('change click', function() { // set form fields as vars in js var pid = <?=$pid;?>; var cid = <?=$contentid;?>; var pDD = $("#pluginDD").val(); // add post vars (must use JSON) to be sent into the js var 'dataString' var dataString = {plugin_options: true, pageid: pid, contentid: cid, pluginDD: pDD }; // include the plugin option page inside the container, with the required values already added into the query string $("#pluginOptionsContainer").load("/admin/inc/edit/content/plugin_options.php#pluginTop", dataString); // add this to stop page refresh return false; }); // end submit function }); // end main function }); // on DOM load Any help would be GREATLY appreciated! I hate IE!

  Read the article

• Multiple layouts in rails [Newbie Q]

  - by BriteLite

  Hi. As a newb, I decided to build a "home inventory" application. I am now stuck on how to programmatically select a layout based on what type of item it is when viewing it in a browser. According to my planning, so far I should have created a few models to represent types of items I can find in my home: Furniture, Electronics and Books. class Book < ActiveRecord::Base end class Furniture < ActiveRecord::Base end class Electronic < ActiveRecord::Base end Now the Books model has things like isbn, pages, address, and category. Furniture model has things like color, price, address, and category. Electronics has things like name, voltage, address, and category. Here is where I got confused. I know the property address is going to be the same for all of them. I also know that, I will need to create multiple "layouts" for 3 different types of items to show the different properties of said items with appropriate graphics and stylesheets. But how will I go about deciding which category the item is so I can determine which layout to render. According to me, this is how I will do it: class DisplayController < ApplicationController def display @item = Params[:item] if @item.category = "electronics" render :layout => 'electronics' end end In my routes.rb map.display ':item', :controller => 'display', :action => 'display' I only seem to have one concern with this, I probably will add a lot of categories later on and think there should be a more DRY-esque way of dealing, rather than hardcoding them. I understand that I need to add into my layout html tags to display relevant information for that particular category. ----Questions---- Is this the right way to approach this type of problem. Will this approach be compatible when I decide to add a gem like *thinking_sphinx* to run search. What issues do you see with my approach and how can I make it better. I was reading something about "Polymorphic Assoc", does that apply in this case, since category exist for all items? Also, I was trying to get a routes to render a URL like "http://localhost/living-room-tv"

  Read the article

• Moving from Windows to Ubuntu.

  - by djzmo

  Hello there, I used to program in Windows with Microsoft Visual C++ and I need to make some of my portable programs (written in portable C++) to be cross-platform, or at least I can release a working version of my program for both Linux and Windows. I am total newcomer in Linux application development (and rarely use the OS itself). So, today, I installed Ubuntu 10.04 LTS (through Wubi) and equipped Code::Blocks with the g++ compiler as my main weapon. Then I compiled my very first Hello World linux program, and I confused about the output program. I can run my program through the "Build and Run" menu option in Code::Blocks, but when I tried to launch the compiled application externally through a File Browser (in /media/MyNTFSPartition/MyProject/bin/Release; yes, I saved it in my NTFS partition), the program didn't show up. Why? I ran out of idea. I need to change my Windows and Microsoft Visual Studio mindset to Linux and Code::Blocks mindset. So I came up with these questions: How can I execute my compiled linux programs externally (outside IDE)? In Windows, I simply run the generated executable (.exe) file How can I distribute my linux application? In Windows, I simply distribute the executable files with the corresponding DLL files (if any) What is the equivalent of LIBs (static library) and DLLs (dynamic library) in linux and how to use them? In Windows/Visual Studio, I simply add the required libraries to the Additional Dependencies in the Project Settings, and my program will automatically link with the required static library(-ies)/DLLs. Is it possible to use the "binary form" of a C++ library (if provided) so that I wouldn't need to recompile the entire library source code? In Windows, yes. Sometimes precompiled *.lib files are provided. If I want to create a wxWidgets application in Linux, which package should I pick for Ubuntu? wxGTK or wxX11? Can I run wxGTK program under X11? In Windows, I use wxMSW, Of course. If question no. 4 is answered possible, are precompiled wxX11/wxGTK library exists out there? Haven't tried deep google search. In Windows, there is a project called "wxPack" (http://wxpack.sourceforge.net/) that saves a lot of my time. Sorry for asking many questions, but I am really confused on these linux development fundamentals. Any kind of help would be appreciated =) Thanks.

  Read the article

• Jscrollpane causese text to disappear on internet explorer

  - by Crippletoe

  Hello all, in my current site, i am using the new Jscrollpane in order to generate a scrollbar for a menu (not my descision but the designer's descision so i dont wanna get into how 90's that all looks like..). my menu is based on a <UL> the <li> elements inside it have the attribute "text-align: right;". my problem that on IE alone the menu text doesnt show when i apply the ScrollPane to the menu. when i delete the ScrollPane function from my code- the menu re-appears. i checked the page with "microsoft Expression" DOM inspector in order to examine how IE sees my code and i can see the <li> elements there, only the text inside them is missing. when i disable the "text-align: right;" for the <li> in my CSS, the text shows again. i suspect this has something to do with the jScrollPane's containing which is relatively aligned but i cannot be sure.. can anyone suggest some fix for this problem? a link to a page where you can see the problem is here: http://kaplanoland.com/index.php?option=com_content&view=article&id=2&Itemid=12 the problematic menu is on the right side of the page. on every browser but IE you can see the text. only on IE not. my CSS code for that menu (not including the jScrollPane CSS) is here: div#menu2{ position: absolute; top: 123px; right: 36px; width: 330px; height: 150px; } div#menu2_scroll{ /*the actual scroller*/ height: 150px; } div#menu2 div#menu2_contain{ } div#menu2 li{ text-align: right; } div#menu2 li span{ line-height: 18px; } div#menu2 a:link, div#menu2 a:visited{ color: #808285 ; font-family: Arial, Helvetica, sans-serif ; font-size: 12px ; } div#menu2 a:hover, div#menu2 li#current a{ color: #000000 ; font-family: Arial, Helvetica, sans-serif ; font-size: 12px ; } div#menu2 span.separator{ display: block; padding-top: 12px; padding-bottom: 40px; font-family: Arial, Helvetica, sans-serif; font-size: 12px; font-weight: bold; color: #000000; } div#menu2 span.separator span { padding-top: 12px; border-top-width: 1px; border-top-style: solid; border-top-color: #808285; } thank you all so much.

  Read the article

• Unable to decode hex values in javascript tooltip

  - by staudk27

  Hi all, I have quite the process that we go through in order to display some e-mail communications in our application. Trying to keep it as general as possible... -We make a request to a service via XML -Get the XML reply string, send the string to a method to encode any invalid characters as follows: public static String convertUTF8(String value) { char[] chars = value.toCharArray(); StringBuffer retVal = new StringBuffer(chars.length); for (int i = 0; i < chars.length; i++) { char c = chars[i]; int chVal = (int)c; if (chVal > Byte.MAX_VALUE) { retVal.append("&#x").append(Integer.toHexString(chVal)).append(";"); } else { retVal.append(c); } } return retVal.toString(); } We then send that result of a string to another method to remove any other invalid characters: public static String removeInvalidCharacters(String inString) { if (inString == null){ return null; } StringBuffer newString = new StringBuffer(); char ch; char c[] = inString.toCharArray(); for (int i = 0; i < c.length; i++) { ch = c[i]; // remove any characters outside the valid UTF-8 range as well as all control characters // except tabs and new lines if ((ch < 0x00FD && ch > 0x001F) || ch == '\t' || ch == '\n' || ch == '\r') { newString.append(ch); } } return newString.toString(); } This string is then "unmarshal'ed" via the SaxParser The object is then sent back to our Display action which generated the response to the calling jsp/javascript to create the page. The issue is some text can contain characters which can't be processed correctly. The following is eventually rendered on the JSP just fine: <PrvwCommTxt>This is a new test. Have a*&amp;#xc7;&amp;#xb4;)&amp;#xa1;.&amp;#xf1;&amp;#xc7;&amp;#xa1;.&amp;#xf1;*&amp;#xc7;&amp;#xb4;)...</PrvwCommTxt> Which shows up as "This is a new test. Have a*Ç´)¡.ñÇ¡." in the browser. -The following shows up in a tooltip while hovering over the above text: <CommDetails>This is a new test. Have a*Ç´)¡.ñÇ¡.ñ*Ç´)¡.ñ*´)(¡.ñÇ(¡.ñÇ* Wonderful Day!</CommDetails> This then shows up incorrectly when rendered in the tooltip javascript with all the HEX values and not being rendered correctly. Any suggestions on how to make the unknown characters show correctly in javascript?

  Read the article

• Using jQuery to gather all text nodes from a wrapped set, separated by spaces

  - by Bungle

  I'm looking for a way to gather all of the text in a jQuery wrapped set, but I need to create spaces between sibling nodes that have no text nodes between them. For example, consider this HTML: <div> <ul> <li>List item #1.</li><li>List item #2.</li><li>List item #3.</li> </ul> </div> If I simply use jQuery's text() method to gather the text content of the <div>, like such: var $div = $('div'), text = $div.text().trim(); alert(text); that produces the following text: List item #1.List item #2.List item #3. because there is no whitespace between each <li> element. What I'm actually looking for is this (note the single space between each sentence): List item #1. List item #3. List item #3. This suggest to me that I need to traverse the DOM nodes in the wrapped set, appending the text for each to a string, followed by a space. I tried the following code: var $div = $('div'), text = ''; $div.find('*').each(function() { text += $(this).text().trim() + ' '; }); alert(text); but this produced the following text: This is list item #1.This is list item #2.This is list item #3. This is list item #1. This is list item #2. This is list item #3. I assume this is because I'm iterating through every descendant of <div> and appending the text, so I'm getting the text nodes within both <ul> and each of its <li> children, leading to duplicated text. I think I could probably find/write a plain JavaScript function to recursively walk the DOM of the wrapped set, gathering and appending text nodes - but is there a simpler way to do this using jQuery? Cross-browser consistency is very important. Thanks for any help!

  Read the article

• Hidden divs for "lazy javascript" loading? Possible security/other issues?

  - by xyld

  I'm curious about people's opinion's and thoughts about this situation. The reason I'd like to lazy load javascript is because of performance. Loading javascript at the end of the body reduces the browser blocking and ends up with much faster page loads. But there is some automation I'm using to generate the html (django specifically). This automation has the convenience of allowing forms to be built with "Widgets" that output content it needs to render the entire widget (extra javascript, css, ...). The problem is that the widget wants to output javascript immediately into the middle of the document, but I want to ensure all javascript loads at the end of the body. When the following widget is added to a form, you can see it renders some <script>...</script> tags: class AutoCompleteTagInput(forms.TextInput): class Media: css = { 'all': ('css/jquery.autocomplete.css', ) } js = ( 'js/jquery.bgiframe.js', 'js/jquery.ajaxQueue.js', 'js/jquery.autocomplete.js', ) def render(self, name, value, attrs=None): output = super(AutoCompleteTagInput, self).render(name, value, attrs) page_tags = Tag.objects.usage_for_model(DataSet) tag_list = simplejson.dumps([tag.name for tag in page_tags], ensure_ascii=False) return mark_safe(u'''<script type="text/javascript"> jQuery("#id_%s").autocomplete(%s, { width: 150, max: 10, highlight: false, scroll: true, scrollHeight: 100, matchContains: true, autoFill: true }); </script>''' % (name, tag_list,)) + output What I'm proposing is that if someone uses a <div class=".lazy-js">...</div> with some css (.lazy-js { display: none; }) and some javascript (jQuery('.lazy-js').each(function(index) { eval(jQuery(this).text()); }), you can effectively force all javascript to load at the end of page load: class AutoCompleteTagInput(forms.TextInput): class Media: css = { 'all': ('css/jquery.autocomplete.css', ) } js = ( 'js/jquery.bgiframe.js', 'js/jquery.ajaxQueue.js', 'js/jquery.autocomplete.js', ) def render(self, name, value, attrs=None): output = super(AutoCompleteTagInput, self).render(name, value, attrs) page_tags = Tag.objects.usage_for_model(DataSet) tag_list = simplejson.dumps([tag.name for tag in page_tags], ensure_ascii=False) return mark_safe(u'''<div class="lazy-js"> jQuery("#id_%s").autocomplete(%s, { width: 150, max: 10, highlight: false, scroll: true, scrollHeight: 100, matchContains: true, autoFill: true }); </div>''' % (name, tag_list,)) + output Nevermind all the details of my specific implementation (the specific media involved), I'm looking for a consensus on whether the method of using lazy-loaded javascript through hidden a hidden tags can pose issues whether security or other related? One of the most convenient parts about this is that it follows the DRY principle rather well IMO because you don't need to hack up a specific lazy-load for each instance in the page. It just "works". UPDATE: I'm not sure if django has the ability to queue things (via fancy template inheritance or something?) to be output just before the end of the </body>?

  Read the article

• php download file slows

  - by hobbywebsite

  OK first off thanks for your time I wish I could give more than one point for this question. Problem: I have some music files on my site (.mp3) and I am using a php file to increment a database to count the number of downloads and to point to the file to download. For some reason this method starts at 350kb/s then slowly drops to 5kb/s which then the file says it will take 11hrs to complete. BUT if I go directly to the .mp3 file my browser brings up a player and then I can right click and "save as" which works fine complete download in 3mins. (Yes both during the same time for those that are thinking it's my connection or ISP and its not my server either.) So the only thing that I've been playing around with recently is the php.ini and the .htcaccess files. So without further ado, the php file, php.ini, and the .htcaccess: download.php <?php include("config.php"); include("opendb.php"); $filename = 'song_name'; $filedl = $filename . '.mp3'; $query = "UPDATE songs SET song_download=song_download+1 WHER song_linkname='$filename'"; mysql_query($query); header('Content-Disposition: attachment; filename='.basename($filedl)); header('Content-type: audio/mp3'); header('Content-Length: ' . filesize($filedl)); readfile('/music/' . $filename . '/' . $filedl); include("closedb.php"); ?> php.ini register_globals = off allow_url_fopen = off expose_php = Off max_input_time = 60 variables_order = "EGPCS" extension_dir = ./ upload_tmp_dir = /tmp precision = 12 SMTP = relay-hosting.secureserver.net url_rewriter.tags = "a=href,area=href,frame=src,input=src,form=,fieldset=" ; Defines the default timezone used by the date functions date.timezone = "America/Los_Angeles" .htaccess Options +FollowSymLinks RewriteEngine on RewriteCond %{HTTP_HOST} !^(www.MindCollar.com)?$ [NC] RewriteRule (.*) http://www.MindCollar.com/$1 [R=301,L] <IfModule mod_rewrite.c> RewriteEngine On ErrorDocument 404 /errors/404.php ErrorDocument 403 /errors/403.php ErrorDocument 500 /errors/500.php </IfModule> Options -Indexes Options +FollowSymlinks <Files .htaccess> deny from all </Files> thanks for you time

  Read the article

• How can I embed a conditional comment for IE with innerHTML?

  - by Samuel Charpentier

  Ok so I want to conditionally add this line of code; <!--[if ! IE]> <embed src="logo.svg" type="image/svg+xml" /> <![endif]--> Using: document.getElementById("logo") .innerHTML='...'; In a if()/else() statement and it don't write it! If i get rid of the selective comment ( <!--[if ! IE]><![endif]-->) and only put the SVG ( <embed src="logo.svg" type="image/svg+xml" /> ) it work! what should I do? I found a way around but i think in the Android browser the thing will pop up twice. here's what I've done ( and its Validated stuff!); <!DOCTYPE html> <html> <head> <META CHARSET="UTF-8"> <title>SVG Test</title> <script type="text/javascript"> //<![CDATA[ onload=function() { var ua = navigator.userAgent.toLowerCase(); var isAndroid = ua.indexOf("android") > -1; //&& ua.indexOf("mobile"); if(isAndroid) { document.getElementById("logo").innerHTML='<img src="fin_palais.png"/>'; } } //]]> </script> </head> <body> <div id="logo"> <!--[if lt IE 9]> <img src="fin_palais.png"/> <![endif]--> <!--[if gte IE 9]><!--> <embed src="fin_palais.svg" type="image/svg+xml" /> <!--<![endif]--> </div> </body>

  Read the article

• Intent filter for browsing XML (specifically rss) in android

  - by Leif Andersen

  I have an activity that I want to run every time the user goes to an xml (specifically rss) page in the browser (at least assuming the user get's it from the list of apps that can support it). I currently already have the current intent filter: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> </intent-filter> </activity> Now as you can guess, this is an evil intent, as it wants to open whenever a page is requested via http. However, when I ad the line: <data android:mimeType="application/rss+xml"></data> to make it: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> <data android:mimeType="application/rss+xml"></data> </intent-filter> </activity> The application no longer claims to be able to run rss files. Also, if I change the line to: <data android:mimeType="application/xml"></data> It also won't work (for generic xml file even). So what intent filter do I need to make in order to claim that the activity supports rss. (Also, bonus points if you can tell me how I know what URL it was the user opened. So far, I've always sent that information from one activity to the other using extras). Thank you for your help

  Read the article

• Make text in a <div> wrap around a child element.

  - by John

  In Word you can place an image on a page and have the text flow nicely around it. I was wondering how far one can get towards this using CSS, noting that is has to work in IE6. I already have something sort of close using float, but the floated child-element still 'blocks' text above it. So it partially wraps. Is it possible to put a child div at some arbitrary position in the parent, and have text flow around it freely? The actual use-case here is to put illustrations inside the main content , where each illustration is implemented inside a child . I repeat, it has to work on IE6. And I don't want to get too involved in browser-specific hacks... floating the child at least works on IE6 with no tweaking. Currently I have like this: <div> <div class="illustration"> <img src="image1.png" /> <p>Illustration caption</p> </div> <p>Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. Atvero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet. </p> </div> div.illustration { float:right; border-top: 1px solid #505050; border-left: 1px solid #505050; border-right: 1px solid #505050; border-bottom: 1px solid #505050; margin-right:30px; margin-top:100px; text-align:center; padding:2px; background: #96C3FF; } div.illustration p { margin:0; font-size:small; font-style:italic; padding:0; }

  Read the article

• codeIgniter: pass parameter to a select query from previous query

  - by krike

  I'm creating a little management tool for the browser game travian. So I select all the villages from the database and I want to display some content that's unique to each of the villages. But in order to query for those unique details I need to pass the id of the village. How should I do this? this is my code (controller): function members_area() { global $site_title; $this->load->model('membership_model'); if($this->membership_model->get_villages()) { $data['rows'] = $this->membership_model->get_villages(); $id = 1;//this should be dynamic, but how? if($this->membership_model->get_tasks($id)): $data['tasks'] = $this->membership_model->get_tasks($id); endif; } $data['title'] = $site_title." | Your account"; $data['main_content'] = 'account'; $this->load->view('template', $data); } and this is the 2 functions I'm using in the model: function get_villages() { $q = $this->db->get('villages'); if($q->num_rows() > 0) { foreach ($q->result() as $row) { $data[] = $row; } return $data; } } function get_tasks($id) { $this->db->select('name'); $this->db->from('tasks'); $this->db->where('villageid', $id); $q = $this->db->get(); if($q->num_rows() > 0) { foreach ($q->result() as $task) { $data[] = $task; } return $data; } } and of course the view: <?php foreach($rows as $r) : ?> <div class="village"> <h3><?php echo $r->name; ?></h3> <ul> <?php foreach($tasks as $task): ?> <li><?php echo $task->name; ?></li> <?php endforeach; ?> </ul> <?php echo anchor('site/add_village/'.$r->id.'', '+ add new task'); ?> </div> <?php endforeach; ?> ps: please do not remove the comment in the first block of code!

  Read the article

• choosing an image locally from http url and serving that image without a server round trip

  - by serverman

  Hi folks I am a complete novice to Flash (never created anything in flash). I am quite familiar with web applications (J2EE based) and have a reasonable expertise in Javascript. Here is my requirement. I want the user to select (via an html form) an image. Normally in the post, this image would be sent to server and may be stored there to be served later. I do not want that. I want to store this image locally and then serve it via HTTP to the user. So, the flow is: 1. Go to the "select image url":mywebsite.com/selectImage Browse the image and select the image This would transfer control locally to some code running on the client (Javascript or flash), which would then store the image locally at some place on the client machine. Go to the "show image url": mywebsite.com/showImage This would eventually result in some client code running on the browser that retrieves the image and renders it (without any server round trips.) I considered the following options: Use HTML5 local storage. Since I am a complete novice to flash, I looked into this. I found that it is fairly straightforward to store and retrieve images in javascript (only strings are allowed but I am hoping storing base64 encoded strings would work at least for small images). However, how do I serve the image via http url that points to my server without a server round trip? I saw the interesting article at http://hacks.mozilla.org/category/fileapi/ but that would work only in firefox and I need to work on all latest browsers (at least the ones supporting HTML5 local storage) Use flash SharedObjects. OK, this would have been good - the only thing is I am not sure where to start. Snippets of actionscripts to do this are scattered everywhere but I do not know how to use those scripts in an actual html page:) I do not need to create any movies or anything - just need to store an image and serve it locally. If I go this route, I would also use it to store other "strings" locally. If you suggest this, please give me the exact steps (could be pointers to other web sites) on how to do this. I would like to avoid paying for any flash development environment software ideally:) Thank you!

  Read the article

• scrollTo (jQuery) won't work in firefox

  - by William

  For some reason, firefox seems to ignore my scrollTo function even though it works in chrome and safari. Here's an example link: http://blog.rainbird.me/post/2358248459/blowholes-are-awesome Chrome and Safari will automatically scroll to the top of the image (with an offset of 20 pixels) It doesn't work in firefox. I'm baffled! code: $(document).ready(function() { $(".photoShell img").lazyload({ placeholder: "http://william.rainbird.me/boston-polaroid/white.gif", threshold: 200 }); window.viewport = { height: function() { return $(window).height(); }, width: function() { return $(window).width(); }, scrollTop: function() { return $(window).scrollTop(); }, scrollLeft: function() { return $(window).scrollLeft(); } }; $(".photoShell img").hide(); $(".photoShell .caption").hide(); $(".photoShell img").load(function() { var maxWidth = viewport.width() - 40; // Max width for the image if(maxWidth > 960){ maxWidth = 960; } var maxHeight = viewport.height() - 50; // Max height for the image var ratio = 0; // Used for aspect ratio var width = $(this).width(); // Current image width var height = $(this).height(); // Current image height // Check if the current width is larger than the max if(width > maxWidth){ ratio = maxWidth / width; // get ratio for scaling image $(this).css("width", maxWidth); // Set new width $(this).css("height", height * ratio); // Scale height based on ratio height = height * ratio; // Reset height to match scaled image width = width * ratio; // Reset width to match scaled image } // Check if current height is larger than max if(height > maxHeight){ ratio = maxHeight / height; // get ratio for scaling image $(this).css("height", maxHeight); // Set new height $(this).css("width", width * ratio); // Scale width based on ratio width = width * ratio; // Reset width to match scaled image } $(this).parents('div.photoShell').css("width", $(this).width() + 22); $(this).parents('div.photoShell').addClass('loaded'); $(this).next(".caption").show(); var scrollNum = $(this).parents('div.photoShell').offset().top; $.scrollTo(scrollNum - 20, {duration: 700, axis:"y"}); $(this).fadeIn("slow"); }).each(function() { // trigger the load event in case the image has been cached by the browser if(this.complete) $(this).trigger('load'); });

  Read the article

• Simple html page using Bootstrap

  - by Athashri

  I am writing a simple HTML page using the Twitter Bootstrap. But the navbar and links are rendered as normal HTML on the browser. I have referred to multiple sites but the same steps are given everywhere. I am not sure where I am going wrong. Code: <!DOCTYPE HTML> <html> <head> <meta charset="utf-8"> <link rel= "stylesheet" href= "css/bootstrap.css" type="text/css"> <title> Bootstrap example</title> </head> <body> <script src="https://ajax.googleapis.com/ajax/libs/jquery/1.11.0/jquery.min.js"></script> <script src="js/bootstrap.js"></script> <h1>Hello, world!</h1> <div class ="container"> <h1><a href="#">Bootstrap Site</a></h1> <div class="navbar"> <div class="navbar-inner"> <div class="container"> <ul class="nav"> <li class="active"><a href="#">Home</a></li> <li><a href="#">Projects</a></li> <li><a href="#">Services</a></li> <li><a href="#">Downloads</a></li> <li><a href="#">About</a></li> <li><a href="#">Contact</a></li> </ul> </div> </div> </div> </div> </body> </html>

  Read the article

< Previous Page | 525 526 527 528 529 530 531 532 533 534 535 536  | Next Page >